ID: 1178992826

View in Genome Browser
Species Human (GRCh38)
Location 21:37368306-37368328
Sequence GAAGTTTTGTGGCGATACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178992826_1178992830 16 Left 1178992826 21:37368306-37368328 CCTGTGTATCGCCACAAAACTTC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1178992830 21:37368345-37368367 GCACAAACCCACTCTCGCTTCGG 0: 1
1: 0
2: 1
3: 7
4: 82
1178992826_1178992828 -6 Left 1178992826 21:37368306-37368328 CCTGTGTATCGCCACAAAACTTC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1178992828 21:37368323-37368345 AACTTCACCAGTCTATTTATAGG 0: 1
1: 0
2: 1
3: 20
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178992826 Original CRISPR GAAGTTTTGTGGCGATACAC AGG (reversed) Intronic
902747573 1:18483601-18483623 GAATTCTTGGGGGGATACACCGG + Exonic
904018177 1:27440629-27440651 GAAATTTAGTGGCTATTCACAGG + Intronic
906937698 1:50228640-50228662 GAAGTTTTGAGGGCATTCACAGG + Intergenic
910517697 1:88081676-88081698 GAAGTCCTGTGGCTATTCACAGG + Intergenic
917988186 1:180343717-180343739 AAAGTTTTGTGCAGATACAAAGG - Intronic
919611788 1:199754314-199754336 GGAGTTCTGTGGCGATACTGGGG - Intergenic
920090191 1:203447199-203447221 GAAGTTTGGTGGGGTTAGACAGG + Intergenic
922214386 1:223508707-223508729 GGTGTTTTGTGGGGATACATGGG + Intergenic
1074039341 10:109772623-109772645 GATGTTTTGTGGAGGTACAGAGG + Intergenic
1083500467 11:63102623-63102645 CAAGATTTGTGGGGTTACACAGG - Intronic
1088425522 11:109697169-109697191 GATGTTTTGTGGCAAGCCACTGG + Intergenic
1089753497 11:120668668-120668690 GATGTGTTGTGGGGAAACACTGG + Intronic
1090149688 11:124369781-124369803 GAAATTTTGTGGCGTTAGAAGGG + Intergenic
1094651223 12:32377660-32377682 GAAGTTTTGTAGCCACACACAGG + Exonic
1097896347 12:64827407-64827429 GAAGTATAGTGGCTATTCACAGG - Intronic
1108232621 13:48364690-48364712 GAAGTGTAGTGGCTATTCACAGG - Intronic
1125919869 15:43518960-43518982 GAAGTCTTGTGGTGATAAATGGG + Intronic
1129664036 15:77569467-77569489 GAAGTTTTGTGCAGACTCACTGG + Intergenic
1129867694 15:78922027-78922049 GAAGTTGTGGGGAGATCCACTGG - Exonic
1140303788 16:73783381-73783403 GAGGTTTTGGGGACATACACTGG - Intergenic
1157776571 18:50401160-50401182 GAATTTTTGTGGGCACACACTGG - Intergenic
1158571095 18:58597687-58597709 GAAGTGTTCTGGCTATATACAGG - Intronic
1162497314 19:11030532-11030554 GACGTTTTGTGGTGAAACACTGG + Intronic
1164914907 19:32044700-32044722 TGAGTTTTGAGGGGATACACAGG - Intergenic
1165498313 19:36167611-36167633 GAAGTTTTGGGGGGTTACAGGGG - Intergenic
926813061 2:16773560-16773582 GAAGGTCTGTGGCATTACACTGG - Intergenic
928583609 2:32734244-32734266 GGAGTGCTGTGGCGATTCACGGG + Intronic
934250709 2:90352233-90352255 GAGGTTTTGTGCCGAGACAATGG + Intergenic
934658528 2:96130606-96130628 GAAGTGTTGTGGCCTGACACAGG - Intronic
1169994883 20:11545583-11545605 GAAGTTTTGTGGCGATGACTTGG - Intergenic
1178992826 21:37368306-37368328 GAAGTTTTGTGGCGATACACAGG - Intronic
1180914800 22:19478806-19478828 GAAGGTTTGTGTCCATTCACGGG - Intronic
1181390544 22:22577408-22577430 GAACTTTTGTGGCTGCACACTGG + Intergenic
949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG + Intronic
950611712 3:14131264-14131286 GTAGTTTTGTGGCCTTGCACTGG - Intronic
951001685 3:17569040-17569062 AAAGATTTGTAGCCATACACTGG + Intronic
951704523 3:25530196-25530218 GAAGTTTTGTTGAGATATGCAGG + Intronic
956045998 3:65196503-65196525 GAAGTTTTCTGGGAATGCACAGG + Intergenic
956189214 3:66592730-66592752 GAAGTCTTGTGGATATAAACAGG - Intergenic
958569286 3:95859583-95859605 GAAGTTTAGTGGGGAAAGACAGG - Intergenic
964002933 3:151797676-151797698 GAAGGTTTGAGGAGATAGACTGG - Intergenic
972864028 4:43208186-43208208 GAAATTTTCTAGTGATACACTGG + Intergenic
976665477 4:87586048-87586070 GGAGTTTTGGGGCGAGACAATGG - Intergenic
985352823 4:189084404-189084426 GAAGTTTGGTAGAGTTACACGGG + Intergenic
1005085884 6:22006024-22006046 GGAGTTTAGTGGCTATTCACAGG + Intergenic
1006924083 6:37644602-37644624 GAAGATCTGTGGCTATACCCAGG - Exonic
1010486149 6:76417122-76417144 TATGTTTTGTGGCAATGCACAGG + Intergenic
1014263896 6:119252502-119252524 GAAGTTTTGTGGCTGGGCACGGG + Intronic
1017748920 6:157471774-157471796 GATGTTTTCTGGCGAGATACAGG + Intronic
1017865312 6:158438035-158438057 GAAGTGTGGTGGCTATTCACAGG - Intronic
1029291892 7:99508395-99508417 GAAATTTTGTGGCCATAGCCTGG + Intronic
1032559551 7:132874502-132874524 GAAGATTTGTAGAGATCCACAGG + Intronic
1033335099 7:140445504-140445526 GAAGTGTAGTGGCTATTCACAGG + Intergenic
1037852653 8:22345136-22345158 GGAGTATTGTGGCTATTCACAGG - Intronic
1045512732 8:102825549-102825571 GAATTTTTTTGGAGAGACACAGG + Intergenic
1058504547 9:105654972-105654994 GGAGTGTTGTGGCTATTCACAGG + Intergenic
1190069266 X:47266081-47266103 GAAATTTTTTGGTGAGACACTGG + Intergenic
1190077616 X:47329369-47329391 GAAATTTTTTGGTGAGACACTGG - Intergenic
1191742731 X:64452830-64452852 GAAGTTCTGTGTCTATAAACTGG + Intergenic
1193572007 X:83155418-83155440 GGAGTTTTGAGGCGAGACAATGG - Intergenic