ID: 1178994593

View in Genome Browser
Species Human (GRCh38)
Location 21:37387076-37387098
Sequence TTGCACACCCACCTCCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178994593_1178994598 29 Left 1178994593 21:37387076-37387098 CCTAAATGGAGGTGGGTGTGCAA 0: 1
1: 0
2: 2
3: 11
4: 160
Right 1178994598 21:37387128-37387150 ACAAAGAAAGAAAGGGAATTTGG 0: 1
1: 0
2: 17
3: 223
4: 2255
1178994593_1178994597 22 Left 1178994593 21:37387076-37387098 CCTAAATGGAGGTGGGTGTGCAA 0: 1
1: 0
2: 2
3: 11
4: 160
Right 1178994597 21:37387121-37387143 TTCTGTTACAAAGAAAGAAAGGG 0: 1
1: 1
2: 16
3: 152
4: 1091
1178994593_1178994596 21 Left 1178994593 21:37387076-37387098 CCTAAATGGAGGTGGGTGTGCAA 0: 1
1: 0
2: 2
3: 11
4: 160
Right 1178994596 21:37387120-37387142 CTTCTGTTACAAAGAAAGAAAGG 0: 1
1: 2
2: 5
3: 74
4: 623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178994593 Original CRISPR TTGCACACCCACCTCCATTT AGG (reversed) Intronic
902928127 1:19710914-19710936 CTGTTCACCCACCTCCACTTTGG - Intronic
905640822 1:39588637-39588659 TTGCACATCCTACCCCATTTTGG + Intergenic
905882111 1:41470697-41470719 TTGCACTCCTACCACCACTTGGG - Intergenic
906276738 1:44522540-44522562 TTGTCCACCCACCTCAATTAAGG - Intronic
907150621 1:52283692-52283714 CTGCACCCCCACCTCACTTTAGG - Intronic
909041780 1:70661987-70662009 TTGCACACCCATGTTCATTGCGG - Intergenic
910157798 1:84240040-84240062 TTGCACTCCCACTTTCCTTTTGG - Intergenic
911462322 1:98206392-98206414 TTCCACAAACATCTCCATTTTGG + Intergenic
912659078 1:111512742-111512764 TTCCACACCCACCACCCTGTGGG + Intronic
914407441 1:147389907-147389929 CTGCACTCCCACCTCCGTTAGGG - Intergenic
914420509 1:147524367-147524389 TTGCTCAGCCACCTCCCTCTAGG + Intergenic
918332523 1:183472980-183473002 CTCCACACCCACCTCCACTCGGG - Intronic
921031861 1:211341094-211341116 GGGCACACCCACCCCCATTTGGG + Intronic
921812792 1:219533515-219533537 TTCCACACCCACCTCCCTTGGGG + Intergenic
923845325 1:237724164-237724186 ATGCACACACACATACATTTAGG - Intronic
923937717 1:238781864-238781886 TTGCTCCCACACCACCATTTTGG + Intergenic
1064546100 10:16451262-16451284 TGGCAGACCCACCTTCATTCTGG - Intronic
1068483398 10:57624700-57624722 TTGCACACCCATCACATTTTGGG + Intergenic
1070285842 10:75083177-75083199 TGGCACCCCCACCTACATCTGGG + Intergenic
1072757087 10:98028834-98028856 TTGAACATCCACCTACATTCAGG + Intronic
1073631074 10:105149668-105149690 ATGCCCACCCACCCCTATTTGGG - Intronic
1073994653 10:109301566-109301588 TAGCACAAGCAACTCCATTTTGG + Intergenic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1076461885 10:130653425-130653447 GTGCTCACGCACGTCCATTTTGG - Intergenic
1078340144 11:10492820-10492842 TCCCACAACCTCCTCCATTTGGG - Intronic
1083304585 11:61755804-61755826 CTGCACACCCACCTGCTTTCTGG - Intronic
1083376731 11:62229564-62229586 TAGCACAAGCAACTCCATTTTGG - Intergenic
1084937683 11:72595783-72595805 TTGAACCCCCACCTCCATACAGG + Intronic
1085483660 11:76843423-76843445 TAGCACAAGCAACTCCATTTTGG - Intergenic
1089563702 11:119359140-119359162 TTGCTCACCCTCCTTCCTTTGGG - Intronic
1096165895 12:49423750-49423772 TTACACAACAACATCCATTTAGG - Intronic
1097341007 12:58438241-58438263 TTGCAGTCCCACCTCCAATTGGG - Intergenic
1099997680 12:89796668-89796690 TTGCATTCTCATCTCCATTTGGG + Intergenic
1104142152 12:125998491-125998513 TTCCAAATCCACCACCATTTTGG + Intergenic
1108216756 13:48192952-48192974 CTGTACCCCCACCTCCAGTTAGG + Intergenic
1108855782 13:54791157-54791179 ATGCACAACTACCTCCCTTTAGG + Intergenic
1110608276 13:77459628-77459650 CTGCAAATCCAGCTCCATTTTGG - Intergenic
1112335430 13:98511358-98511380 TTGCATCCCCACCAGCATTTGGG - Intronic
1113315077 13:109170751-109170773 TTTCACAAACATCTCCATTTTGG - Intronic
1114919788 14:27312174-27312196 TAGCACAAACAACTCCATTTTGG - Intergenic
1116348695 14:43830482-43830504 TTTCACACCCTCCTCCATTTTGG - Intergenic
1118967865 14:70604833-70604855 TGCCACAGCCACCTCCCTTTTGG - Intergenic
1120232079 14:81850759-81850781 TAGCACAAGCAACTCCATTTTGG + Intergenic
1123994273 15:25707326-25707348 GTCCACCCCCACCTCCATCTCGG - Intronic
1125334933 15:38617693-38617715 TTGCACTTCCAACTCCATCTTGG + Intergenic
1126371797 15:47955173-47955195 TTTCACACCCACATTCATTAAGG + Intergenic
1127308398 15:57729918-57729940 TTGCACACTAATCTCCATCTCGG - Intronic
1131360014 15:91782387-91782409 TTGCACACTTACCTCCACGTGGG + Intergenic
1135464878 16:22676657-22676679 TTGCTCCCCCACCTCCAATTGGG - Intergenic
1140195609 16:72852543-72852565 TTGCACAGCTGTCTCCATTTTGG - Intronic
1140224335 16:73066401-73066423 CGGCACACCCATCTCCATTTCGG + Intergenic
1146453234 17:32991100-32991122 CTGCACACCCACCACCATCCTGG + Intronic
1147301661 17:39533716-39533738 TCTCACCCCCACCCCCATTTTGG + Exonic
1149215611 17:54350476-54350498 TTTCTCACACACCTCTATTTTGG + Intergenic
1155242436 18:23876509-23876531 TTACACAGCGACCTCTATTTAGG - Intronic
1157180432 18:45493010-45493032 TTCCACACTCACCTCTCTTTGGG + Intronic
1157586852 18:48806528-48806550 CTGCAAACTCACCTTCATTTCGG - Intronic
1164749666 19:30643303-30643325 TCTCACATCCACCTCCAATTAGG - Intronic
1166242618 19:41504578-41504600 GTGCACACCCACCACGATGTGGG + Intergenic
1167866805 19:52335547-52335569 AGGCAGACCCACCTCAATTTGGG + Intergenic
925091943 2:1163279-1163301 TCACACACCCACCTCCTGTTGGG - Intronic
925091979 2:1163448-1163470 TCACACACCCACCTCCTGTTGGG - Intronic
926969432 2:18452090-18452112 ATGCACACAAAGCTCCATTTTGG + Intergenic
927299595 2:21496660-21496682 TTGCTCACTCCCCTCTATTTTGG + Intergenic
928249660 2:29664420-29664442 TTGTACTCCCACTTCCATTTGGG + Intronic
928410856 2:31052875-31052897 TTGGACACCCAGTTCTATTTCGG - Intronic
929440467 2:41962287-41962309 TTGCTCACCCACCTGTAGTTTGG + Intergenic
935332962 2:101990605-101990627 TTGCTCAACAAACTCCATTTTGG + Intergenic
936489308 2:112956718-112956740 TTCCCCACCCTCCTCCACTTGGG - Intergenic
937377778 2:121349377-121349399 TTGCACCCCCTCCTCCAGTTGGG - Intronic
938768759 2:134481996-134482018 TCTCACCGCCACCTCCATTTTGG - Intronic
939003699 2:136763623-136763645 CTGCACACACACCCCCATATGGG - Intergenic
939244053 2:139599910-139599932 TTGCACACCTAATTCCATCTAGG + Intergenic
944905526 2:204257965-204257987 ATGCACACACACTTCCCTTTTGG + Intergenic
945696981 2:213119182-213119204 TTGCAAACCCACTTCCCTTGTGG - Intronic
947958738 2:234217034-234217056 TTAAACACCCTCATCCATTTTGG - Intergenic
948555264 2:238805735-238805757 CTAGACACCCACCTGCATTTTGG - Intergenic
1169510815 20:6261961-6261983 AGGCAGACCCACCTCCATCTGGG + Intergenic
1169766099 20:9149793-9149815 CTGCACACCAACCTCCAGTTGGG - Intronic
1170677906 20:18499418-18499440 TAGCACAAGCAACTCCATTTTGG - Intergenic
1177120649 21:17133099-17133121 TTGCACTCCCTCCTCCCTTAGGG - Intergenic
1177491183 21:21828354-21828376 TAGCACACCCACCTCCTTTTTGG - Intergenic
1177534179 21:22402762-22402784 TAGCACAAGCAACTCCATTTTGG - Intergenic
1178994593 21:37387076-37387098 TTGCACACCCACCTCCATTTAGG - Intronic
1183127339 22:35796161-35796183 TTACATCCCCACCTCCATGTGGG + Intronic
1184045433 22:41969900-41969922 CTGCACAGCCACATCCACTTGGG - Intergenic
1184494240 22:44828294-44828316 TTGCACTCCCACCACCCCTTAGG + Intronic
952253788 3:31678422-31678444 CTGCACAGCCACCTCCTTGTCGG + Intronic
957693685 3:83604649-83604671 ATGCACAATCACCTCAATTTGGG - Intergenic
958002687 3:87771599-87771621 TTGCAACCCCACCCCCATCTTGG - Intergenic
958883446 3:99698995-99699017 TTTCACATCCTCCTTCATTTTGG - Intronic
962353884 3:134677489-134677511 GTGCCCACCTACCTCCATCTGGG + Intronic
964955688 3:162353336-162353358 GTGCTGACCCACCTCCATTATGG - Intergenic
965407800 3:168292389-168292411 TTGCACACCCCCCTCCTATGTGG - Intergenic
970353761 4:15232270-15232292 ATGCACGTCCACCTCCATTATGG - Intergenic
972868950 4:43272084-43272106 CTGCAGACACAGCTCCATTTAGG - Intergenic
979400822 4:120247229-120247251 TGGCCCACCCACCCCCATTCTGG - Intergenic
979813445 4:125067562-125067584 TTGAAAAACCACCTTCATTTTGG - Intergenic
981116586 4:140998040-140998062 TTGCACACTGACTTCAATTTAGG + Intronic
983468359 4:168123985-168124007 TTGCACAGCCACTCCCATTCAGG + Intronic
984282395 4:177687200-177687222 TTACTCACCCACATCCTTTTTGG - Intergenic
984400027 4:179251480-179251502 TCTCACACCCAACACCATTTTGG + Intergenic
985919723 5:2960807-2960829 TTTCATCCCCACCTGCATTTTGG - Intergenic
989249222 5:39289368-39289390 TTGCACACAAACCTCCTCTTAGG - Intronic
989337461 5:40335756-40335778 TACCACACCCAACTCAATTTTGG - Intergenic
989598708 5:43182053-43182075 TAGCACAAGCAACTCCATTTTGG + Intronic
992546385 5:77817861-77817883 TTGCACACTGAACTCTATTTTGG + Intronic
994208132 5:97059121-97059143 GTGCACTCCCACTTCCATTAGGG + Intergenic
994342863 5:98652361-98652383 TAGTACACCCACCTTCTTTTAGG - Intergenic
995972671 5:117991548-117991570 TTGCACACTCACTTCATTTTTGG + Intergenic
997574418 5:134963113-134963135 TTGTAAACCCACCTCTCTTTAGG + Intronic
997587028 5:135049284-135049306 TTCCCCAGCCACCTTCATTTAGG + Intronic
999630100 5:153562027-153562049 TTCCACCCTCATCTCCATTTAGG - Intronic
999630115 5:153562157-153562179 TTCCACCCTCACCTCCATTTAGG - Intronic
1000258951 5:159567644-159567666 TTGCTCACCCAGCTCCATGGAGG + Intergenic
1001137856 5:169117308-169117330 TTGCTCACTCACTTCCAGTTTGG - Intronic
1002648022 5:180671904-180671926 TTCCACACCCATCCCAATTTGGG + Intergenic
1007117424 6:39353143-39353165 TTGCACTCCCACAGCCACTTTGG - Intronic
1009363807 6:62842738-62842760 GTGTACACCCACTTCAATTTTGG - Intergenic
1009367522 6:62867249-62867271 GTGCACACCCACTGCGATTTTGG + Intergenic
1011616872 6:89205501-89205523 TTGAACACCCACTTTTATTTTGG + Intronic
1011735734 6:90309144-90309166 AGGCACACCCACCTTCATCTTGG + Intergenic
1012260688 6:97083966-97083988 TAGCACACACTCCTCCTTTTGGG - Intronic
1013787301 6:113796109-113796131 TTGCACACCCAACTGCTGTTTGG - Intergenic
1014667487 6:124257651-124257673 GTGCAAACCCATCTCTATTTTGG - Intronic
1015821855 6:137269797-137269819 TTGCCCTCCCACCTCATTTTGGG - Intergenic
1017753894 6:157513490-157513512 TTGCACCCCGAGCTCCATCTGGG + Intronic
1024345771 7:48311365-48311387 TTGCAAACCCACCTCTATCTTGG + Intronic
1024595200 7:50927316-50927338 TTGCATTCCCACCTGAATTTTGG + Intergenic
1024997850 7:55287572-55287594 CTGCTCACCCTCCTCCACTTAGG - Intergenic
1025194506 7:56922428-56922450 CTGCACACCCACATACATTGCGG - Intergenic
1025677446 7:63654521-63654543 CTGCACACCCACGTACATTGCGG + Intergenic
1026322647 7:69280928-69280950 TCACTCACTCACCTCCATTTAGG + Intergenic
1027485826 7:78760731-78760753 TTGCACACACACTTACATATCGG - Intronic
1027976021 7:85156967-85156989 ATGCAAACACACTTCCATTTGGG - Intronic
1028759517 7:94480028-94480050 TTGCACTCTAACCTCCTTTTAGG + Intergenic
1041519633 8:58740982-58741004 CTGCAAACACACTTCCATTTTGG + Intergenic
1041649906 8:60292088-60292110 TTAGACACCCACATGCATTTGGG + Intergenic
1042756441 8:72218713-72218735 CTGAACACCCACCTACATTTTGG + Intergenic
1044585788 8:93868324-93868346 TTGGACAGCCAACACCATTTTGG - Intronic
1045435795 8:102162495-102162517 TTTCCCACCCACCTACAGTTAGG - Intergenic
1048099942 8:131340362-131340384 TTGCACATCGAATTCCATTTTGG - Intergenic
1048154424 8:131931039-131931061 ATGCACACCCACGTTCATTCGGG - Intronic
1052856450 9:33409812-33409834 TTGCACACCCATGTTCATATCGG - Intergenic
1053145363 9:35708207-35708229 TTGCACACACAGCTTCTTTTTGG - Intronic
1056921264 9:90791323-90791345 TATCACACCCTCCTCCTTTTTGG - Intergenic
1057951057 9:99369414-99369436 ATGCACACCCACATTCAATTCGG + Intergenic
1058129424 9:101233242-101233264 TCACACACCTACCTCCAGTTTGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1188151221 X:26678366-26678388 TAGAACATCCACATCCATTTGGG - Intergenic
1188885793 X:35547281-35547303 CTGCACTCCCACCTCCCTTAGGG - Intergenic
1190823715 X:53997717-53997739 GGCCACACCCACCTCCCTTTTGG + Intronic
1194781688 X:98030749-98030771 TTGTTCACCCATCTCCATGTAGG + Intergenic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1196400725 X:115313193-115313215 TTACACAAGCAACTCCATTTTGG + Intergenic
1198013318 X:132582458-132582480 TTTTACACCAACCTACATTTAGG - Intergenic