ID: 1178996485

View in Genome Browser
Species Human (GRCh38)
Location 21:37405341-37405363
Sequence AAGAATTAGGAAAAGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 524}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178996485_1178996489 7 Left 1178996485 21:37405341-37405363 CCTGCATCCTTTTCCTAATTCTT 0: 1
1: 1
2: 2
3: 45
4: 524
Right 1178996489 21:37405371-37405393 GTTCTGTTTTCTTCAACTATAGG 0: 1
1: 0
2: 4
3: 30
4: 317
1178996485_1178996490 8 Left 1178996485 21:37405341-37405363 CCTGCATCCTTTTCCTAATTCTT 0: 1
1: 1
2: 2
3: 45
4: 524
Right 1178996490 21:37405372-37405394 TTCTGTTTTCTTCAACTATAGGG 0: 1
1: 0
2: 1
3: 47
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178996485 Original CRISPR AAGAATTAGGAAAAGGATGC AGG (reversed) Intronic
902959032 1:19949029-19949051 AAGAATGAGGGAATGGATGGAGG - Intergenic
903051370 1:20603668-20603690 AAGAAATAGGAAATGAATACTGG + Intronic
904246295 1:29190463-29190485 AAGAAAAAGGTACAGGATGCAGG + Intergenic
904678551 1:32213319-32213341 AAAAATTATTAAGAGGATGCAGG - Intronic
904835552 1:33333319-33333341 AAGAATGAGGAAAAGGCAGATGG + Intronic
905563461 1:38945084-38945106 AGGAATCAGGAATAGGAAGCTGG - Intergenic
906268287 1:44452106-44452128 AATCAGTAGGAAAAGGATGATGG - Intronic
906762507 1:48388587-48388609 AAGAATCAGAAAAATAATGCAGG + Intronic
906884700 1:49631690-49631712 AAGACTAAGGGAAAGGAAGCAGG + Intronic
907827903 1:58036601-58036623 AAAAATTAGTAGAAGGCTGCAGG - Intronic
908205153 1:61839782-61839804 AGGAATGAGGAATAGGATGTAGG - Intronic
908625239 1:66032948-66032970 AAGAATTAGATAAATGAGGCCGG - Intronic
909242955 1:73238324-73238346 AAAAATTAGCATAAGAATGCTGG + Intergenic
909529554 1:76667072-76667094 AAGAATTAAAATTAGGATGCAGG - Intergenic
909977095 1:82058063-82058085 AAGAGTTAGGAGAATGATGTTGG + Intergenic
910125125 1:83832196-83832218 AAAAATGAGGAAAAGGATGCAGG + Intergenic
910585425 1:88873936-88873958 AAGAATGGGGAAATGGATGTTGG + Intronic
910832929 1:91478574-91478596 AAGAAATAGGAAAGGGAGGGAGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
912577661 1:110688654-110688676 AAGACATAGGAAAAGCATGAGGG + Intergenic
912687253 1:111777293-111777315 AAGAAGTAGGAAAAGGAGGTAGG + Intronic
912747435 1:112256918-112256940 TATACTTAGAAAAAGGATGCAGG - Intergenic
912901780 1:113658806-113658828 AAAAATTAGAAAAAGGTTTCTGG + Intronic
913046764 1:115080249-115080271 AAGAATTAGGAGAAAGACGATGG + Intronic
913180356 1:116314769-116314791 AATAATTAGAAAAATGATTCTGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
915849034 1:159301371-159301393 AAGAATTAGTAAAGGAATCCTGG + Intronic
916469882 1:165112759-165112781 AAGCATTTTTAAAAGGATGCAGG - Intergenic
917329406 1:173866966-173866988 AAGAATTGGGGAAAGTATGGTGG - Intergenic
917477832 1:175384186-175384208 TGAAATTAAGAAAAGGATGCAGG + Intronic
917627543 1:176861511-176861533 AAGCATTAGGAAAAGTCAGCAGG + Exonic
917830639 1:178881325-178881347 AAGGGTAAGGAAAAGTATGCTGG + Intronic
917905013 1:179579912-179579934 AAGAAATGGGAAGAGGATGGAGG + Intergenic
917940610 1:179916985-179917007 AGGGATAAAGAAAAGGATGCAGG - Intronic
918818472 1:189222917-189222939 GAGAATTAGGTAAAGGCTGTAGG + Intergenic
919018257 1:192069030-192069052 AAGAACTAGAAAAAGCAGGCTGG + Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921561606 1:216665779-216665801 CAAAATTAGGTACAGGATGCTGG - Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922842712 1:228656977-228656999 AAGAAATAGAAAAAAGAGGCTGG + Intergenic
923154105 1:231261041-231261063 GAGTATTAGGAAAAGGATAAAGG - Intronic
1062793981 10:328673-328695 ATGCATTAGGAAAACAATGCAGG + Intronic
1063915687 10:10879753-10879775 AAGGATTAAGAACAGGATGTCGG - Intergenic
1064609362 10:17081471-17081493 AAGAATTAAAAAAAGAATGTTGG - Intronic
1065287728 10:24201941-24201963 AAGAATTGGGAATGGGGTGCTGG - Intronic
1065867115 10:29923976-29923998 GATAATTAGGGAAAGGAAGCAGG + Intergenic
1067268013 10:44764104-44764126 AGGCATTAGGTAAAGGATGGTGG - Intergenic
1067675903 10:48376716-48376738 AAAAATCAGGAAACAGATGCTGG + Intronic
1067998145 10:51299500-51299522 AAGAATGAGCAAAAAGAGGCGGG - Intronic
1068176599 10:53468093-53468115 AAGTATTAGGAAAACGAAGAAGG - Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068595397 10:58897741-58897763 AAGAATTGGAAATAGGATGCAGG - Intergenic
1071120705 10:82274352-82274374 CAGAATTAGAAGAAGGTTGCAGG - Intronic
1071604629 10:86976664-86976686 AAAAAATAGGAAAAGTATCCAGG + Intronic
1072047364 10:91670573-91670595 AAGAATAAAGAAAAGGATTCAGG + Intergenic
1072377785 10:94835785-94835807 TAGAATTAGGAAAAGGAAAAAGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1074212148 10:111345108-111345130 AAGAATGAGTATAAGGATGTGGG + Intergenic
1074519659 10:114207653-114207675 AAGAATGAGGAAGATGAAGCTGG + Intronic
1075049611 10:119173231-119173253 AAGAATTAGAAAAAGCAGCCGGG - Intronic
1075904154 10:126065939-126065961 CAGCATTAGGAAGAGGATGAAGG + Intronic
1077698699 11:4419425-4419447 AAGAATCAGAAAAAGGGTGGTGG + Intergenic
1077746249 11:4909483-4909505 GAGAATTAGAAAAAGGAAACGGG + Intronic
1079182519 11:18205836-18205858 AAGAATTAGAAAAATAATTCAGG + Intronic
1079392331 11:20033477-20033499 AAGAATTTGGAACAGGATGGAGG + Intronic
1079432374 11:20405105-20405127 AAGAAGGAAGAAAAGGAGGCTGG - Intronic
1080331546 11:31145636-31145658 TTGAATGAGGAAAAGTATGCGGG + Intronic
1080582753 11:33657309-33657331 AAGAAATAAGAAATTGATGCTGG - Intronic
1083091652 11:60206093-60206115 AAGCAGAAGGAAAAGGATGGGGG + Intronic
1084712964 11:70855478-70855500 AAGAATCAGGAAGGGGAAGCTGG - Intronic
1085426253 11:76407141-76407163 AGACATTATGAAAAGGATGCTGG + Exonic
1085632781 11:78133129-78133151 AAGTATTAGGAAGAAGAGGCTGG - Intronic
1085793464 11:79516241-79516263 AATAATAAGGAAAGGGATGGAGG - Intergenic
1086165219 11:83769916-83769938 CAGACTTAGGAAGAGGAAGCAGG - Intronic
1086254928 11:84864392-84864414 AAGAATGAGGAAATTGATCCAGG - Intronic
1086553557 11:88082740-88082762 AAAAATTAGGAGAGTGATGCTGG - Intergenic
1086879694 11:92138844-92138866 AAAAATTAGGAAAAGGAGTGAGG + Intergenic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1087284269 11:96247774-96247796 AAGAATTGGGAAGAAGGTGCTGG - Intronic
1087460572 11:98440373-98440395 AAGAAATAGGTAAATGAGGCTGG - Intergenic
1087702165 11:101447520-101447542 AATAATTAGGACAAAAATGCAGG + Intergenic
1087968106 11:104444023-104444045 AACAACCAGGAAAAGGATGCAGG - Intergenic
1089203072 11:116736877-116736899 AGGCAGGAGGAAAAGGATGCAGG - Intergenic
1089385797 11:118066989-118067011 AGGGATTAAGAGAAGGATGCAGG - Intergenic
1090312076 11:125749890-125749912 AGGAATTAGGAAGAGGTTGGAGG - Intergenic
1091265061 11:134264046-134264068 TAAAATTAGGAAAAGTAGGCTGG + Intronic
1091306187 11:134537555-134537577 AAGAATGAGCAAAGGGACGCTGG - Intergenic
1092205034 12:6609516-6609538 AAGAATGAGGGAAACAATGCTGG - Intergenic
1092800995 12:12166799-12166821 ATGAATTAGGAAAATGAGGCTGG + Intronic
1093395964 12:18682748-18682770 AAGAACTAGCATAAGAATGCAGG + Intergenic
1093677186 12:21956848-21956870 AAATACTAGGAAAAAGATGCTGG - Intergenic
1093957201 12:25234271-25234293 AAGACTAGGGAAAAGAATGCAGG + Intronic
1094118796 12:26946827-26946849 AGGGATTAGGAAAAGGAAGGAGG - Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095897967 12:47299784-47299806 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1096471480 12:51879889-51879911 AAGACTTAAGAAAAGAAGGCCGG + Intergenic
1097569191 12:61310281-61310303 ATAAATTAGGAAAAGGAAGATGG + Intergenic
1097998557 12:65916797-65916819 AAGAATTGAGGGAAGGATGCAGG + Intronic
1098349892 12:69547473-69547495 AAGAATTACGAGATGGATGATGG + Intronic
1098395033 12:70008021-70008043 AAGAAGCAGGAAAAAGAGGCGGG - Intergenic
1098431043 12:70420493-70420515 AAGAATGCAGGAAAGGATGCTGG + Intronic
1098521417 12:71438861-71438883 AAAAAGGAGGAAAAGGATTCAGG - Intronic
1098952095 12:76650251-76650273 AAGAATTAAGAAAATGAAGGAGG - Intergenic
1099909374 12:88810947-88810969 AAGAATGAGCACCAGGATGCTGG - Intergenic
1100211184 12:92400210-92400232 AAGTTTCAGAAAAAGGATGCTGG + Intergenic
1100877271 12:98975308-98975330 AAGAAGGAGGAAAAGGAAGAAGG - Intronic
1101294145 12:103403384-103403406 AAAAAAAAGAAAAAGGATGCAGG + Intronic
1101828318 12:108238167-108238189 GAGAATGAGGAATAGGATGTGGG - Intronic
1102013513 12:109633197-109633219 GAGCATTAAAAAAAGGATGCTGG + Intergenic
1102247557 12:111364938-111364960 AAGAATTTGGGGAAAGATGCAGG + Intronic
1102990133 12:117309481-117309503 AAGCATCAGGAAAATGAAGCCGG + Intronic
1104151210 12:126085116-126085138 AAGAATTAGGAAAAAGTTGAAGG - Intergenic
1105576096 13:21653629-21653651 AAGATCTAGGAAAATGATTCAGG + Intergenic
1106232967 13:27836130-27836152 AAGACTTAGGGACAAGATGCGGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108427503 13:50318820-50318842 AAGCAGGAGGAAAAGGAAGCAGG - Intronic
1108696056 13:52903411-52903433 AAGAATTAGGATTAGAATCCAGG + Intergenic
1109143067 13:58740512-58740534 AAGAATGAAGAAATGGAAGCTGG - Intergenic
1109203824 13:59459891-59459913 AAGAAGCTGAAAAAGGATGCAGG + Intergenic
1109215477 13:59584746-59584768 CAGAATTAGTACAGGGATGCAGG + Intergenic
1109341283 13:61062773-61062795 AAGCATAAGGAAAAGGTTGATGG - Intergenic
1109963251 13:69659357-69659379 AAGAATAAGGAAAAGAATAAAGG - Intergenic
1110552816 13:76827616-76827638 AAAAAAAAGGGAAAGGATGCTGG - Intergenic
1110710457 13:78645394-78645416 ATGAATTGAGAAAAGGATTCGGG - Intronic
1110951410 13:81497006-81497028 ATGAATCAGCAAATGGATGCTGG + Intergenic
1111035095 13:82661743-82661765 AGGCAATAGGATAAGGATGCAGG + Intergenic
1111037126 13:82690494-82690516 AAGAATTAGGTAAATGATGATGG - Intergenic
1111213595 13:85113410-85113432 AAGAAGTAGAGAAAGGATGCAGG - Intergenic
1111639793 13:90953339-90953361 ATGAATCCGGTAAAGGATGCGGG - Intergenic
1111830500 13:93323306-93323328 AAGTAATAGGAAAAGAATGTGGG + Intronic
1111934771 13:94547629-94547651 AAAGAGTAGGGAAAGGATGCAGG - Intergenic
1112350984 13:98632823-98632845 AAGAAACAGAAAAAGGAGGCCGG - Intergenic
1112724136 13:102282348-102282370 AAGAAGTAGGGATAGGAGGCTGG - Intronic
1112804212 13:103145075-103145097 AAGAATCAAGAAAAGCATGTGGG + Intergenic
1112869547 13:103953273-103953295 AGGAAGAAGGAAAAGGGTGCAGG - Intergenic
1113072220 13:106433148-106433170 TAGATTGAGGAAAAAGATGCTGG - Intergenic
1113157246 13:107337697-107337719 AAGAGTTAAGAAAAGTATCCAGG + Intronic
1113239211 13:108317504-108317526 AAGAATTAGAAAAACAATGCAGG + Intergenic
1113303875 13:109054965-109054987 AAGAAGGAGGAAAAGGAGGGAGG - Intronic
1113659563 13:112096304-112096326 TACAATTAGGAAAAGGAGACAGG + Intergenic
1113694381 13:112333358-112333380 AAGGATTAGGAAGAAAATGCAGG - Intergenic
1114689994 14:24572626-24572648 AAGGTTTAGGACAAGCATGCGGG + Intergenic
1115428384 14:33287605-33287627 AAGTAGTAGGAGAGGGATGCAGG - Intronic
1117239495 14:53815139-53815161 TATAAATAGGAAAAGTATGCTGG + Intergenic
1118573263 14:67215580-67215602 CAGAAATAGGAAAGGGATACGGG + Intronic
1119750677 14:77075307-77075329 AAGAAGTTGGAAGAGGATGCTGG + Intergenic
1119847525 14:77841398-77841420 AAGAGTTAGGAACAGCAGGCTGG + Intronic
1120649137 14:87110012-87110034 AAAAATTAGGAAGAGGAGTCAGG - Intergenic
1120846049 14:89126008-89126030 AAGGAAAAGGACAAGGATGCAGG - Intronic
1121465575 14:94113526-94113548 TAGAAGTAGGAAAAGGTTGGAGG + Intronic
1121620428 14:95344033-95344055 AAGAATAAGAATAAGGATCCAGG + Intergenic
1122766583 14:104075997-104076019 AAGAATTTGGAAAAGGTGGAAGG + Intergenic
1123825975 15:24082511-24082533 AAGAATTTGGAAAAACAGGCTGG - Intergenic
1123937147 15:25199539-25199561 GAGAATTTGGAAGAGGATGCTGG + Intergenic
1123941472 15:25218709-25218731 AGAATTTTGGAAAAGGATGCTGG + Intergenic
1124011440 15:25842403-25842425 AAGAAACAGTAAAAGGACGCTGG - Intronic
1124656355 15:31512106-31512128 AAGACTGAGGAAAAAGCTGCGGG - Intronic
1124845686 15:33287809-33287831 GAGAATGAGGAAAATGATCCAGG - Intergenic
1125146427 15:36474216-36474238 AAGAATCAGATAAAGGATGGAGG + Intergenic
1125208806 15:37186918-37186940 AAAAGTTAGGAAACAGATGCTGG + Intergenic
1125980003 15:43991885-43991907 ACTAATTAGTAAAAGGATGCAGG - Intronic
1126712253 15:51472119-51472141 AAGAAATAGCAAAAGGATTCAGG + Intronic
1127829718 15:62739623-62739645 AACAAATAGGAAAAGGAACCTGG + Intronic
1128715401 15:69904216-69904238 CAGAATTAGGGAAGGGCTGCAGG + Intergenic
1129898185 15:79123992-79124014 AAGAATTATGACAGGGATGGAGG + Intergenic
1130807813 15:87344951-87344973 AAAATTTAAGAAAACGATGCAGG - Intergenic
1130914395 15:88293446-88293468 AAGAAAGAGGAGATGGATGCAGG + Intergenic
1131030623 15:89183588-89183610 AGGGATCAGGACAAGGATGCTGG - Intronic
1131902160 15:97099676-97099698 AAGAACTATGACAATGATGCTGG - Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1133846711 16:9461049-9461071 AAGAAGGAGGAAAAGGATGCAGG + Intergenic
1134050822 16:11136010-11136032 AACAATGAAAAAAAGGATGCTGG - Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1135292015 16:21248002-21248024 AAGAAGAAAGAAAAGGATGTTGG - Intronic
1135394654 16:22122102-22122124 AAGAAGAAGGAAAAGAATGATGG + Intronic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135805740 16:25540859-25540881 AAAAAGAAGGAAAAGGATTCTGG + Intergenic
1136505899 16:30702878-30702900 AAGCATTAAGAAATGGAAGCTGG - Intronic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1136939665 16:34510988-34511010 AAGAAGGAGGAAAAGGAGGGCGG - Intergenic
1136960155 16:34837572-34837594 AAGAAGGAGGAAAAGGAGGGCGG + Intergenic
1137413104 16:48245888-48245910 TAGAGTTAGGAATAGGAGGCGGG - Intronic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139616229 16:68095107-68095129 AAGAAAGAGAAAATGGATGCTGG + Intronic
1140930590 16:79624042-79624064 AGGATTCAGGAAAATGATGCTGG - Intergenic
1141711412 16:85701386-85701408 AAGAAGAAGGAAAAAGATGAAGG - Intronic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1143320866 17:6068191-6068213 AAGAAAAAGCAAAAGGCTGCTGG - Intronic
1143772640 17:9178454-9178476 GAGAATTAGGAAGAGGAGGGAGG - Intronic
1144313777 17:14039322-14039344 ATGAATTTGGAAAAGTAAGCAGG - Intergenic
1144406910 17:14960735-14960757 AGGAATGAGGAAAAAGATGATGG - Intergenic
1144500400 17:15781545-15781567 AAGAAGTAAGAAAAGCAGGCCGG - Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145783932 17:27582033-27582055 AAGAGTTAGGAAAGGGAAGCTGG - Intronic
1146105463 17:30031723-30031745 AAGAATAATGATAATGATGCTGG + Intronic
1146605597 17:34255120-34255142 AGGAAGTAGGAAAGGGAAGCAGG - Intergenic
1147870244 17:43582001-43582023 GAGAATTAGGAAGAAGATGGTGG - Intergenic
1148148513 17:45381469-45381491 AAACATTAAGAAAATGATGCCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149895004 17:60422408-60422430 AAGAATGAGGAAATGGGAGCGGG + Intronic
1150203447 17:63380614-63380636 AAGAATTCTGAAAAGGCTGTAGG - Intronic
1150828244 17:68495393-68495415 AATAAATAAGAAAAGGAGGCTGG - Intergenic
1150872828 17:68932328-68932350 AAGAGAGAGGAAAAGGATGAAGG - Exonic
1151435637 17:74095119-74095141 AACCATCAGGAAAATGATGCTGG - Intergenic
1152370115 17:79882032-79882054 ATGAATTTGGAAAAGGTTGCTGG - Intergenic
1153973779 18:10248848-10248870 GAGAATATGGAAAATGATGCAGG + Intergenic
1155284643 18:24275165-24275187 ATGGAATTGGAAAAGGATGCAGG + Intronic
1155304060 18:24462134-24462156 AAGAATGAGCAAAGGCATGCTGG + Intronic
1155762273 18:29583440-29583462 AGGTATAAGGAAAAGGATGGAGG + Intergenic
1156298435 18:35814288-35814310 AAGAAATGGGGAAAGGATTCTGG + Intergenic
1156633489 18:38997296-38997318 AAGAATTAGGAACAAGATGGTGG - Intergenic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1158288889 18:55916848-55916870 AAGTATCAGGAAGAGGTTGCAGG + Intergenic
1158408057 18:57177940-57177962 AAGAAGGAGGAAAAGGGTTCAGG + Intergenic
1160664521 19:318758-318780 AAAAATCAGTAAAAGGAGGCTGG + Intronic
1161359537 19:3839759-3839781 AAGAAAAAGGAATAGGATCCAGG - Intronic
1161927593 19:7312817-7312839 AAGAATTAGGGAAAGAAGGCTGG - Intergenic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1165677907 19:37744248-37744270 AGAGATTAGGAAAAGGAGGCTGG + Intronic
1165881627 19:39048049-39048071 AAGAATTGGGCATGGGATGCTGG + Intergenic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166209864 19:41299409-41299431 AAGACATAGGAACAGGGTGCTGG - Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925610670 2:5698474-5698496 AAGAATTAATAAGAGAATGCTGG - Exonic
925862241 2:8190475-8190497 AAGAAGAAGGAAAAGAATGAAGG - Intergenic
926465828 2:13185851-13185873 AAGAATTAGGGAAATTATGTAGG + Intergenic
927046800 2:19287175-19287197 AAGAATTTGCAAAAGAAAGCAGG - Intergenic
927178271 2:20425281-20425303 AAAAAAGAGAAAAAGGATGCAGG + Intergenic
927415282 2:22872882-22872904 GATAAGTAGGAGAAGGATGCTGG - Intergenic
927928980 2:27032183-27032205 AAGAACAAGGAAGAGGATGGGGG - Intergenic
928540401 2:32278599-32278621 AAGAATGAGAAAAAGGAAGGAGG + Intronic
928702305 2:33911387-33911409 AAGAAATAGGAAATGAATGATGG + Intergenic
929763697 2:44826700-44826722 AAGAAATAGGAAAGGCCTGCTGG + Intergenic
929969949 2:46565332-46565354 AGGAAGTAGGAGAAGAATGCTGG + Intronic
930026152 2:47030279-47030301 AAGGATTAGGAAAAAATTGCTGG + Intronic
930636317 2:53809757-53809779 AATAATTAAGAAAATGAGGCCGG + Intronic
931166608 2:59755739-59755761 CACAATTAGGAAAAGCATGAGGG - Intergenic
931326835 2:61234585-61234607 AAGAAATAGGAAGATGATGTTGG + Intronic
931866041 2:66412919-66412941 AAGAAATAAGACAAAGATGCTGG - Intergenic
932068905 2:68596166-68596188 AAGATTTGAGAAAAGGGTGCTGG - Intronic
932672321 2:73748962-73748984 AAGAAAAAGAAAAAGGACGCTGG - Intergenic
932747566 2:74346515-74346537 AATAAATAGGAAAAAGAAGCTGG - Intronic
934133924 2:88976834-88976856 TAGAAATAGGAAAAGGTAGCTGG + Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
938143723 2:128817048-128817070 AAGAACTGGGTAAAGGATCCAGG + Intergenic
939700359 2:145384117-145384139 AGGAAGTATGAAAAGTATGCAGG + Intergenic
940206092 2:151203303-151203325 AACACTCAGGAAAAGGATGAAGG + Intergenic
941209334 2:162617181-162617203 AAGAATTTAGAAAAGCAGGCTGG + Intronic
941322800 2:164076259-164076281 ATAAATTAGGCAAAGGATTCAGG - Intergenic
942258340 2:174130006-174130028 AAGAATTAGGGCAAGGCTTCCGG + Intronic
942343293 2:174973122-174973144 AAGAGTTAGAAAGAGAATGCTGG + Intronic
943121935 2:183747268-183747290 AAGAATTTGGTAAAGGATGTTGG - Intergenic
943690193 2:190861713-190861735 AAGAAGTAGGAAAAGGATGCTGG + Intergenic
945072572 2:206006105-206006127 AAGAAATGGGAAGAGGATGAGGG - Intronic
945665042 2:212730560-212730582 AAGAATTAGAAAAAAGCTGTAGG + Intergenic
946866825 2:224048494-224048516 AAGAATGAGGAAAAGGAAGAGGG + Intergenic
947040339 2:225911195-225911217 AAGAATTAGGCATAGGAAGTAGG - Intergenic
947220856 2:227791184-227791206 AAGAAATAAGAAAAGCATGTGGG + Intergenic
947298129 2:228656017-228656039 TAGAAATAGTAAAAGAATGCAGG - Intergenic
947374574 2:229482615-229482637 AAGAATCATGAGAGGGATGCAGG + Intronic
947452857 2:230224399-230224421 AACAAGAAGGAAAAGTATGCTGG - Intronic
947845320 2:233239149-233239171 AAGAAGCAGGAAATGGCTGCTGG - Intronic
1173537007 20:43823156-43823178 GACAGTTAGGAAAAGGATACAGG - Intergenic
1173992691 20:47315457-47315479 AAGAATTAGGAAATGCCTGCTGG + Intronic
1174045656 20:47730815-47730837 AAGAATAAGGAAAAGCATACTGG - Intronic
1175346631 20:58283418-58283440 GACAATTAGGAAAATGAAGCTGG + Intergenic
1175630391 20:60530592-60530614 AAGATGCAGGAAAGGGATGCTGG - Intergenic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1178665126 21:34540025-34540047 AAGAATGGGGAAAATAATGCAGG - Intronic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1179445943 21:41430373-41430395 AAAACATAGGAAAAGGATTCTGG + Intronic
1179460051 21:41528520-41528542 AACAATGAGGAAAACGATGGAGG + Intronic
1180229471 21:46418378-46418400 CAGAACCAGGCAAAGGATGCAGG - Intronic
1181455199 22:23055446-23055468 AAGGATTAGAGAAAGGATGAGGG - Intergenic
1183041153 22:35178968-35178990 AAGAAATAGTAAAAGGAGGAAGG - Intergenic
1184002113 22:41682593-41682615 AAGAATTAGGTGAAGGATGGAGG + Intronic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
949186205 3:1194976-1194998 AAGGCATATGAAAAGGATGCTGG - Intronic
949547544 3:5084677-5084699 AAGAGTTAGGAAAAAGAGGAGGG - Intergenic
949809717 3:7993184-7993206 ATGTGTTAGGAAAAGGATGGGGG - Intergenic
951722412 3:25714398-25714420 AAGAAATAGGAAAGGGGTGTTGG + Intergenic
951755186 3:26083285-26083307 AAAAATCAGGAAAATAATGCAGG - Intergenic
951823998 3:26846840-26846862 AAGTATTAAGAAAAGAATGAAGG + Intergenic
952464559 3:33568177-33568199 AAGAATTAGAAATAGCTTGCAGG - Intronic
952539711 3:34355052-34355074 AATAATTAGGAAGAGTATGAGGG - Intergenic
952688550 3:36176675-36176697 AAGAATTTGGAAAAGCCTGGAGG + Intergenic
953597650 3:44333546-44333568 AAGTATTAGGATGAAGATGCAGG + Intergenic
955100843 3:55848312-55848334 AATAATTAGGAAAAAGAGGGAGG - Intronic
955215580 3:56982698-56982720 ATGAATGAGGAAATGGATGATGG + Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
955628403 3:60945888-60945910 AAGTATTAGGTAAACAATGCAGG + Intronic
956018473 3:64909241-64909263 AAGACTTAGGAAAAGCAAGAAGG + Intergenic
956444294 3:69310355-69310377 CAGCATTATGAAAAGAATGCTGG + Intronic
956642244 3:71426199-71426221 AAGAATCAGGCAAAGGAGTCAGG + Intronic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
957540923 3:81567952-81567974 AAGAAATAGGAAAGGCAGGCAGG - Intronic
957658545 3:83115757-83115779 AAGAGTCATGAAAAGCATGCTGG - Intergenic
957744779 3:84325349-84325371 CAGAAATAGGAAAATGATACAGG + Intergenic
957885005 3:86275488-86275510 AAGAACTAAGAAAAGGAGGCAGG - Intergenic
959108077 3:102088959-102088981 AAGAATCAGATAAATGATGCAGG - Intergenic
959268518 3:104173893-104173915 AATAATTATGTAAAGGATGATGG + Intergenic
959755800 3:109897515-109897537 AAGAATTAGGGAAATGAAGCAGG - Intergenic
960004973 3:112772511-112772533 AGGAATGAGGAAGAGGATGGAGG - Intronic
960967298 3:123114257-123114279 AAGAATGAGTGAAAGGCTGCAGG + Intronic
962071954 3:132043069-132043091 AAGGAACATGAAAAGGATGCAGG + Intronic
963376787 3:144477413-144477435 AAGTATTAGAAAATGAATGCTGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
965134535 3:164744649-164744671 GAAAATTAGCAAAAGGATCCTGG + Intergenic
965339145 3:167464359-167464381 GAGAATTAGGAAAGGGATAAAGG + Intronic
965782038 3:172296345-172296367 AAGAATTAGGAACAGGAAAGGGG - Intronic
966211315 3:177456345-177456367 AAGAATTAGTAAAGGAATGAAGG + Intergenic
966211976 3:177462981-177463003 AAGAAGAGGGAAAAGGGTGCTGG + Intergenic
967200706 3:187070267-187070289 AAGAAATAGCGAATGGATGCTGG + Intronic
967510053 3:190300689-190300711 AAAAAATAGGAAAAGGCAGCAGG - Intergenic
967521767 3:190440413-190440435 AAGAATGAGGTAGAGTATGCAGG + Intronic
967735093 3:192943361-192943383 GAGACTTAGAAAAAGGAGGCTGG + Intergenic
967960638 3:194920329-194920351 AATAAATAAGAAAAAGATGCTGG - Intergenic
968359906 3:198139613-198139635 GAGAATTAGGAAGAGGAAGAGGG + Intergenic
970329029 4:14959912-14959934 AAAAATTAGGATAAGGATGAAGG + Intergenic
970637314 4:18022669-18022691 AAGGACTAGGAAAAAGATGCGGG + Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
971797626 4:31249282-31249304 AAAAATTGGGAAAAGGCTCCAGG + Intergenic
971861082 4:32106892-32106914 AGGATTTAGAAAAATGATGCAGG - Intergenic
971926209 4:33012519-33012541 AAGGATTAGAAAAGGGATTCAGG + Intergenic
972663566 4:41142084-41142106 AAGATGGAGGAAAAGGATGCTGG + Intronic
974104069 4:57447795-57447817 AGAAAATGGGAAAAGGATGCAGG + Intergenic
974302517 4:60086536-60086558 AACAGTCAGGAAACGGATGCTGG + Intergenic
974316233 4:60284790-60284812 AAGAAGGAGGAAAAAGATGAGGG - Intergenic
975197549 4:71543153-71543175 AAGAATTAGCTAAATGAGGCTGG + Intronic
975739282 4:77413076-77413098 AGGAAGGAGGACAAGGATGCTGG - Intronic
975858705 4:78652813-78652835 GTGAATAAGGAAAATGATGCAGG - Intergenic
975941177 4:79648655-79648677 AGGAATTAGGAAGGCGATGCGGG + Intergenic
976288739 4:83396052-83396074 AAGGAGTAGGAAAAGCCTGCTGG + Intergenic
976788066 4:88845153-88845175 AAAAATGAGGAAAAGGATGTTGG + Intronic
977168923 4:93735970-93735992 AAGAATGAGAAAGAGGATACTGG + Intronic
977201812 4:94124818-94124840 AAAAATTAGGTCAAGGGTGCAGG - Intergenic
977318240 4:95478308-95478330 AAGAATAAGGACAAGGATTGGGG + Intronic
977351059 4:95888068-95888090 AAGAATTAGAAAAAGAATTCAGG - Intergenic
977790371 4:101093109-101093131 AAAAGTCAGGAAATGGATGCTGG - Intronic
978612497 4:110558985-110559007 GAGTATTAGGATAACGATGCTGG + Intronic
978622006 4:110641866-110641888 AAGAATAAGCAAAAGGAAGGAGG - Intronic
978903527 4:113980179-113980201 AAGGAATAGGAAAATGATGGGGG - Intergenic
979906716 4:126302351-126302373 AAGATATAGGAAAAGTATTCAGG - Intergenic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
981169841 4:141609024-141609046 CAGAACTGGGAAAAGGATGGAGG + Intergenic
981221751 4:142244881-142244903 AAAAGTTAGGAAACAGATGCTGG - Intronic
981658206 4:147136339-147136361 AGTAATTTGGAAAAGGATGCTGG - Intergenic
981838853 4:149087793-149087815 AAGAATAAGGAAGATGATGTGGG - Intergenic
982661399 4:158211014-158211036 AAGAATTGGGAAAAATGTGCTGG + Intronic
982986922 4:162221574-162221596 AAGAATGAGGACACGGATGCTGG + Intergenic
984817333 4:183850846-183850868 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817343 4:183850906-183850928 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817346 4:183850918-183850940 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817349 4:183850930-183850952 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817401 4:183851295-183851317 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817404 4:183851307-183851329 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817407 4:183851319-183851341 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817432 4:183851483-183851505 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817448 4:183851579-183851601 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817455 4:183851615-183851637 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817473 4:183851723-183851745 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817486 4:183851807-183851829 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817498 4:183851867-183851889 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817509 4:183851927-183851949 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817523 4:183851999-183852021 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817526 4:183852011-183852033 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817536 4:183852071-183852093 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817539 4:183852083-183852105 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817542 4:183852095-183852117 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817545 4:183852107-183852129 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817554 4:183852155-183852177 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817557 4:183852167-183852189 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817560 4:183852179-183852201 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817567 4:183852215-183852237 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817570 4:183852227-183852249 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817573 4:183852239-183852261 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817588 4:183852323-183852345 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817599 4:183852395-183852417 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817613 4:183852479-183852501 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817616 4:183852491-183852513 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817619 4:183852503-183852525 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817622 4:183852515-183852537 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984817625 4:183852527-183852549 AAGGATGAGGGAAAGGATGAGGG + Intergenic
984848435 4:184129162-184129184 AAGAAATAAGAAATGAATGCTGG + Intronic
985135977 4:186786543-186786565 AAGAAAAATGAAAATGATGCTGG + Intergenic
986535775 5:8785459-8785481 AAGGTGTAGGAAAGGGATGCTGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986954175 5:13130473-13130495 AAAAATCAGGAAACAGATGCTGG + Intergenic
987542535 5:19274618-19274640 AAGAATTACTAACAGGGTGCAGG - Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988151419 5:27386861-27386883 AAAAATTAGGAAAATGATTTTGG - Intergenic
988854746 5:35217027-35217049 AAGACTTGGGAAGAGGATGAGGG - Intronic
988929643 5:36024457-36024479 AAGAATCAGAAAAAGAATCCTGG + Intergenic
990517105 5:56540491-56540513 AAGAATTTGGCCAAGGAAGCTGG + Intronic
990834382 5:59999840-59999862 TGAAATTAGGAAAATGATGCAGG + Intronic
991624122 5:68580711-68580733 AAAAATTAGAAAAAAGCTGCCGG + Intergenic
992208660 5:74455786-74455808 AATAATTAAGAAAAGAAAGCTGG + Intergenic
992975713 5:82117256-82117278 AAGAATTAGGAAATGGAATGAGG + Intronic
993039715 5:82800075-82800097 AAAACTTAGGAAAAGGAAGGAGG - Intergenic
993302917 5:86235591-86235613 GAGGATGAGGAAAAGGATGGGGG + Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994679264 5:102865557-102865579 AAGAAGTAGGAAAAGAAAACAGG + Intronic
994848459 5:105021404-105021426 AAGAATTAGGCAAATCATGATGG + Intergenic
995126134 5:108578379-108578401 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
995402979 5:111762395-111762417 AAGCATGAGGAAAAGGGAGCTGG - Intronic
995630109 5:114123657-114123679 AAAAATTAAGAAAATGAGGCCGG - Intergenic
996224657 5:120977066-120977088 AAGAAATAGGAAAAGCATAGAGG + Intergenic
996950714 5:129121833-129121855 AATAATGAGGAAAAGGAGGAGGG + Intergenic
997326457 5:133026078-133026100 AGGAAGTAGGAAAAGGCAGCTGG + Intronic
997760376 5:136442162-136442184 TAGAATTAGGAAAAGGACAAAGG - Intergenic
998238903 5:140425176-140425198 TAGATTTAGGAAAAGCATGATGG + Intronic
998949213 5:147374916-147374938 AAGAATATGAAAAACGATGCTGG + Intronic
998975586 5:147642963-147642985 AAGAATCAGGAGAAAGATGTAGG - Intronic
1001252229 5:170155180-170155202 AAGCATGAGGAGAAGGATGAGGG + Intergenic
1001945649 5:175775369-175775391 CAGAGTTTGGAAAAGGATGGGGG - Intergenic
1002918590 6:1548840-1548862 AAAAAGTAGGAAAAGAATCCAGG + Intergenic
1002941579 6:1721168-1721190 AAATATTAGGAAAAGTTTGCGGG + Intronic
1003058585 6:2844130-2844152 AAGAATTTGGAGATGCATGCTGG - Intergenic
1003574196 6:7277579-7277601 AAGAATTTGTAAAAGGAGGCTGG - Intronic
1003853098 6:10244724-10244746 AAGAATTTGGAAAAGTTTGGTGG + Intergenic
1003969987 6:11290147-11290169 AAGAATGAGGAAATGGACACAGG - Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004535154 6:16493245-16493267 ATGAAGTTGGAAAAGCATGCTGG - Intronic
1004596538 6:17104621-17104643 AGGAAGTAGAAAAAGGATCCAGG - Intronic
1005231793 6:23710193-23710215 AAGCATAAGCAAAAGGAAGCAGG + Intergenic
1005319445 6:24638462-24638484 AAGAATTAGAAAGAGGCAGCCGG + Intronic
1005422554 6:25667667-25667689 AAGAAGAAGGAACAGGATGAAGG - Intronic
1007133777 6:39501081-39501103 AAGAATGAAGAAAAGGGTGACGG + Intronic
1007202041 6:40117761-40117783 AAGTATTAGGAAAAGCATTTTGG - Intergenic
1007709921 6:43816207-43816229 AGCAAATAGGAACAGGATGCTGG + Intergenic
1007838843 6:44698948-44698970 AAGAATAAGGAATGGGATGTTGG + Intergenic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1009351625 6:62687379-62687401 AAAAAATAGGAAAGAGATGCTGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010457688 6:76077243-76077265 ATGAATGTGGATAAGGATGCAGG - Intergenic
1010526647 6:76907808-76907830 ATGAAGGAGGAAAAGAATGCTGG - Intergenic
1010738141 6:79466528-79466550 AAAAATTACAAAAAGAATGCAGG + Intergenic
1010799656 6:80160451-80160473 AACAATTAAGAAAAAGAAGCCGG - Intronic
1011953045 6:92991355-92991377 GAGAATTAGAAAAGGGATCCGGG - Intergenic
1012486412 6:99726275-99726297 AAGAATTAGGAACAAGATGGTGG - Intergenic
1013390798 6:109684576-109684598 AAAAAGTAGGCAAAGGAGGCCGG + Intronic
1013706660 6:112843140-112843162 AAAAATTAGCTAATGGATGCTGG - Intergenic
1013806301 6:113999611-113999633 ATGAATTTGGAAAAGGAGGGAGG + Intronic
1013940236 6:115652326-115652348 AACATTTAGGAAATGGATTCTGG - Intergenic
1014076068 6:117235931-117235953 AGGAATTATGAAAAGATTGCTGG + Intergenic
1014236455 6:118961840-118961862 GAGAATTAGGAATGGGATCCAGG + Exonic
1014518892 6:122414094-122414116 AAAAAATCGGAAAACGATGCAGG + Intronic
1015237603 6:130988790-130988812 AAGAATGAAGGAAAGGAGGCTGG + Intronic
1015957518 6:138614018-138614040 AAGAATTAGAAAAGGGATATTGG - Intronic
1016040324 6:139426105-139426127 AATAATTAGGGAAAGGAAGGTGG + Intergenic
1016058916 6:139607950-139607972 GAGAATTGGGAAAAGGAGGAAGG - Intergenic
1016168915 6:140983812-140983834 GAGAATGAGGAAGAGGTTGCAGG - Intergenic
1017420745 6:154269787-154269809 AAGAATTAGGAAAAGAAATGAGG + Intronic
1017429006 6:154352009-154352031 AAGAATAAGCTAATGGATGCTGG + Intronic
1017681201 6:156865821-156865843 AAGAATTAAGAAAAGGAAAAAGG - Intronic
1017689980 6:156954846-156954868 AGGAATTAAGAATAGGGTGCAGG - Intronic
1018073637 6:160190082-160190104 AAGACTTATGATAAGGATACAGG + Intronic
1018804298 6:167246986-167247008 GAGAGTTAGCAAAAGCATGCAGG - Intergenic
1019260082 7:77036-77058 GAGAATTAGGAAGAGGAAGAGGG - Intergenic
1020660389 7:10974273-10974295 AAGACTTAGGGAGAGGCTGCAGG - Exonic
1020975626 7:15002832-15002854 AAAAATAAAGAAAAGGATGATGG - Intergenic
1020976381 7:15012349-15012371 CAGAAATAGGAACATGATGCGGG + Intergenic
1021321770 7:19221242-19221264 AAAAATCATTAAAAGGATGCTGG - Intergenic
1021370031 7:19833348-19833370 AAGAATTTTGAAATGGATACTGG - Intergenic
1021609670 7:22445075-22445097 AAGAATTTGGACAATGATGCCGG + Intronic
1021786175 7:24155033-24155055 AGAAAAAAGGAAAAGGATGCTGG - Intergenic
1023245239 7:38196142-38196164 TGGAATTAGAAAAAGGATGTGGG + Intronic
1023736186 7:43237970-43237992 CAGAATTATGCAAAGGATACAGG - Intronic
1024019645 7:45354708-45354730 ACGTATAAGGAAAAGGATGTTGG + Intergenic
1024033375 7:45484112-45484134 AGGAAAGAGGAAAAGGAGGCAGG + Intergenic
1024456321 7:49611659-49611681 GAGAATTAAGAAAAAAATGCTGG + Intergenic
1024724858 7:52181637-52181659 AAAAATTAGCAAAAGGATCATGG + Intergenic
1026258585 7:68734420-68734442 AAGAAGTAGGACAAGAAGGCCGG - Intergenic
1027688028 7:81302433-81302455 ATCAATTAGGAAAAGTATGAAGG - Intergenic
1027837196 7:83259680-83259702 AAGAATGTGCAGAAGGATGCAGG - Intergenic
1028015334 7:85703844-85703866 GAGGGTTAGGAAAATGATGCTGG + Intergenic
1030027549 7:105339680-105339702 ATGAATTAGGACCAGGATCCTGG - Intronic
1030198562 7:106877842-106877864 AAAAATAATGCAAAGGATGCGGG - Intronic
1030249236 7:107423898-107423920 AAAAATAATGAAAAGAATGCAGG + Intronic
1030735228 7:113040168-113040190 AAGAATAACAAAAAGTATGCAGG - Intergenic
1030777757 7:113556077-113556099 AAGGTTTAGGGAATGGATGCAGG + Intergenic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1032425987 7:131822511-131822533 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
1032438140 7:131919388-131919410 GAGAAGTATGACAAGGATGCTGG + Intergenic
1033152343 7:138926264-138926286 AAGAAAAAGGAAAAAGTTGCTGG - Intronic
1033894907 7:146057440-146057462 AAGAATTAGAAAAATGTAGCAGG - Intergenic
1034052257 7:147995807-147995829 AAGAATTCGGACAGGGAGGCCGG - Intronic
1035034440 7:155885870-155885892 AGGAAGAAGGAAAAGGATGGGGG - Intergenic
1035839537 8:2795558-2795580 AAGGAAAAGGAAAAGGATGGAGG + Intergenic
1036335815 8:7869032-7869054 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1036682463 8:10885581-10885603 AAGAATTAGGAAAAAGACATGGG - Intergenic
1037041694 8:14244258-14244280 AAGAATGAGGAAGAGGAAGAAGG - Intronic
1037505439 8:19524876-19524898 AAGAATCAGGCAAAAGATGCTGG + Intronic
1038962739 8:32539365-32539387 AAGAATGAGGAAGAGGACCCAGG + Intronic
1041037045 8:53803038-53803060 AAGAAGTAGAGAAAGGAGGCTGG + Intronic
1041565105 8:59268311-59268333 AAGAATTAGGATTAGGATTATGG - Intergenic
1041666899 8:60454601-60454623 AAGAATGAGAAAAAGGGTGGAGG + Intergenic
1042256160 8:66806009-66806031 AAGAAATATGAAAAAGGTGCAGG - Intronic
1042945048 8:74146007-74146029 AAGACTTAGGAAAAGCAGGTGGG + Intergenic
1043458423 8:80435275-80435297 AAGAATTAGGGAAAGAATTCAGG - Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044391823 8:91661125-91661147 AGGAAATAGGATTAGGATGCAGG - Intergenic
1044478495 8:92656560-92656582 AAGAATAAGGAAAACAAAGCTGG + Intergenic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1044830120 8:96239009-96239031 AAGAATAAGGAAAAGGAAAGTGG - Intergenic
1045578668 8:103453962-103453984 AAGAATAAGGTGAAGGATGGTGG + Intergenic
1046491088 8:114953492-114953514 AAGTATTAGGGGGAGGATGCAGG - Intergenic
1046906843 8:119582608-119582630 GAAAATTAAGAAAAGGAGGCAGG + Intronic
1047232396 8:123008666-123008688 AAGAAGGAGGAAACGGATGCTGG - Intergenic
1047234174 8:123024594-123024616 ATGAAGTCAGAAAAGGATGCTGG + Intronic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048523705 8:135181441-135181463 AAAAATTAAGAAGAGGACGCTGG - Intergenic
1048642023 8:136374331-136374353 AAGAATTACGAATACGATGAGGG + Intergenic
1050326133 9:4499434-4499456 AAGAATTAGGAAAAGAAACTGGG + Intronic
1050491109 9:6188733-6188755 CAGCATTAACAAAAGGATGCTGG + Intergenic
1050734419 9:8747274-8747296 TAGAATTAGGAAAAGGAAAAAGG + Intronic
1051014209 9:12455832-12455854 CAGAAGGAGGAAATGGATGCTGG + Intergenic
1051474493 9:17490093-17490115 TAGAAATAGGAAAAGTAGGCTGG + Intronic
1052527500 9:29637268-29637290 AAAAATTAGGGAAAGTATTCAGG + Intergenic
1052701937 9:31948318-31948340 AAAAGTCAGGAAAAAGATGCTGG - Intergenic
1055852163 9:80644764-80644786 AGGAATTAGGGAAAGGAAGGAGG + Intergenic
1058007086 9:99928209-99928231 AAGAATTAGGAACAGAATCATGG - Intronic
1058995423 9:110294154-110294176 AGGAATGAGGAAAAGAGTGCTGG - Intergenic
1059082366 9:111264159-111264181 ATGACTTAGGAAAAGAAGGCTGG - Intergenic
1059178574 9:112190378-112190400 AAAAATCAGGAAACAGATGCTGG - Intergenic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1059475895 9:114547383-114547405 AAGAATTAGGAAGAGCATCAAGG + Intergenic
1059710172 9:116860587-116860609 AAGAATCATGGAAAGGAGGCTGG - Intronic
1059901304 9:118929073-118929095 AAGAAGTAGGAAAAGGTTAAGGG + Intergenic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185989197 X:4873899-4873921 AAGAGTTATGAAAATGATGAAGG + Intergenic
1186090032 X:6037015-6037037 AAGAATTTGGAAAATGATATGGG + Intronic
1186238495 X:7540838-7540860 AATAATTTGGAACAGGATGAAGG + Intergenic
1186490570 X:9969174-9969196 AATACTTAGGAAAAAGAGGCCGG - Intergenic
1186826208 X:13342333-13342355 AAGAAAAAGTAAAAGGATCCTGG - Intergenic
1186894483 X:13992372-13992394 GACATTTAAGAAAAGGATGCAGG + Intergenic
1187164835 X:16795483-16795505 AAGAATGAGTAAAAGGATCCGGG - Intronic
1187966861 X:24620457-24620479 AAGACTTGGGACAAGGATTCAGG + Intronic
1188918485 X:35941908-35941930 AAGAATTAGTAAAAGCCTTCTGG - Intronic
1189148857 X:38684166-38684188 AAGTATTAGGAAAACTAAGCTGG + Intronic
1193197053 X:78644363-78644385 AAGAAATAAAAAAAGGATACAGG + Intergenic
1193594290 X:83426978-83427000 AAGCAATGGGAAAAGGATGCTGG + Intergenic
1194471331 X:94301827-94301849 AAGAATCAGAAAAAGAATTCTGG - Intergenic
1194543520 X:95204436-95204458 AAGAATAATGAAAAGAAAGCAGG - Intergenic
1194622179 X:96186932-96186954 AAGAATTTGAAAAAGGATAGTGG - Intergenic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195012353 X:100745209-100745231 AAATTTTAGGAAAAGGAAGCAGG - Intergenic
1196051395 X:111309254-111309276 AAAAATTACCAAAGGGATGCTGG + Intronic
1196173193 X:112612422-112612444 TAAAATTAGGAAGAGGAAGCAGG + Intergenic
1196683213 X:118489595-118489617 AAAAATTAGTAAAAAGAAGCAGG - Intergenic
1197405696 X:126046250-126046272 CTCAATTAGGAAAATGATGCAGG - Intergenic
1197686084 X:129441140-129441162 AAGAATTAGGAAAAGAGGCCGGG + Intergenic
1198041740 X:132859695-132859717 AAGAATGAAGAAAAGAAGGCAGG + Intronic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198645615 X:138802680-138802702 AGCAACTAGGAAAAGGAGGCAGG - Intronic
1199201508 X:145095217-145095239 CAGACTTAGGAAGAGGAAGCAGG - Intergenic
1199757538 X:150879348-150879370 AAGAATTAAGAAAAGGGAGAAGG + Intronic
1200127906 X:153825498-153825520 TTGAGTTAGGAAAAGGAAGCAGG - Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200955053 Y:8936480-8936502 AGATATTGGGAAAAGGATGCTGG + Intergenic
1201674466 Y:16563815-16563837 AAGAATTAGGACTTGGATCCCGG + Intergenic
1202332493 Y:23769575-23769597 AAAAAATAGGTAAAGGCTGCAGG - Intergenic
1202538276 Y:25900488-25900510 AAAAAATAGGTAAAGGCTGCAGG + Intergenic