ID: 1178997705

View in Genome Browser
Species Human (GRCh38)
Location 21:37420336-37420358
Sequence TCATATCATCCTGATGGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178997705_1178997710 4 Left 1178997705 21:37420336-37420358 CCCACCCCATCAGGATGATATGA 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1178997710 21:37420363-37420385 TGAAAGAAGACGATGCATACAGG 0: 1
1: 0
2: 1
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178997705 Original CRISPR TCATATCATCCTGATGGGGT GGG (reversed) Exonic
902206329 1:14870875-14870897 TCTTATCATTCTGGTAGGGTTGG - Intronic
902465608 1:16616087-16616109 TCATACCGTCCTCATGGGGTAGG + Intergenic
903442417 1:23398054-23398076 TCATAACAACCTCATGAGGTAGG + Intronic
903645010 1:24890092-24890114 ACATATCTTCGTGGTGGGGTGGG + Intergenic
905087747 1:35398053-35398075 TCATGACAGCCTTATGGGGTGGG + Intronic
905526755 1:38645785-38645807 TCACAACAACCTGATGAGGTAGG + Intergenic
908519169 1:64924791-64924813 TTAGATCATCATTATGGGGTTGG - Intronic
910963949 1:92788931-92788953 TCATATTGTCCTCATGGGGTAGG + Intronic
913162777 1:116160377-116160399 TAATATCTACCTCATGGGGTTGG + Intergenic
917256186 1:173118852-173118874 TCATAGCATCTTGATGAAGTTGG - Intergenic
917347200 1:174040517-174040539 TCATAACATCCTTGTGAGGTAGG + Intergenic
917502204 1:175595864-175595886 TCATAACATCCTTATGAGGTAGG + Intronic
917687130 1:177428451-177428473 TCAGTTCATCTTGGTGGGGTGGG - Intergenic
918077704 1:181182949-181182971 TCATAACATCCCGGTGAGGTAGG + Intergenic
918532712 1:185540736-185540758 TATTATCATTTTGATGGGGTTGG + Intergenic
919132259 1:193466207-193466229 TAATATCTTCCTTGTGGGGTGGG + Intergenic
920691831 1:208153248-208153270 TCACAACAACCTAATGGGGTAGG + Intronic
921279962 1:213556913-213556935 TCATTTAATCCAGGTGGGGTGGG + Intergenic
1069459976 10:68585567-68585589 GCATATAATTCTGAGGGGGTGGG - Intronic
1069735881 10:70653919-70653941 TCATGTAACCCTCATGGGGTAGG - Intergenic
1073131435 10:101191493-101191515 TCACAACAACCTGATGAGGTAGG + Intergenic
1073812832 10:107169524-107169546 TCATAACATCCTTATGAGTTAGG - Intergenic
1077656855 11:4027800-4027822 TCATATGATCCTGTAGGGGCTGG - Intronic
1077774479 11:5256055-5256077 TCCTATCAACCTGATAGGTTAGG - Intronic
1078436401 11:11329140-11329162 TCATAACAGCCTTATGAGGTAGG - Intronic
1078859906 11:15237401-15237423 TCACAACATCCTTATGAGGTAGG - Intronic
1080326823 11:31084617-31084639 GCATATCATCCTAATTGTGTAGG - Intronic
1080590813 11:33721851-33721873 TCATGCCAACCTGATGGAGTTGG - Intronic
1081274062 11:41124935-41124957 TCTCATATTCCTGATGGGGTTGG - Intronic
1081755249 11:45539706-45539728 TCATGGCATCTTTATGGGGTAGG - Intergenic
1082895864 11:58189228-58189250 TCATAGCAACCTGATGAGATGGG - Intergenic
1084736932 11:71111411-71111433 GCAGATCAACCTGATGGGGTGGG + Intronic
1085279685 11:75321703-75321725 TCAGAACAACCTGATGGGGTGGG - Intronic
1089437363 11:118481810-118481832 TCCTCTCTTGCTGATGGGGTAGG - Exonic
1090040482 11:123286469-123286491 TCTTGTCATCCTGATAGGGATGG + Intergenic
1091707536 12:2707689-2707711 TAATTTCATCCTGCTGTGGTTGG - Intergenic
1091856489 12:3744843-3744865 TCTTCTCAAACTGATGGGGTTGG - Intronic
1092908375 12:13123077-13123099 TCATAACAGCCCCATGGGGTAGG - Intronic
1094151577 12:27290366-27290388 TCATATCAACCTTATAAGGTTGG + Intronic
1095409331 12:41905153-41905175 TCCTATCATCCTGCTGGCCTAGG - Intergenic
1101560663 12:105854735-105854757 TCATAACAACCCTATGGGGTAGG - Intergenic
1102744563 12:115239028-115239050 ACAAAAAATCCTGATGGGGTGGG - Intergenic
1103205930 12:119128881-119128903 CCATCTCCTCCTGATGGTGTTGG + Intronic
1104490131 12:129186669-129186691 TCATAACATCCCTATGGGGTAGG - Intronic
1106878895 13:34107380-34107402 TCATATCAGCCTGGTGAAGTAGG - Intergenic
1113205917 13:107915859-107915881 TCATCGCAACCAGATGGGGTCGG - Intergenic
1118433756 14:65750072-65750094 TAATATCTACCTGATAGGGTTGG - Intergenic
1118917737 14:70122065-70122087 TCATCTCATCCTGGTGGGACAGG - Intronic
1120176643 14:81301121-81301143 AAATATCTTCCTTATGGGGTTGG - Intronic
1120188086 14:81415228-81415250 TCTTATCAACCTTATGAGGTAGG + Intronic
1121432748 14:93899151-93899173 ACCTGACATCCTGATGGGGTGGG - Intergenic
1125829635 15:42704994-42705016 CCCATTCATCCTGATGGGGTGGG + Intronic
1126153442 15:45543466-45543488 TAATATCATCTGGGTGGGGTAGG + Intergenic
1128566251 15:68702079-68702101 TCATGTCCTCCTCAGGGGGTTGG + Intronic
1130410220 15:83641363-83641385 GCTTATCATCTTAATGGGGTGGG + Intergenic
1131460263 15:92612769-92612791 TCATAATATCCAGATGAGGTAGG + Intergenic
1132663295 16:1070984-1071006 TCATTTGATCCTCCTGGGGTGGG + Intergenic
1134436586 16:14264322-14264344 TCAGATCATCCTACTGGGGGTGG + Exonic
1134824069 16:17270383-17270405 TCATGTCCCCCTGGTGGGGTTGG - Intronic
1138977511 16:62225819-62225841 TCACTTCATCCTGTTGGGGTTGG - Intergenic
1139275013 16:65719508-65719530 TCATCTAATCCTGATGGTGCAGG + Intergenic
1143923808 17:10351908-10351930 CAATATCATCCTGCTGGTGTTGG - Intronic
1146687072 17:34848408-34848430 TCATAACTGCCTCATGGGGTTGG + Intergenic
1146905321 17:36614296-36614318 TCAGCTCATCCTGCTGGGGGAGG + Intergenic
1148139686 17:45319185-45319207 ACAGATCATCTTGATGGGGTAGG - Intergenic
1148443198 17:47722301-47722323 TCCCATCCTGCTGATGGGGTAGG - Intergenic
1150843279 17:68629467-68629489 TCATATTACCCTTATGAGGTAGG - Intergenic
1156509826 18:37627013-37627035 TCATAAAATCCTTGTGGGGTGGG - Intergenic
1157829230 18:50841156-50841178 TCATAACAGCCTGATAAGGTAGG - Intergenic
1162701019 19:12514625-12514647 TCAGACCCTCCTGATGAGGTAGG + Intronic
1165924304 19:39317715-39317737 TCATAGCAACCTTATGAGGTGGG - Intergenic
928187629 2:29126806-29126828 TCAAATCATCCAGTAGGGGTTGG + Intronic
932888119 2:75565508-75565530 TGAAATCATCCTCATGTGGTAGG + Intronic
932913613 2:75831218-75831240 TCACAACATCCTGATGAGGTAGG - Intergenic
935019704 2:99218039-99218061 ACATTTCAGTCTGATGGGGTTGG + Intronic
937037600 2:118794744-118794766 TCATTTCAACATGATGAGGTTGG - Intergenic
938474245 2:131592154-131592176 ACATACCGTCCTGATGGGGGAGG + Intergenic
948192091 2:236067244-236067266 TGAAATCATCCTGATGAGGCAGG - Intronic
1170987052 20:21268038-21268060 TCATATCATCCTTATCTGCTTGG - Intergenic
1171450671 20:25233827-25233849 TCATATAATAGTGAAGGGGTGGG + Intergenic
1177868499 21:26542030-26542052 TCATTTCCTACTGATGTGGTGGG - Intronic
1178997705 21:37420336-37420358 TCATATCATCCTGATGGGGTGGG - Exonic
1179139932 21:38716451-38716473 TCATATCTTCCAGACTGGGTAGG - Intergenic
1180194433 21:46184419-46184441 TCATCTCATCCTCATGGGAAGGG + Exonic
1182821290 22:33218688-33218710 TTTTATCAACCTGATGAGGTAGG + Intronic
1183934717 22:41255558-41255580 AGATCTCATCCTGATGTGGTGGG - Intronic
949742618 3:7253651-7253673 TCACAGCATCCTTATGAGGTAGG + Intronic
954433452 3:50483592-50483614 TCATAGCAGCCTGCTGGGTTGGG + Intronic
955804694 3:62722044-62722066 TCATAACCACCTGATGGGGTTGG + Intronic
960555936 3:119030726-119030748 TCAGATCCTCCAGATGGTGTGGG + Intronic
960666178 3:120111175-120111197 TCATATCATCCAATTGGAGTGGG + Intergenic
961091849 3:124119639-124119661 TCAGATCATTCAGATCGGGTAGG + Intronic
964905567 3:161715891-161715913 TCACATCATCCTGTGGGAGTAGG - Intergenic
965398464 3:168189225-168189247 TTATATGATCCTTATGGGGTAGG + Intergenic
965969966 3:174542822-174542844 TCATTTCATCCTGTTGGGACTGG + Intronic
967437936 3:189472373-189472395 TCATTTCTTCCTGAAGGTGTGGG - Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
968970386 4:3790611-3790633 TTATAGCATCATGATGAGGTGGG - Intergenic
970158606 4:13166816-13166838 TCATAACATCTTGATGAGGCAGG + Intergenic
970288556 4:14546485-14546507 TCATATCGTCCTGAAGGTTTGGG - Intergenic
970313902 4:14811026-14811048 TCATGACAACCTGATGAGGTAGG + Intergenic
971969256 4:33600598-33600620 TCATATCCTACTGATGGTTTGGG - Intergenic
972112410 4:35580664-35580686 TCATAACATCCTGATGGGTTGGG + Intergenic
972892267 4:43573406-43573428 TCATATCAGCTGGATGGGGTGGG + Intergenic
973699008 4:53518589-53518611 TCATATCATCCCTATGAGGAGGG + Intronic
975056635 4:69940950-69940972 TCATATGAAAATGATGGGGTTGG + Intronic
976467440 4:85386980-85387002 TCATGTCGTCCTCATGGGGTAGG - Intergenic
978435295 4:108677526-108677548 TCAGAACATCCCTATGGGGTAGG - Intergenic
988129548 5:27085205-27085227 TCAAAAAATCCTTATGGGGTTGG + Intronic
988482623 5:31642399-31642421 TCCTATCATCCTTCTGGGGATGG - Intronic
994670795 5:102759230-102759252 TCATCTCATCCTAATTGGGTTGG + Intronic
996613865 5:125415869-125415891 TCACAGCATCCTTATGAGGTAGG + Intergenic
998448543 5:142216988-142217010 TCATAGCATCCCTAAGGGGTAGG + Intergenic
999439729 5:151591831-151591853 TCATAACAACCTTATGAGGTAGG - Intergenic
1000040523 5:157481447-157481469 TCACAACAACCTGATGGGGCTGG + Intronic
1001573044 5:172743294-172743316 TCACAACACCCTGATGAGGTTGG - Intergenic
1002379665 5:178817641-178817663 TCATGGCCACCTGATGGGGTAGG - Intergenic
1002422114 5:179154246-179154268 TCCTATCATCGGGGTGGGGTGGG - Intronic
1006752855 6:36389689-36389711 TCATAACAACCTTATGGGATAGG - Intergenic
1006936864 6:37724653-37724675 TAATATCTACCTTATGGGGTTGG - Intergenic
1006939746 6:37743923-37743945 TCACATCATCCTTTTGGGATGGG - Intergenic
1007374515 6:41447173-41447195 TCATATCAACCTCATGAGGTGGG - Intergenic
1007496265 6:42261965-42261987 TCTTACCATCTTGAAGGGGTGGG + Intronic
1008401899 6:51072833-51072855 TCACAGCAACCTGATGGAGTTGG - Intergenic
1010805884 6:80235895-80235917 TCATATCATTCAGATGGGAATGG + Intronic
1011413484 6:87091635-87091657 ACATATTATCTTGATGTGGTGGG - Intronic
1011629707 6:89311768-89311790 TCACATCATCCCCATGGGGAAGG + Intronic
1012552097 6:100472718-100472740 TCATGTCTTTCTTATGGGGTTGG - Intergenic
1012744093 6:103061444-103061466 TCAACTCATCCTGATGGTGTTGG + Intergenic
1014624466 6:123708994-123709016 TCAAACCATCATGATGGGGCTGG - Intergenic
1020606898 7:10350263-10350285 TTATATAAACCTTATGGGGTTGG + Intergenic
1021258500 7:18424379-18424401 TCATAGCATCCTGATGAAGTAGG - Intronic
1021645250 7:22783123-22783145 TCATATCAACCATATGGGGAGGG - Intergenic
1021971025 7:25966397-25966419 TTATATCTTGCTGATGGTGTTGG + Intergenic
1023652787 7:42388954-42388976 TCACATCTTCCTGAGGGGATGGG + Intergenic
1024007931 7:45241233-45241255 TCAGACCATGCTGATGGGCTTGG + Intergenic
1030559242 7:111064342-111064364 CCATATCATCCTGAAGGAGGTGG + Intronic
1030651901 7:112125242-112125264 TGGGATCATCCTGATGGGGCAGG - Intronic
1031153907 7:118086566-118086588 TCACATCATCTTTATGGGTTTGG + Intergenic
1031628525 7:124018678-124018700 TCATAGCAATCTGATGAGGTAGG - Intergenic
1036705173 8:11041088-11041110 TCCTCTGATCCTGATGGGGGTGG - Intronic
1039214852 8:35258556-35258578 TCACAACACCCTGATGTGGTAGG - Intronic
1041095893 8:54349576-54349598 TCATTTCTTCCTGTTGTGGTTGG + Intergenic
1041539260 8:58964422-58964444 TAATATTAACCTGATAGGGTGGG - Intronic
1041612409 8:59867146-59867168 TCATAACTACCTGATGAGGTAGG + Intergenic
1041840735 8:62267710-62267732 CAAAATCATCCTGATGGTGTAGG - Intronic
1042834957 8:73071194-73071216 TCATACCAACCTCATGTGGTAGG + Intronic
1044428424 8:92081185-92081207 TCATATCATCCTGATAAGTTAGG - Intronic
1044455715 8:92390859-92390881 TCTTATCCTCCTGCTGGTGTAGG - Intergenic
1047345163 8:124020752-124020774 TCATAACAGCCTTATGAGGTAGG - Intronic
1047802702 8:128326394-128326416 TTATAACAACCTGATGAGGTAGG - Intergenic
1048018182 8:130515923-130515945 TCACATCATCCTGATGTTGTGGG + Intergenic
1048509764 8:135051676-135051698 TCATAACTACCTTATGGGGTTGG - Intergenic
1049173908 8:141179814-141179836 TCATAGCAACCTGATGAGATTGG - Intronic
1049272191 8:141701643-141701665 TCCCATCAGCCTGGTGGGGTGGG - Intergenic
1050506114 9:6351163-6351185 ACGTAGCCTCCTGATGGGGTTGG + Intergenic
1051502734 9:17795731-17795753 GCATAACATCCTAATGGGGCAGG - Exonic
1059429197 9:114240109-114240131 CCATCTCATCCTGCTGGGATGGG - Intronic
1060473248 9:123966004-123966026 TCAGTTCTTCCTGATTGGGTGGG - Intergenic
1061739855 9:132694337-132694359 ACATTTCATCCTGATGAGGCAGG - Exonic
1062612714 9:137382216-137382238 GCATTTCATCTTCATGGGGTGGG - Intronic
1186874653 X:13804853-13804875 TCATACCATCTGGTTGGGGTTGG + Intronic
1187740042 X:22345710-22345732 TCTCATCCTCCTCATGGGGTTGG - Intergenic
1190384631 X:49872825-49872847 TTATCACACCCTGATGGGGTAGG - Intergenic
1192221370 X:69199585-69199607 TCATAACAACCTTATGAGGTGGG - Intergenic
1193197370 X:78649082-78649104 TCACAGCAACCTGATGGAGTTGG + Intergenic
1194382631 X:93214268-93214290 TAATATCATCTTGATGGTTTTGG - Intergenic
1197779772 X:130148022-130148044 TCACAGCATCCTGATGGGAGAGG + Intronic
1198149237 X:133891984-133892006 TCATAACAACCTGGTGAGGTGGG - Intronic
1198610964 X:138400175-138400197 TCATATCAACCTTAAGGGTTAGG + Intergenic
1201512584 Y:14781418-14781440 TCTTATAATCATGTTGGGGTGGG + Intronic