ID: 1178998881

View in Genome Browser
Species Human (GRCh38)
Location 21:37435326-37435348
Sequence GCCGCTGTTGCTGGGGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178998874_1178998881 19 Left 1178998874 21:37435284-37435306 CCAATCATATGGTGTCGGTTTAG 0: 1
1: 0
2: 1
3: 2
4: 35
Right 1178998881 21:37435326-37435348 GCCGCTGTTGCTGGGGTTCAGGG 0: 1
1: 0
2: 0
3: 23
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178998881 Original CRISPR GCCGCTGTTGCTGGGGTTCA GGG Intronic
900164728 1:1240142-1240164 GCTGCTGTTGCTTGGGGTCTGGG - Intergenic
902719481 1:18294683-18294705 GCCCCTGTTACTGAGGCTCAGGG - Intronic
903907703 1:26697485-26697507 GCCGCTGCTCCCGGGGCTCATGG - Exonic
904430323 1:30460092-30460114 GCCCATGTTGCTGGGGTGCCTGG - Intergenic
904683277 1:32243342-32243364 GCCTCCGTTTCTCGGGTTCAAGG - Intergenic
904796843 1:33062589-33062611 GAGGCAGTGGCTGGGGTTCAGGG + Intronic
906551410 1:46668959-46668981 GTCACTGTGGCTGGAGTTCAAGG - Intronic
907769305 1:57444049-57444071 GCCACTGTAGCTGGGGTCTAGGG - Intronic
911375605 1:97047100-97047122 GCTGGTGTTGGTGGGGTCCATGG - Intergenic
915101397 1:153503358-153503380 GCCGTTGTTGCTGCCGTTCTGGG - Intergenic
916832973 1:168512031-168512053 GAGGCTGTTGCTGGGACTCAGGG + Intergenic
918080482 1:181204114-181204136 GCCATTGCTGCTGGAGTTCAGGG + Intergenic
920749203 1:208658279-208658301 GCAGCTGTGGCTGAAGTTCAAGG + Intergenic
922089922 1:222386214-222386236 GCCTCTGATGCTGGTGCTCAGGG + Intergenic
923779839 1:237012253-237012275 GTCACTGTTGCTGTCGTTCATGG - Intergenic
924350168 1:243107135-243107157 GCTGCTGCTGCTGCGGTTCACGG + Intergenic
1064086745 10:12350888-12350910 GCCCATTTTGCAGGGGTTCATGG + Intronic
1064288506 10:14013045-14013067 GCCCCTTCTGCTGGGGCTCATGG - Intronic
1068369652 10:56096045-56096067 TCCTCTCTTGCTGGGGTTCCAGG + Intergenic
1069820025 10:71221650-71221672 GCCTGTGATGCTGGGGTGCAAGG + Intronic
1069893623 10:71667088-71667110 GCCTCTGTTGCTGGGACCCAGGG + Intronic
1069984541 10:72274383-72274405 GCCACTGTTGCTGCTGTCCAGGG - Exonic
1073538589 10:104299902-104299924 GATGCTGATGCTGAGGTTCAGGG + Intronic
1074308140 10:112298009-112298031 GCAGCTCTTGCTGGAGTTCAAGG + Intronic
1075426805 10:122348284-122348306 GTCGCTGTTGCTGGTGGTAAAGG + Intergenic
1077248117 11:1548864-1548886 GCCACTGTTCCTTGGTTTCATGG + Intergenic
1078855203 11:15201254-15201276 GGTGTTGGTGCTGGGGTTCAGGG + Intronic
1079380613 11:19934127-19934149 GCTGCTGATGCTGTGGTTCAGGG - Exonic
1080500985 11:32870746-32870768 GCCTCTGTGGCTGGGATTCCAGG - Intergenic
1083638507 11:64133051-64133073 GGCGCTCTGGCTGGGGCTCATGG - Intronic
1084971148 11:72772759-72772781 TCCCCTGTGGCAGGGGTTCAGGG - Intronic
1087287233 11:96278074-96278096 GCCGCTGCTGCTGCTGTTCTTGG + Intronic
1091323094 11:134665346-134665368 GCCGCTGCTCCTGTGGTTCCTGG - Intergenic
1096546582 12:52344307-52344329 GCCCCTGTTGCAGGGCTACATGG + Intergenic
1097631070 12:62062900-62062922 TCCGCTGTTGCTGGCTTTGAAGG - Intronic
1097846739 12:64374348-64374370 GCTGTTGTTGATGAGGTTCAAGG - Intronic
1100436853 12:94578928-94578950 GACACTGCTGTTGGGGTTCATGG + Intronic
1104960744 12:132487602-132487624 GCCGCCGATGCTGGAGTTCTGGG - Intergenic
1104987698 12:132606188-132606210 GCTGCTGCTGCTGGGGTCCATGG - Exonic
1105247374 13:18665820-18665842 GCAGCTGCTGCTGGGGTGCAAGG + Intergenic
1105847593 13:24307337-24307359 GCCGCTTTTGCTAGGGATCATGG + Intronic
1108424024 13:50279681-50279703 GCAGGTGTTTCTGTGGTTCACGG - Intronic
1112430201 13:99344222-99344244 GCAGCTGTTGATGGGGATCTGGG + Intronic
1113721512 13:112561255-112561277 GCCCCTGTTGCTGGCTTGCAGGG - Intronic
1114547703 14:23514427-23514449 GCCACTTTTGCTGGGGTGGAAGG + Intergenic
1116956160 14:50925987-50926009 GCTGCTCTTTGTGGGGTTCAGGG - Intronic
1118292755 14:64541031-64541053 GATGGTGTTGGTGGGGTTCATGG - Exonic
1118479932 14:66154101-66154123 GCAGCTGTTTCTCGGCTTCATGG - Intergenic
1119702066 14:76762082-76762104 GCCGCTGTTTCTGGGGACGAGGG + Intergenic
1120009591 14:79398672-79398694 GCATCTGTTGGAGGGGTTCAAGG + Intronic
1121123704 14:91392684-91392706 GCCGCCCTTGCTGGGGTCCCTGG - Intronic
1122378228 14:101283092-101283114 TCAGCCATTGCTGGGGTTCAGGG + Intergenic
1124374702 15:29122672-29122694 GCCGGTGTTGCGGGGGTTGGAGG - Exonic
1126312805 15:47336423-47336445 GGAGCTGTTACTGGGGCTCATGG + Intronic
1127264026 15:57346798-57346820 GCGGCTGGTGCTGGGGGGCAAGG + Intergenic
1127289365 15:57556674-57556696 GCTGCTGTTGCTATGGGTCATGG + Intergenic
1135992827 16:27228324-27228346 GCAGCTGTTGCTGGTGCACAGGG + Intronic
1137789619 16:51164129-51164151 GCTGCTGTGGCTGTGGATCACGG + Intergenic
1137898716 16:52241468-52241490 GTTGCTCTGGCTGGGGTTCAGGG - Intergenic
1138604670 16:58081233-58081255 GTCTCTGTTGTTGGGGTCCAGGG + Intergenic
1140510500 16:75504118-75504140 GCAGCTGCTTCTTGGGTTCAAGG + Intergenic
1143119281 17:4597071-4597093 CCCGCTGAGGCTGGGGTTAAGGG + Intronic
1143614244 17:8039927-8039949 GGCGCTGTTGCTGGAGCACAGGG - Exonic
1146279474 17:31536010-31536032 TCCACTGGTGCTGGTGTTCAGGG + Exonic
1152233716 17:79127632-79127654 GCCTCTGATGCGGGGGCTCAAGG - Intronic
1153179819 18:2420520-2420542 GCAGCTCCTGGTGGGGTTCAGGG + Intergenic
1153824552 18:8863692-8863714 GACTCTGTTGCTGAGCTTCAAGG + Intergenic
1154303907 18:13217497-13217519 GCCGCCGTGGCGGGGGCTCAGGG - Intronic
1154441468 18:14393301-14393323 GCAGCTGCTGCTGGGGTGCAAGG - Intergenic
1156036215 18:32770541-32770563 GTCGCTGTGGCTGGGGTCGAAGG + Exonic
1156337835 18:36186409-36186431 GCGGCAGGTGCTGGGGCTCAGGG - Intergenic
1158260527 18:55601308-55601330 GCAGATGGTGCAGGGGTTCAAGG - Intronic
1158408859 18:57186706-57186728 GCAGGGGTTACTGGGGTTCAGGG + Intergenic
1158669703 18:59463737-59463759 GCGTTTGTTGCTGGGGTTCCCGG + Intronic
1158900119 18:61954561-61954583 GCCCATGTGGCTGGGTTTCAGGG + Intergenic
1160529483 18:79555211-79555233 TCCGCTGTTCTTGGGGCTCAAGG + Intergenic
1160680695 19:410680-410702 GCAGCTGGAGCTGGGGTTCGGGG - Intergenic
1160706359 19:531964-531986 GGCGCTGCTGCTGGAGCTCAAGG + Exonic
1160859027 19:1229926-1229948 GCCGCTGCTGCTGTGGTCCGAGG + Exonic
1161531468 19:4792451-4792473 GCAGCTGCTGCTGGGGTGCAAGG + Exonic
1162236751 19:9315627-9315649 GGCGCTGCTGCAGGGGTTCCAGG + Intergenic
1162919142 19:13890005-13890027 GGAGCTGATGCTGGGGTACAGGG + Exonic
1165009817 19:32836582-32836604 CTCGCTGTTGCTGGGGTTCGGGG + Intronic
1165313204 19:35040660-35040682 GAGGCTGATGCTGGGGTGCAGGG + Intronic
1166210536 19:41304066-41304088 GCGGCTGTTGCTGGGGAGCCCGG - Exonic
1168119038 19:54241658-54241680 CCACCTGTGGCTGGGGTTCACGG + Exonic
1168543788 19:57233534-57233556 GAACCTGCTGCTGGGGTTCAGGG + Exonic
927252612 2:21011286-21011308 GACACTGTTGCTAAGGTTCAGGG - Exonic
927436841 2:23073877-23073899 CACGCTGTCACTGGGGTTCAAGG - Intergenic
928925260 2:36571974-36571996 GCCGCTCATGCTGGAGTGCAGGG - Intronic
929334959 2:40731387-40731409 GTTACTGTTGTTGGGGTTCAGGG + Intergenic
930712084 2:54558811-54558833 GCCGCTGTCGCCGGCGTACACGG + Intronic
933141217 2:78794414-78794436 GCCGAGGTTGCTGGGACTCAAGG - Intergenic
933773515 2:85758472-85758494 GCCGCTGTTGCTGCGGAGCTTGG + Intronic
934098244 2:88627202-88627224 GCTGCTGCTGCTGGGGCTCGCGG - Exonic
935592598 2:104855752-104855774 GCCGCCGTTGCTGGCGGCCATGG - Exonic
937261882 2:120591804-120591826 GCTGGTGTGGCCGGGGTTCATGG - Intergenic
940009582 2:149039174-149039196 GGAGCTGGGGCTGGGGTTCAAGG + Intronic
941065186 2:160893724-160893746 GGGGCTGATGCTGGGGTCCAGGG + Intergenic
942073078 2:172332733-172332755 ACAGCTGTTGCTGGGCTTCAGGG + Intergenic
944457614 2:199911533-199911555 GCCGCTGCCGCCCGGGTTCATGG - Exonic
946088523 2:217198513-217198535 GTCGCTGTTGGTGGGGGACATGG + Intergenic
948910514 2:241000092-241000114 GCTGCTGGTGGTGGGGTTGAAGG - Intronic
1169052904 20:2595653-2595675 TCAGCTGTGGCTGGGGGTCACGG + Intronic
1171774157 20:29350107-29350129 GCCGCTGGTGCAGGGATGCATGG + Intergenic
1171816178 20:29787728-29787750 GCCGCTGGTGCAGGGATGCATGG + Intergenic
1171878494 20:30599251-30599273 GGGGCTGCTGCTGGGATTCAGGG + Intergenic
1172610462 20:36247493-36247515 ACCACTGTTGCTGGAGTTGATGG - Intronic
1174236919 20:49101643-49101665 GCCTGTCTTGCTGGTGTTCAGGG + Intergenic
1174524391 20:51159597-51159619 GCCACTGTTCCTGTGGGTCACGG - Intergenic
1176454592 21:6897874-6897896 GCAGCTGCTGCTGGGGTGCAAGG + Intergenic
1176832765 21:13762922-13762944 GCAGCTGCTGCTGGGGTGCAAGG + Intergenic
1177416000 21:20794237-20794259 CCAGATGTTGCTGGTGTTCAGGG + Intergenic
1178583946 21:33857633-33857655 GCCGCTGTTGGAGGAGTACAGGG + Intronic
1178807158 21:35848843-35848865 GCCGCTGTGGCTGTGCTTCTGGG - Intronic
1178998881 21:37435326-37435348 GCCGCTGTTGCTGGGGTTCAGGG + Intronic
1180319624 22:11308261-11308283 GCCGCTGGTGCAGGGATGCATGG + Intergenic
1181167898 22:20993106-20993128 GCAGATGGTGCTGGGGCTCACGG + Intronic
1182347634 22:29677717-29677739 GCTGCTTTTGCTGGGATCCAAGG - Intronic
1183731774 22:39622391-39622413 GCGGCAGTAGCGGGGGTTCAGGG + Intronic
1184420595 22:44380834-44380856 CCCGCTGCTGCGGGGGTTCTGGG - Intergenic
1184501753 22:44878847-44878869 GCTGCTGTTGCTGGAGTAGAGGG + Intergenic
1185162603 22:49238859-49238881 GCCTCTGTTTCTGTGATTCATGG - Intergenic
1185229917 22:49673917-49673939 GCAGCTGATGATGGGGTACAGGG - Intergenic
1185265528 22:49900686-49900708 GCTGCTGTTGCTGGGGGCCAGGG + Exonic
949596521 3:5553642-5553664 TAGGCTGTTGCTGTGGTTCATGG + Intergenic
952972293 3:38659208-38659230 GCGGCTGTTGCTGGGGTCCCTGG + Intergenic
954160389 3:48717317-48717339 GGCGCTGTTGCTAGGGTGCCAGG + Intronic
957775073 3:84748065-84748087 GCATTTGCTGCTGGGGTTCATGG - Intergenic
958097854 3:88970871-88970893 GCAACTGTAGTTGGGGTTCATGG + Intergenic
958740485 3:98064546-98064568 GCCCCTGTTCCTGGTGTTCTTGG + Intergenic
961721861 3:128902557-128902579 GCCGCTGTTGAGGATGTTCATGG - Exonic
962376655 3:134863952-134863974 GCTGGTGATGGTGGGGTTCAGGG + Intronic
962688256 3:137868217-137868239 GCTGCTGCTGCTGGGGGTCAGGG - Intergenic
962852767 3:139320069-139320091 GCGGCTGCTGCTGGGGTGCAGGG - Intronic
967478043 3:189943390-189943412 GCAGAGGTTGCTGTGGTTCAGGG - Intergenic
967852102 3:194089942-194089964 TCCGCTGCTTCTGGGGTTCGGGG + Intergenic
967859092 3:194138127-194138149 GCCGCTGTTGCTGGTGTAGACGG - Exonic
968919829 4:3516803-3516825 GCCACTGTTGCGGGGCTCCATGG - Intronic
978134145 4:105236156-105236178 GCTGCTGTTGCTGGTTTTGAGGG - Exonic
979251772 4:118573412-118573434 GCTGCTGCTGCTGCGGTTCACGG - Intergenic
990761547 5:59135410-59135432 GTCCCTGTTTCTGGGGTTGATGG + Intronic
990918579 5:60937466-60937488 GCCGCTGCTGCTGTGGTAGATGG + Intronic
995292226 5:110469980-110470002 ATGGCTGTTGCTGGGGTTCCGGG - Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
999102152 5:149035559-149035581 CCCTCTGTTGCTGTGATTCAAGG + Intronic
999106478 5:149075475-149075497 GACTCTGATGCTGGGGGTCAGGG - Intergenic
1002058978 5:176615221-176615243 GCCGCAGCTGCTGGGGGTGAGGG - Intergenic
1002065834 5:176651240-176651262 GAAGCTGGTGCTGGGGTTCCAGG - Intronic
1007301484 6:40871125-40871147 GGCACTGTGGCTGGTGTTCAGGG + Intergenic
1010561255 6:77353452-77353474 GCTGCTGTTGCTGGGGATGAAGG + Intergenic
1010760769 6:79719843-79719865 GCTGCTGTTGATTGTGTTCATGG - Intergenic
1015024556 6:128519100-128519122 GCATCTGCTGCTGGGGTTCGCGG - Intronic
1017011344 6:150065786-150065808 GCCCTTGCTGCTGGGCTTCATGG + Intronic
1020360665 7:7323595-7323617 GCCAGTGTGGCTGGAGTTCACGG + Intergenic
1021521535 7:21543443-21543465 GGCGATGATGCTGGGGTTCACGG + Exonic
1023865412 7:44235977-44235999 GCTGCTGCTGCTGGGGTTGGGGG - Intronic
1023939472 7:44760483-44760505 GACGCTGCTGCTTGGGGTCATGG - Exonic
1027193293 7:76010583-76010605 GCCTCTGCTGCTGGGTTTCTCGG - Intronic
1027505906 7:79016847-79016869 GCAGCTGCTGCTGGGGTTGGGGG - Intronic
1028477159 7:91265072-91265094 TCCGCTGCTGCTGGGGGTCCGGG + Exonic
1029982372 7:104890896-104890918 GGCGCTGCTGGTGGGCTTCATGG - Intronic
1030079839 7:105767806-105767828 GCTGCAGCTGCTGGGTTTCAAGG - Intronic
1031330623 7:120459200-120459222 GCAACTGTGGCTGGAGTTCAGGG - Intronic
1032240506 7:130155269-130155291 CCTGCTGGTGCTGGGGTTCGAGG - Intergenic
1035534634 8:381751-381773 GACGCTGTTCCCGGTGTTCAGGG - Intergenic
1035784606 8:2250781-2250803 GTGGCTGGTGCTGGGGCTCAGGG + Intergenic
1035808201 8:2470932-2470954 GTGGCTGGTGCTGGGGCTCAGGG - Intergenic
1036796463 8:11759711-11759733 GCCCCTGATGCTGGAGCTCAAGG + Exonic
1038572471 8:28674802-28674824 GCCACTGTTGCTGGGGTTGTTGG - Intronic
1043630488 8:82325392-82325414 GCCGCAGTTGGTGTGGTTCCAGG + Intergenic
1046844271 8:118898647-118898669 GAAGCTGTTGTTGGGGTTCAGGG + Intergenic
1046905460 8:119567646-119567668 TCGGCTCTTGCTGGGTTTCAGGG + Intronic
1048055087 8:130855532-130855554 GCCCTGGTTCCTGGGGTTCAGGG - Intronic
1049740728 8:144239730-144239752 CCCGCTGCTGCTGGGGTACCTGG + Exonic
1051114249 9:13675749-13675771 GCAACTGTTACTTGGGTTCAGGG + Intergenic
1056126314 9:83538711-83538733 GCCGCTGTCGCTCGGGCTCCCGG + Intergenic
1058341230 9:103899477-103899499 GCTGGTATTGCTAGGGTTCAGGG - Intergenic
1061940790 9:133882818-133882840 GCCTCTGCTGCAGGGGTTCAGGG - Intronic
1062517565 9:136944105-136944127 GCAGCCGTTGGTGGGTTTCAGGG - Exonic
1187224329 X:17361376-17361398 GCTTCAGTTGCTGGGGTTAAAGG + Intergenic
1193000709 X:76559243-76559265 GCCACTGCTGCTGGGGTTTGAGG + Intergenic
1195736633 X:108018922-108018944 GCTCCTGTTCCTGGGCTTCAGGG + Intergenic
1197010149 X:121551145-121551167 CCTGCTGCTGCTGGGGTTGAAGG - Intergenic
1199656769 X:150004063-150004085 GGAGCTGTTGCTGGGATTCCAGG + Intergenic