ID: 1179000321

View in Genome Browser
Species Human (GRCh38)
Location 21:37451820-37451842
Sequence CTCAGAATCTTACAGGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179000321_1179000325 8 Left 1179000321 21:37451820-37451842 CCAGTTCCCTGTAAGATTCTGAG 0: 1
1: 0
2: 0
3: 24
4: 209
Right 1179000325 21:37451851-37451873 TTAGCATGACATTTGATCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 109
1179000321_1179000324 7 Left 1179000321 21:37451820-37451842 CCAGTTCCCTGTAAGATTCTGAG 0: 1
1: 0
2: 0
3: 24
4: 209
Right 1179000324 21:37451850-37451872 CTTAGCATGACATTTGATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179000321 Original CRISPR CTCAGAATCTTACAGGGAAC TGG (reversed) Intronic
900518816 1:3095917-3095939 CTCAGCATCTGACAGGGGTCTGG + Intronic
901815236 1:11789929-11789951 CTTAGCCTCTGACAGGGAACGGG + Exonic
904238427 1:29128597-29128619 CTCAGGATCTTAGAGGGCAATGG + Intergenic
904575067 1:31500164-31500186 CTCAGACTCCAACAGGGAGCTGG - Intergenic
904636451 1:31885188-31885210 CTCTGAATCTCTCAGGAAACTGG + Intergenic
905018872 1:34794978-34795000 CTCAGACCCTTACACGGACCAGG + Exonic
907040974 1:51259060-51259082 CTTAGGATCTTACAGTAAACAGG - Intronic
907750963 1:57262779-57262801 CTCAGAATCTGGCTGGGAGCAGG - Intronic
909164009 1:72194241-72194263 CTCAGAATGATAAAGGGAAAAGG + Intronic
909361345 1:74762551-74762573 CTCAGAATATAACAGGAGACAGG + Intronic
909767578 1:79376285-79376307 CTCAGTGTCTTACAGGAATCTGG + Intergenic
909771844 1:79433130-79433152 CTGAGAGGCTTACAGGAAACAGG - Intergenic
911171090 1:94771771-94771793 TTCAGACTCCTAAAGGGAACAGG - Intergenic
911781680 1:101887546-101887568 TTCAGTTTCATACAGGGAACAGG + Intronic
912219362 1:107654795-107654817 CTTAGAGTCTAACAGGGAAAAGG + Intronic
912219840 1:107660787-107660809 CTTAGAGTCTAACAGGGAAAAGG + Intronic
913190364 1:116408135-116408157 CTCATAATCTATCCGGGAACAGG - Intronic
913674920 1:121131492-121131514 CTCAGAATTTCACGGGGAACTGG + Intergenic
914026761 1:143919124-143919146 CTCAGAATTTCACGGGGAACTGG + Intergenic
914665144 1:149826559-149826581 CTCAGAATTTCACGGGGAACTGG + Intergenic
914670621 1:149867262-149867284 CTCAGAATTTCACGGGGAACTGG - Intronic
915648257 1:157289257-157289279 CTCAGAAGCTTACAGAAAGCAGG + Intergenic
916338315 1:163698306-163698328 ATCAGAATATCACAGGGAAGGGG - Intergenic
921320117 1:213930573-213930595 CTAAGAATCTTAATGGGACCTGG - Intergenic
921699075 1:218246684-218246706 CTCAGAGTCTTCCAGAAAACTGG - Intergenic
922161487 1:223081717-223081739 CGCAGTATCTCCCAGGGAACTGG - Intergenic
923042889 1:230332614-230332636 CTCAAAAGCTTACAACGAACAGG + Intronic
1067021321 10:42800975-42800997 CACAGACTCTTACAGGCCACAGG - Intronic
1070581532 10:77724079-77724101 ATCAGAAACTTATTGGGAACTGG + Intergenic
1072803904 10:98412184-98412206 CTCATAGTCTTCCAGGCAACTGG + Intronic
1072935832 10:99712243-99712265 CACAGAAACTTACAGAGTACTGG + Intronic
1073502426 10:103952543-103952565 CTCAAAATCGTACATGGAAGAGG + Intergenic
1075524857 10:123175522-123175544 CTCAGAAGCATATAGGGAAGGGG - Intergenic
1079239645 11:18713631-18713653 CTCAGCTTCTTACCTGGAACAGG - Intronic
1079268092 11:18955387-18955409 CTCAAAGTCTTAAAGGGAAGGGG + Intergenic
1081610636 11:44561131-44561153 CCCAGACACTAACAGGGAACTGG + Intergenic
1083145628 11:60756375-60756397 CTCAGACCCTTACACTGAACTGG + Intergenic
1088253415 11:107881066-107881088 TTCAGAATGTTACAGGAAAGGGG + Intronic
1089719635 11:120403099-120403121 CTCAGAATTTAACAAGGAAAAGG + Intronic
1089821172 11:121227508-121227530 ATAAGAAACTTACTGGGAACTGG - Intergenic
1090842693 11:130506705-130506727 ATGAGGATCTTACAGGGAACTGG + Intergenic
1091311290 11:134576976-134576998 CTCAGCTTCCTCCAGGGAACAGG - Intergenic
1091987913 12:4928122-4928144 CTTAGAAATTTACAGGGGACAGG + Intronic
1092112499 12:5973674-5973696 CTCAGTATCAGACAGGAAACAGG - Intronic
1093226589 12:16491464-16491486 CTGAGAATCATAAAAGGAACTGG - Intronic
1095421681 12:42030861-42030883 CTAAGAACCATACAGGGAAGGGG + Intergenic
1096818209 12:54215039-54215061 CCCAGAATCCTCCAGGGAACTGG + Intergenic
1097485237 12:60188843-60188865 CTTAGAGTCTTAGAGAGAACAGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099984580 12:89648333-89648355 ATGAGAAACTTACTGGGAACTGG + Intronic
1100164442 12:91900624-91900646 ATGAGAAACTTACTGGGAACTGG + Intergenic
1102882161 12:116493895-116493917 CTCAGCATCCTACAGTGCACAGG + Intergenic
1103419517 12:120769187-120769209 TTCAGAAACTTACATGCAACTGG + Intronic
1103916967 12:124380703-124380725 CTCAGAGTCTCGCAGGGAACAGG + Intronic
1104199660 12:126576131-126576153 CTTAGAATGATTCAGGGAACTGG - Intergenic
1109468851 13:62778198-62778220 CTTAGAACCTTACAGGACACTGG - Intergenic
1112748247 13:102552301-102552323 CTGTGAATGTTACAGGGAAAAGG - Intergenic
1112760175 13:102686595-102686617 CTCACCATCTTACAGTGCACGGG - Intronic
1113202743 13:107885162-107885184 GTCAGGATCTTACAGTCAACAGG - Intergenic
1113453607 13:110431326-110431348 CTCAGTATCTGTCAAGGAACTGG - Intronic
1115159998 14:30383285-30383307 CTCAGAGTCTTTCAGGGATTAGG - Intergenic
1115712158 14:36062399-36062421 CTTAGAATCCTACAGGAAAGGGG - Intergenic
1121914045 14:97819984-97820006 ATGAGAAACTTACTGGGAACTGG + Intergenic
1122470483 14:101962767-101962789 CTCAGAAACCTGCAGGGACCTGG - Intergenic
1125338464 15:38651553-38651575 CACTGAATCTTTCAGAGAACAGG + Intergenic
1127098186 15:55534896-55534918 CTCAGAAACTCTGAGGGAACAGG + Intergenic
1127583189 15:60356065-60356087 CTCAGAGTCTTAGTGGGAAATGG - Intronic
1130713901 15:86312691-86312713 CCCAGAATTTTACAGGGCAAGGG + Intronic
1130759326 15:86801881-86801903 CTCAGAGACTTAAAGGGAATGGG + Intronic
1133880143 16:9773932-9773954 TGCAGAATCTAAAAGGGAACAGG + Intronic
1134662332 16:15993573-15993595 CTCAGTATCTTACAATGCACAGG + Intronic
1135514550 16:23119505-23119527 CTCAGCATCATACAGGGCTCAGG + Intronic
1137835427 16:51587895-51587917 CTCACAATCATAAAGGGACCAGG + Intergenic
1138107744 16:54298735-54298757 CTCAGGATCATACTGGGAACAGG - Intergenic
1138140792 16:54566892-54566914 CTAAGCATCCTACAGGGCACAGG - Intergenic
1138217659 16:55218567-55218589 TTCAGAATCCTACATGGAGCTGG + Intergenic
1138499039 16:57427228-57427250 CTCAGGATCTTACAAGGTGCCGG + Intergenic
1139920514 16:70457047-70457069 CTCAGGATCCTACAGGAAGCAGG + Intronic
1140288778 16:73630487-73630509 CTCAGTACCTTTCAGGGAACAGG + Intergenic
1141861952 16:86723415-86723437 CCCAGAATCATACAGGAGACAGG + Intergenic
1143630859 17:8139637-8139659 CTCAGAACCTGAAAGGGAAGAGG - Intergenic
1145006117 17:19338857-19338879 CTCATGATCCTACAGGGGACTGG - Intronic
1149350387 17:55780813-55780835 CTCAGGATCTTAAAAGGAAAAGG + Intronic
1151075938 17:71272502-71272524 CACTGAATCTTACAAGGCACAGG + Intergenic
1152237675 17:79147002-79147024 CTTTGGATCTTACAGGGAACAGG + Intronic
1152755690 17:82086115-82086137 CACAGAACCACACAGGGAACTGG + Intronic
1153437483 18:5083184-5083206 GTCAGAATGTTACAGGAAAGGGG - Intergenic
1156105390 18:33653296-33653318 CTAAGAATCTTGCAGGGGGCAGG + Intronic
1156283950 18:35672239-35672261 CTGAGAATCAAACAGGGACCTGG - Intronic
1156964107 18:43069421-43069443 TTCAGAGTGTTACAGGAAACGGG - Intronic
1159878472 18:73835301-73835323 CTCAGAATTTTCCAGAGAAGGGG + Intergenic
1160049689 18:75421386-75421408 CTCAGAATCATAGAGGGGAATGG - Intronic
1161150169 19:2703279-2703301 ACCAGAATCCTATAGGGAACTGG + Intergenic
1161887737 19:7010058-7010080 TTCAGATTCTTACAGGGGACTGG - Intergenic
1162959994 19:14119937-14119959 CTAAGAATCTTCCTGGGAGCAGG + Exonic
1163388020 19:17011972-17011994 CTCAACATCTTACAGAGCACAGG + Intronic
1163978800 19:20878737-20878759 ATGAGAAGCTGACAGGGAACAGG - Intergenic
925539713 2:4953367-4953389 ATGAGAAACTTACTGGGAACTGG - Intergenic
926478738 2:13360078-13360100 ATAAGAAACTTACTGGGAACTGG - Intergenic
927063847 2:19449636-19449658 CTTATGGTCTTACAGGGAACAGG + Intergenic
927345346 2:22032215-22032237 GTCAGGATCTTATAGGGAAGGGG - Intergenic
930563620 2:52991999-52992021 CTCAGAAGCTTACAGTCAACTGG - Intergenic
930919273 2:56731901-56731923 CTCAGAAGCTTTCAGGGTCCTGG + Intergenic
932439434 2:71723050-71723072 CACAGAATCCTACAGAGGACTGG + Intergenic
933394603 2:81714863-81714885 CTCAGAACTTTACAGGGCATAGG + Intergenic
933771309 2:85746180-85746202 AACAGAATCTCACAGGGCACAGG + Intergenic
936834762 2:116695294-116695316 ATGAGAAACTTACTGGGAACTGG - Intergenic
937920591 2:127126785-127126807 CTCAGAATTTTCCAAGGAACGGG + Intergenic
938546515 2:132337764-132337786 CACAGAAGCTTTCAGGTAACTGG - Intergenic
938846562 2:135215840-135215862 CTGAGAATCCTACAGTGAACAGG - Intronic
938974225 2:136459955-136459977 ATAAGAAACTTACTGGGAACTGG - Intergenic
939078078 2:137626858-137626880 ATAAGAAACTTACTGGGAACTGG - Intronic
940875596 2:158894141-158894163 CTGAGAATCTGGCAGGGAAGAGG - Intergenic
1168879395 20:1193896-1193918 CTCAGAATCTGGCTGGGATCTGG + Intergenic
1169366893 20:4999960-4999982 CTCAGGATGTCACATGGAACAGG + Intronic
1169948026 20:11010387-11010409 CTCAGGATCTTACAACAAACAGG + Intergenic
1170319840 20:15083267-15083289 CTTAGAATCATACAAGGAAAGGG + Intronic
1172293152 20:33790409-33790431 CTAAAAATCCTACAGGGCACAGG - Intronic
1174039003 20:47686037-47686059 CTCACAACCTTCCTGGGAACTGG - Intronic
1176845057 21:13870341-13870363 ATGAGGATCTTACTGGGAACGGG - Intergenic
1176847788 21:13889899-13889921 ATGAGGATCTTACTGGGAACGGG - Intergenic
1176849163 21:13899658-13899680 ATGAGGATCTTACTGGGAACGGG - Intergenic
1179000321 21:37451820-37451842 CTCAGAATCTTACAGGGAACTGG - Intronic
1179070908 21:38069817-38069839 CTAAAAATCTTTCAGGGAAGGGG + Intronic
1181894083 22:26091390-26091412 CTAAGAATCAGACAGGGAAGGGG + Intergenic
1181989949 22:26829740-26829762 CTCAGCATCTTGCAGGGAGCTGG - Intergenic
1182418990 22:30239552-30239574 CTCAGAATCACACAGGACACTGG - Intergenic
1183564300 22:38602251-38602273 CTCAGCATCCTACAGTGCACAGG - Intronic
1185061188 22:48607692-48607714 CTCAGAATCTCCCAGGCAACAGG - Intronic
1185269283 22:49921481-49921503 CTCAGAATCGTACAGGGTTTGGG + Intronic
949511022 3:4767283-4767305 CTAAGTATCTTACAGTGCACAGG - Intronic
951480461 3:23156128-23156150 CTCAGCAACTTAGATGGAACAGG + Intergenic
954589019 3:51763943-51763965 CTCAGAAGTATACATGGAACAGG - Intergenic
956585614 3:70861328-70861350 CTTAGACTCTGACAGGGATCTGG - Intergenic
957510883 3:81186212-81186234 ATGAGAAACTTACTGGGAACTGG + Intergenic
958453400 3:94301446-94301468 CTCAAAATCTTGAAGGGAAGAGG + Intergenic
962275371 3:134009478-134009500 CTCAGAAACTTACAGTGAGGAGG - Intronic
963647088 3:147928388-147928410 CTCAGAACCATGCAGGGAAAGGG - Intergenic
964935090 3:162074598-162074620 CACAAAATCTTACAGGGCAGAGG + Intergenic
967869231 3:194216213-194216235 CTCAGAAACCTACAGGCAACTGG + Intergenic
970051658 4:11921431-11921453 CTCAGAATAGTACATGGCACAGG + Intergenic
970334045 4:15014580-15014602 CTCAGAATCCTCAACGGAACAGG - Intronic
970734460 4:19149842-19149864 CCCAGAACCTTATAGGGTACTGG + Intergenic
971599351 4:28572417-28572439 CTTAGATTCTTCCAGGGAGCAGG - Intergenic
974623988 4:64398894-64398916 ATGAGAAACTTACTGGGAACTGG + Intronic
976583555 4:86768477-86768499 GACAGAATCTTAAAGGGTACTGG - Intronic
980171852 4:129298767-129298789 CTCAGAACTCTACAGGGACCTGG - Intergenic
980412603 4:132442441-132442463 CTCACAATCTTTCAGGAAACTGG + Intronic
980822665 4:138037551-138037573 ATCAGACTCTTACAGGAAAGGGG - Intergenic
981025300 4:140071730-140071752 CTTATAATTTTACAGGGACCAGG + Intronic
981063830 4:140460066-140460088 CTCAGAATCAAACATGGAGCAGG - Intronic
982780982 4:159491348-159491370 CTGAGAAACTTATTGGGAACTGG + Intergenic
982797653 4:159664781-159664803 ATCAGGAACTTACTGGGAACTGG - Intergenic
986033815 5:3918505-3918527 CTCAGAATCTGAAAGGGAAAGGG + Intergenic
986278836 5:6306063-6306085 CTCATAAGATTACAGGGATCTGG + Intergenic
987829590 5:23077916-23077938 CTAACAATCTTACAGTGCACAGG + Intergenic
989296899 5:39838960-39838982 ATGAGAAACTTACTGGGAACTGG + Intergenic
991198858 5:63966509-63966531 CTCAGAATTTCCCAGAGAACTGG - Intergenic
991222846 5:64236228-64236250 ATGAGGATCTTACTGGGAACTGG + Intronic
991517599 5:67456044-67456066 CTCAGCAGCTGACATGGAACAGG - Intergenic
992773459 5:80070008-80070030 CCCAGAAGGTCACAGGGAACTGG - Intronic
993222397 5:85116983-85117005 CTCAGAATTTTAAAGGAAAGAGG - Intergenic
994805441 5:104441500-104441522 CTAAACATCTTACAAGGAACAGG - Intergenic
994876328 5:105427004-105427026 CTAAGAAACTTACAGGCAAATGG - Intergenic
995418665 5:111937819-111937841 CACATAATCTCACAGGGTACTGG + Intronic
995483668 5:112617509-112617531 CTGAGAATCTTTCGGGGAAGGGG + Intergenic
996519070 5:124406280-124406302 ATCAGATCCTTACAGTGAACAGG - Intergenic
997959431 5:138307956-138307978 CTCAGATTCTCACAAGGAACCGG + Intronic
999167547 5:149563220-149563242 TTTAGAATCTGACAGGGAAGAGG - Intronic
999619567 5:153459003-153459025 CCCAGAGTCTTACAGCTAACTGG - Intergenic
999791559 5:154944571-154944593 CTGAGGATTTTGCAGGGAACAGG + Intronic
999804981 5:155072749-155072771 CTCAGGGTCTTATTGGGAACTGG - Intergenic
1001092726 5:168753090-168753112 CTCAGCATCCTACAGGGAGAGGG + Exonic
1001209882 5:169800812-169800834 CTCAGAATCTTGGAGGGAGAGGG + Intronic
1001529246 5:172450981-172451003 CTCAGGATCTCACAGGCACCTGG + Intronic
1005311818 6:24566102-24566124 ATAAGCACCTTACAGGGAACAGG + Intronic
1006006487 6:31006237-31006259 CACAGAGTCTTACAAGGCACAGG + Intergenic
1007339252 6:41179930-41179952 CACACAATCTTTAAGGGAACAGG + Intergenic
1007704976 6:43785081-43785103 CTCAGATCCTGACAGGGAAGAGG + Exonic
1008018803 6:46552351-46552373 CTCAGAATCTTACAATGAAAGGG - Intronic
1009204648 6:60786939-60786961 CTCAAATTCTTAAAGAGAACTGG + Intergenic
1012356153 6:98316803-98316825 TTCAGACTCTGAGAGGGAACTGG + Intergenic
1014669100 6:124277732-124277754 CTCAGATTCTTGAAGGGACCTGG + Intronic
1021273293 7:18618806-18618828 CACAGAATTTTAGAGTGAACAGG + Intronic
1023487837 7:40705847-40705869 CTCAGAAACTCAGAGGGGACTGG + Intronic
1023690217 7:42778627-42778649 ATGAGAAACTTACTGGGAACTGG + Intergenic
1028112731 7:86962031-86962053 CTCTGAAGCTTACAGGGCTCAGG - Intronic
1030387672 7:108885226-108885248 CTAAAAAGTTTACAGGGAACTGG + Intergenic
1031145640 7:117994509-117994531 ATGAGAAACTTACTGGGAACTGG + Intergenic
1032053075 7:128661855-128661877 CTGAGGAACTTACTGGGAACTGG + Intergenic
1033215443 7:139490169-139490191 CTCAGAAAGTTACAGGGGATGGG - Intergenic
1033707671 7:143904677-143904699 CTCAGAAGCTGACAGTCAACAGG + Intergenic
1033909126 7:146244479-146244501 CTCAGAATGCTACAAGGTACAGG - Intronic
1034787924 7:153942403-153942425 CTCAAGATCTCACAGGGAACTGG - Intronic
1035436621 7:158864250-158864272 CTCAGTGTCATGCAGGGAACAGG + Intronic
1043127209 8:76414093-76414115 CTCAGTAGCTTAGAGAGAACTGG - Intergenic
1043137869 8:76550259-76550281 ATGAGAAACTTACTGGGAACTGG - Intergenic
1044772877 8:95655727-95655749 CTCAGATACCTAGAGGGAACTGG - Intergenic
1045288416 8:100811540-100811562 CACAGAATCTTACTGAGCACTGG + Intergenic
1045492443 8:102680532-102680554 CTCAGAACTGTACAGGGAAAGGG - Intergenic
1045997779 8:108383526-108383548 CTCAGAACCTCACAGAGAAGTGG - Intronic
1046826267 8:118695312-118695334 ATAAGAAACTTACTGGGAACTGG - Intergenic
1047394208 8:124479581-124479603 CTAAAAATCTTACAGTGCACAGG - Intronic
1049219690 8:141423368-141423390 CTCAGAATATGACTGGGATCAGG + Intronic
1049310304 8:141930629-141930651 CTCAGCATCTCACAGGGCGCAGG + Intergenic
1051669229 9:19493650-19493672 CTCAGATTCTTTCTGGGAAGAGG - Intergenic
1051979588 9:22997895-22997917 ATGAGAAACTTATAGGGAACTGG - Intergenic
1052878576 9:33585854-33585876 ATGAGAAACTTACTGGGAACAGG + Intergenic
1053497400 9:38558355-38558377 ATGAGAAACTTACTGGGAACAGG - Intronic
1056315467 9:85385325-85385347 CTCAGAATGTTATAAGGAATTGG + Intergenic
1057121931 9:92584074-92584096 CTCAGAATGTGTCAGGGACCTGG + Intronic
1058398648 9:104587571-104587593 CCCAGAATCTTCTTGGGAACAGG - Intergenic
1059502407 9:114766505-114766527 CTAAGACTCTGACAGGGGACAGG + Intergenic
1061679188 9:132234498-132234520 TTCAGGATCTTTCAGGGACCAGG - Intronic
1061792075 9:133064168-133064190 CCCAGAATCTTAGAGGAAACTGG - Intronic
1061970935 9:134045122-134045144 CTCAGAGCCTGACAGGGACCTGG + Intronic
1185478967 X:432324-432346 CTCAGCATCCTACAGGGCCCAGG - Intergenic
1185573268 X:1151123-1151145 CTCAGCATCCTACAGGGCACAGG - Intergenic
1185761770 X:2693928-2693950 CTCAGAATCTTTCAAGGGCCAGG + Intronic
1187479105 X:19638753-19638775 CTCAGAATCTGACCCAGAACTGG - Intronic
1188593513 X:31868390-31868412 TTCTGAATTTTACAGGGATCAGG - Intronic
1189813777 X:44804500-44804522 CTCAGCATCCTACAGTGCACAGG + Intergenic
1192608447 X:72544045-72544067 TTCAGAATCTTAAGGGGAAGTGG - Intronic
1192779838 X:74282873-74282895 CTGAGAAACTTACAGGCAATAGG - Intergenic
1192926340 X:75758816-75758838 CTCAGAATCTCAAAGCGAAAAGG - Intergenic
1193981287 X:88184954-88184976 ATAAGAAACTTACTGGGAACTGG + Intergenic
1194043413 X:88971258-88971280 ATGAGAAACTTACTGGGAACTGG - Intergenic
1197648177 X:129039568-129039590 CTCAGACTCTAAGAGGGAGCAGG + Intergenic
1197815543 X:130494338-130494360 CTCAGAATCTTGTTGGGAATGGG + Intergenic
1198007931 X:132517758-132517780 CTAAGCATCTTATAGGGCACAGG + Intergenic
1199207238 X:145163427-145163449 CTGAGAATTTTGCAGGGGACCGG - Intergenic
1199311862 X:146330157-146330179 CTCTGAATTTTACATGGAATAGG - Intergenic
1199929860 X:152507098-152507120 ATGAGAAACTTACTGGGAACTGG - Intergenic
1200785392 Y:7256184-7256206 TTCAGAATATTAGTGGGAACTGG - Intergenic