ID: 1179002599

View in Genome Browser
Species Human (GRCh38)
Location 21:37477276-37477298
Sequence AGGAACACAAAGATGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179002590_1179002599 6 Left 1179002590 21:37477247-37477269 CCCAGCACAAATGTCCAGAAGAG 0: 1
1: 0
2: 2
3: 25
4: 188
Right 1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 322
1179002591_1179002599 5 Left 1179002591 21:37477248-37477270 CCAGCACAAATGTCCAGAAGAGT 0: 1
1: 0
2: 9
3: 101
4: 561
Right 1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 322
1179002595_1179002599 -8 Left 1179002595 21:37477261-37477283 CCAGAAGAGTTGGGCAGGAACAC 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179002599 Original CRISPR AGGAACACAAAGATGGGCCA GGG Intronic
901187209 1:7382235-7382257 AGGAAGAGAAAGCTGGGCAAAGG + Intronic
901189501 1:7399459-7399481 AGCAACACAAAAATGGACTAAGG + Intronic
901228866 1:7630932-7630954 AGGAACTGAAAGAGGGGCCCTGG - Intronic
901787043 1:11631645-11631667 AAGAACACGAAGATGGGCTGTGG + Intergenic
906148635 1:43575065-43575087 AGGAGCCCACAGATGGGCCCAGG - Intronic
906600808 1:47127562-47127584 AGGAACACCAAGATGCCCCTTGG - Intergenic
908189999 1:61692593-61692615 ATAAACAAAAAGATGAGCCAGGG + Intronic
908215975 1:61952378-61952400 GGGAACACAACAATGGTCCAAGG + Intronic
908800336 1:67873478-67873500 AGGACCAGAGAGATGGGCCTGGG + Intergenic
908827638 1:68148917-68148939 GGGAACACAAAGAAAGGCCTCGG + Intronic
908851028 1:68375810-68375832 AGGGACCCAAAGAGGGGCAATGG - Intergenic
908897683 1:68918890-68918912 AACACCACAAAGATGGGCTATGG - Intergenic
910365407 1:86459964-86459986 AGGAACAAAAAGAGGGCCAAGGG + Intergenic
910516859 1:88071454-88071476 AGCACCACAAGGATGGGTCATGG + Intergenic
913571505 1:120124907-120124929 AGTAAGACAAAGAAGGGACAAGG - Intergenic
915389991 1:155533981-155534003 AGTAACACAAACATGGTCCTTGG + Intronic
915404451 1:155648899-155648921 AGGCACATAAATATGGGCTAAGG - Intergenic
915658213 1:157379607-157379629 GGGAACAGAGAGATGGACCAAGG + Intergenic
915670804 1:157487084-157487106 GGGAACAGAGAGATGGACCAAGG - Intergenic
917429857 1:174954786-174954808 AGGAGCAGAAACAAGGGCCAAGG - Intronic
917854183 1:179088064-179088086 AGAAACAGAAAGATAGTCCATGG - Exonic
917971666 1:180211831-180211853 AGGAACTGAAAGAGGGGACAGGG - Intergenic
918434757 1:184500083-184500105 AGGAACAGAATGAGTGGCCAAGG - Intronic
919304529 1:195814391-195814413 AGAAACACAATGAAGGGCAAAGG - Intergenic
920134133 1:203755823-203755845 AGTAACAATAGGATGGGCCATGG - Intergenic
920232665 1:204480877-204480899 AGGAACACCACGATGGCACAGGG - Intronic
921278707 1:213544533-213544555 GGGAACACACAGAGGGGCCACGG - Intergenic
922669252 1:227496291-227496313 AAGAGAACAAAAATGGGCCAGGG - Intergenic
922670342 1:227505011-227505033 AAGAGAACAAAAATGGGCCAGGG + Intergenic
922821502 1:228488196-228488218 GGGACCACAAAGATGGGCGCTGG - Intronic
923048260 1:230371275-230371297 AGGAACACAGCAATGGGACAAGG + Intronic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
1062858872 10:794485-794507 AGGTACACAGAGGTGGGCCCAGG - Intergenic
1063864150 10:10345643-10345665 AGGAACAGAAAGATAAGCAAAGG - Intergenic
1063892073 10:10640883-10640905 AGGGAAACAAAGATGGCCAATGG - Intergenic
1064978049 10:21138490-21138512 AGAAACAAAAAGAGGGGTCAGGG + Intronic
1066351031 10:34636858-34636880 AGGAAAACCAAGAAGGGCAAAGG + Intronic
1066456547 10:35577238-35577260 AGGAACGCCAAGGTTGGCCAGGG + Intergenic
1067074980 10:43172973-43172995 AGGGGCACATAGCTGGGCCAGGG + Intronic
1067142809 10:43670595-43670617 AGTAACACAAAGCTGTCCCAGGG - Intergenic
1067808211 10:49407808-49407830 AGGAACACCCAGATTGGCCCTGG - Intergenic
1068353433 10:55880392-55880414 AGAAACACAAAGATAGGGCCGGG + Intergenic
1069351552 10:67532702-67532724 AGGAGAAGAAAGATGGGACAGGG + Intronic
1069992475 10:72323886-72323908 AGGAGGACAAAGGTGGGCCGGGG - Intergenic
1070673310 10:78393364-78393386 AGGACCAAAAAGATGTGACATGG + Intergenic
1071876701 10:89850683-89850705 GGGAACACAAATTTGGTCCAAGG + Intergenic
1072088652 10:92105426-92105448 ATGAACACAAAAATGGGAAATGG - Intronic
1072533775 10:96344056-96344078 AGGACCACAGGAATGGGCCAAGG - Exonic
1073750726 10:106523854-106523876 AGGAACACTAAGTTGGTACATGG + Intergenic
1074384870 10:113008826-113008848 AGGAACAGAAAGATGAACAAGGG - Intronic
1074432851 10:113408535-113408557 AGGAGCACGAAGATGCTCCAGGG + Intergenic
1074446332 10:113524223-113524245 AAGAACACACTGATGGACCATGG - Intergenic
1075568694 10:123522761-123522783 GGGAATACAAAGATGGCTCAAGG - Intergenic
1077511809 11:2969461-2969483 AGGAAGACAGAGATGGGCTCTGG + Intronic
1077683976 11:4273433-4273455 ACAAACACAAAGAAGGGCAATGG + Intergenic
1077686066 11:4293331-4293353 ACAAACACAAAGAAGGGCAATGG - Intergenic
1077691218 11:4344490-4344512 ACGAACACAAAGAAGGGCAATGG - Intergenic
1079380000 11:19929798-19929820 TAGAACACAAAGATGAGTCAGGG + Intronic
1079763932 11:24365791-24365813 AGGAAGAAATGGATGGGCCATGG + Intergenic
1082949274 11:58793303-58793325 AGCAAGACAAAAATCGGCCATGG + Intergenic
1083266178 11:61547947-61547969 AGGAGGAGAAAGATGGGCAAGGG - Intronic
1083463870 11:62832639-62832661 AGACACACAAAGAGGGCCCAGGG - Intronic
1083533376 11:63446142-63446164 AGGAACACAAGACTGGGCAAAGG - Intergenic
1083979412 11:66153841-66153863 AGTAGCACTAAGATGGGGCAGGG + Intronic
1085301617 11:75462203-75462225 AGGAACATAAGGCTGGGCCAGGG - Intronic
1085456821 11:76670314-76670336 AGGAACACACAGCTAGGCAAGGG - Intronic
1086514418 11:87595322-87595344 AGGAACAGAATGATTGCCCAAGG - Intergenic
1087770273 11:102201938-102201960 AGGCACAAAAAGATGTTCCAAGG - Intronic
1087935194 11:104025725-104025747 AGGAACACAAACATGAGCACAGG + Intronic
1088014644 11:105044220-105044242 AGGAACACAAAAAAGAGTCAAGG + Intronic
1088320411 11:108549676-108549698 AGTAACTCAAGAATGGGCCAGGG - Intronic
1089112500 11:116067939-116067961 AGGAGCCCAAACATAGGCCATGG - Intergenic
1089424165 11:118357268-118357290 AGGCACACAAAGATTGCCCAGGG + Intergenic
1089732946 11:120530769-120530791 AGGAAGACAGAGATGGCCCTGGG + Intronic
1090013207 11:123062739-123062761 TGGAACACGAAGGTGGGGCATGG - Intronic
1090587336 11:128228086-128228108 AGGAATACAAAGAAGGGCTCTGG + Intergenic
1090801952 11:130178674-130178696 GGGAACACAAAGCTGACCCACGG - Intronic
1091777539 12:3194325-3194347 AGGGACACAAAGGGTGGCCAGGG - Intronic
1092314668 12:7397852-7397874 AGGAACATAAAGTTGGGTCAGGG + Intronic
1093599507 12:21004305-21004327 AGGAACAGAATTAAGGGCCAAGG - Intergenic
1094331281 12:29296878-29296900 AGGAAGAGAAGGATGGGTCATGG - Intronic
1094814286 12:34168098-34168120 AGAAGAACAAAAATGGGCCAGGG - Intergenic
1095102638 12:38200491-38200513 AGAAGAACAAAAATGGGCCAGGG + Intergenic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1096262203 12:50099909-50099931 AGGAAGACAGGGATGGCCCAGGG - Exonic
1096766052 12:53890740-53890762 AGGACCAAAGTGATGGGCCATGG - Intergenic
1097640143 12:62171274-62171296 TGGAACACAAAAATGGTGCATGG - Intronic
1097973958 12:65664899-65664921 AGGATCAGAGAAATGGGCCATGG - Intergenic
1098290493 12:68952949-68952971 AGAATCACACAGATAGGCCAGGG - Intronic
1099276356 12:80581363-80581385 AGGATCACAAGCATGCGCCATGG - Intronic
1103284189 12:119786552-119786574 AGGGCAACAAAGATGGGCCCAGG - Intronic
1103462441 12:121115766-121115788 ATGAACACAAGAATGGGGCAAGG + Intergenic
1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG + Intronic
1104870073 12:131988737-131988759 AGGAGGATAAAGAAGGGCCACGG - Intronic
1104963053 12:132497375-132497397 AGGACCACAGAGCTGGCCCAAGG + Intronic
1108000888 13:45904740-45904762 AGGAAGAAAAAGATGGGCACAGG + Intergenic
1108523260 13:51263344-51263366 GGGAACACAAAGGTTGGCAAAGG - Intronic
1110154229 13:72294406-72294428 ATGAACAAAAAAATGGGGCAGGG + Intergenic
1112266179 13:97925828-97925850 GGGAATACAAAGATGAGCAATGG - Intergenic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1114036239 14:18631247-18631269 AGGAAGAAAAGGATGGGGCACGG - Intergenic
1114122397 14:19683788-19683810 AGGAAGAAAAGGATGGGGCACGG + Intergenic
1121291773 14:92781667-92781689 AGTAATAGAAAGATAGGCCAGGG + Intergenic
1121436511 14:93924219-93924241 AGGAACACAGGGATGGGAGAGGG + Intronic
1121689479 14:95865952-95865974 AGGATAAGAAAGATGTGCCAAGG + Intergenic
1121844372 14:97159988-97160010 AGGAACACAGGGATGGGGCTGGG + Intergenic
1125799699 15:42434534-42434556 AGGAACATAAAGAAGGGGGAGGG - Intronic
1126511947 15:49487574-49487596 AAGAACATAAAGATGTGCGAGGG + Exonic
1127065363 15:55231746-55231768 AGAAAGACAAAGCTGGGGCATGG - Intronic
1127332776 15:57955100-57955122 AGGAATACAAAGTTGAGCCACGG - Exonic
1127979488 15:64024229-64024251 AGGGACTCAGAAATGGGCCAGGG + Intronic
1128623683 15:69176520-69176542 AAAAAAACAAAAATGGGCCAGGG - Intronic
1128662291 15:69510912-69510934 TGGAACAAAAAGATGGGGGAAGG + Intergenic
1129113673 15:73352930-73352952 GGGAACACACAGTTGGGCAAGGG + Intronic
1129400224 15:75277235-75277257 AGGAACACCAGGATAGGCAAGGG - Intronic
1129461161 15:75700663-75700685 GGGAACTCAGAGATGAGCCATGG - Intronic
1129723669 15:77891079-77891101 GGGAACTCAGAGATGAGCCATGG + Intergenic
1131694721 15:94864117-94864139 AGGAAGAAAAACATAGGCCAAGG - Intergenic
1131959592 15:97774333-97774355 AGGTAAACAAACATGTGCCATGG - Intergenic
1132321315 15:100927470-100927492 AGGGACACACACAAGGGCCAAGG + Intronic
1132959751 16:2615212-2615234 AGGAACCCACATATGGGACATGG - Intergenic
1134206389 16:12241763-12241785 GGGGAAACAAAGATAGGCCAGGG - Intronic
1134552740 16:15145551-15145573 AGGAACGCCAGGCTGGGCCAGGG + Intergenic
1136281861 16:29218063-29218085 AGGAACAGAAAGCTGGGAAAGGG - Intergenic
1137616623 16:49852183-49852205 AGGAAGACAAAGAAGGGGAAGGG + Intronic
1138446686 16:57068838-57068860 TGAAAGACAAAGAAGGGCCAAGG - Intronic
1138453575 16:57107798-57107820 AGGAACACAATGAGGGAGCAGGG - Intronic
1138967644 16:62104814-62104836 AGGAATAGAAAGATGGTCCTTGG - Intergenic
1140554042 16:75900330-75900352 AGAAAGACATAGATAGGCCAAGG - Intergenic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1140733029 16:77873577-77873599 AGCAGCACAAACATGGTCCAAGG + Intronic
1141419714 16:83905633-83905655 ACAAAGAAAAAGATGGGCCAAGG + Intronic
1141727184 16:85797589-85797611 AGGCACTCAAAGATGTGCCCAGG + Intronic
1142086235 16:88183979-88184001 AGGAACAGAAAGCTGGGAAAGGG - Intergenic
1143088043 17:4431471-4431493 AGGGGGACAAAAATGGGCCAAGG - Intergenic
1143088469 17:4434249-4434271 AGGAGCAGAAAGATGGGTGATGG - Intronic
1143510736 17:7393942-7393964 AGGCAGAGAAAGATGGGGCAGGG + Intronic
1143671113 17:8396791-8396813 AGGAACTCAAGGATGGGGAATGG - Intronic
1145188991 17:20822086-20822108 AGGCACACAAGTATGGGCAACGG + Intergenic
1146978592 17:37138355-37138377 AGGAAGACAGAGCTGGGCCCTGG - Intronic
1147568330 17:41551435-41551457 AGGTACAAAAAGTTGGGGCAGGG - Intergenic
1148262258 17:46193615-46193637 AGGTACAAAAACATCGGCCACGG - Intronic
1149982693 17:61323846-61323868 AGGAACCCACACAGGGGCCAGGG - Intronic
1150222384 17:63503855-63503877 ACAAAAACAAAGATGGGCAAAGG - Intronic
1150476971 17:65483021-65483043 AGAGACACACAGATGGGCGAAGG - Intergenic
1150944077 17:69725079-69725101 TGGTACATAAAGGTGGGCCATGG - Intergenic
1152246865 17:79189279-79189301 AGGATCACAGAGGTGGTCCAAGG + Intronic
1152334315 17:79691707-79691729 TGGGACACAGAGCTGGGCCAGGG + Intergenic
1152359209 17:79822916-79822938 AAGAACACAGAGAGAGGCCAAGG - Intergenic
1152957395 18:50702-50724 AGAAGAACAAAAATGGGCCAGGG - Intronic
1153837657 18:8978495-8978517 AGGAACAAAAATATGATCCAAGG - Intergenic
1154091851 18:11371641-11371663 TGGAACACAAGGACGGGGCAAGG - Intergenic
1155676835 18:28440300-28440322 AGGAACACAAAGGTGTTCCTGGG + Intergenic
1155998016 18:32352598-32352620 TGGAACAGAAAGAGGGGACAGGG + Intronic
1156825432 18:41425172-41425194 AAGAAAACAAAGCAGGGCCAGGG - Intergenic
1157528166 18:48400906-48400928 GGCCACACAAAGATGGGGCACGG - Intronic
1158904396 18:61998143-61998165 AGGAACTGAAAGAAGGGCAATGG - Intergenic
1160160330 18:76465830-76465852 ACGAAAACAGAGATGGACCAAGG + Intronic
1161506386 19:4646068-4646090 AGGAAGAGAGATATGGGCCACGG - Intronic
1164257666 19:23543350-23543372 AGGAAAACAAAGATGATCCTGGG - Intronic
1164887358 19:31792813-31792835 AGGAATACAAACCTGGGTCATGG - Intergenic
1165641681 19:37394377-37394399 AGGATCAGAAAGATGGGCTGGGG - Intergenic
1165754207 19:38282665-38282687 GGGCACACCAAGATGGGCCTGGG - Intronic
1166211311 19:41308349-41308371 AGGAAGGGGAAGATGGGCCATGG - Intronic
1166560617 19:43730141-43730163 AGGGAGACAAATATGTGCCACGG + Exonic
1167479265 19:49719535-49719557 AAGAACGCCAAGAAGGGCCAGGG - Intergenic
1167663661 19:50811149-50811171 AGGAACACCATGATTGGCCCAGG + Intergenic
1168084561 19:54035989-54036011 AGAAACACAAAGATGACTCAGGG - Intergenic
1202665483 1_KI270708v1_random:115240-115262 AAGAAAACACAGTTGGGCCAGGG + Intergenic
925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG + Intronic
925657784 2:6167979-6168001 AGGAGCACAGAGCTGGGCCGGGG - Intergenic
926056042 2:9774584-9774606 AGGACCACAGAGATGAGCCCTGG - Intergenic
926313361 2:11691454-11691476 AGGAAAGCATAGATGGGACACGG - Intronic
928367932 2:30717056-30717078 AGGAACAGATAGATGAGGCATGG - Intergenic
928655559 2:33447269-33447291 AGGAACAGGAGGCTGGGCCAGGG + Intronic
929565373 2:42980474-42980496 AGAAACACAGTGATGGGTCAAGG + Intergenic
929999473 2:46851083-46851105 AGCAACCCAAAGCCGGGCCAAGG - Intronic
930172202 2:48263372-48263394 AGGGACAAAAACATGGGCAAAGG + Intergenic
932831672 2:74996343-74996365 AGGAAGCCACAGATGGTCCAAGG - Intergenic
933220243 2:79679572-79679594 AGGACCACAGAGATGGGAAAGGG - Intronic
935132591 2:100271687-100271709 GGGGACACAGAGGTGGGCCACGG + Intergenic
935161253 2:100531443-100531465 AGGAAGTCCAAGATGGGCCTGGG + Intergenic
937735171 2:125279243-125279265 AGGAAGACAAAGGTGGACCAGGG - Intergenic
938116154 2:128604113-128604135 AGGAACAAAAAGAAGGGTGAGGG - Intergenic
938381264 2:130837622-130837644 AGGAACCCCAAGATGGGCCGGGG + Intronic
938441216 2:131335359-131335381 AGGAAGAAAAGGATGGGGCACGG - Intronic
939168962 2:138671594-138671616 GGGAAGACAAAGATGCTCCAGGG - Exonic
939203027 2:139062927-139062949 AGGAACACAGACATATGCCAAGG - Intergenic
939905496 2:147908414-147908436 AGGAAAGCAAAGAAAGGCCAAGG - Intronic
944913690 2:204335724-204335746 TGGAACAGAAAGATGTGCCCTGG + Intergenic
946654424 2:221930526-221930548 ATGAACACAGAAATGGTCCAAGG + Intergenic
947122466 2:226831529-226831551 AGGAGCACCAAGAAAGGCCAAGG + Intergenic
947308028 2:228768554-228768576 ACAAAAACAAAGATGGGCAAAGG - Intergenic
947745694 2:232506291-232506313 AGGGACACAGAGACAGGCCACGG + Intergenic
1169170381 20:3460096-3460118 AGGAACCCCAAGATGGGGGAAGG - Intergenic
1169492897 20:6086161-6086183 AAGGACACAAAGAAGTGCCATGG + Intronic
1171139727 20:22730180-22730202 AGGAACAGATACATGGGCAAAGG + Intergenic
1171470199 20:25364258-25364280 AGCAACACAAAAATGGACTAAGG - Intronic
1171775482 20:29363475-29363497 AGAAGAACAAAAATGGGCCAGGG - Intergenic
1171817500 20:29801280-29801302 AGAAGAACAAAAATGGGCCAGGG - Intergenic
1172151882 20:32796575-32796597 GGGAACATCAAGATGGGCAAGGG - Intronic
1172778228 20:37420388-37420410 AGGAGCACAAAGCGGGGCCCTGG - Intergenic
1173228026 20:41173393-41173415 AGGCAGACAAAGAAGGGCCTGGG - Intronic
1173453394 20:43185256-43185278 AAGAAAACAAACAAGGGCCATGG - Intronic
1175380697 20:58560460-58560482 AGAAAGACAAAGCTGGGCCAGGG + Intergenic
1175686340 20:61031240-61031262 AGGAACCCAAAGATAGGCTGTGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176994351 21:15537303-15537325 AGGTGCACAAAGATGAGGCAAGG + Intergenic
1178744454 21:35235146-35235168 AAGAACAGAGAGATGGGCAAAGG + Intronic
1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG + Intronic
1180460367 22:15558307-15558329 AGGAAGAAAAGGATGGGGCACGG - Intergenic
1181313906 22:21960007-21960029 AGGAGCACAAAACTGGCCCAAGG - Intronic
1181436854 22:22916169-22916191 AGAAACACGAAGATGGTCCCAGG - Intergenic
1181581212 22:23829135-23829157 AGGAACACAGGGCTGGCCCAGGG - Intronic
1182172087 22:28241333-28241355 AGGAACACAAAGAATGGCTGAGG + Intronic
1182551318 22:31102336-31102358 GGGAACACAGTGATGGGGCAAGG - Intronic
1184073708 22:42162901-42162923 AGGAACACACACAGAGGCCATGG + Intronic
1184219234 22:43088641-43088663 CGGTACAAAAAGATGGGCCCCGG - Intronic
951208969 3:19953700-19953722 ATTAACAGAAAGTTGGGCCAGGG - Intronic
952916994 3:38254169-38254191 AGATACACAAAGATGGGCTGTGG + Exonic
953556399 3:43949854-43949876 TGGGACACCAAGATGGGCCTGGG + Intergenic
953964574 3:47293799-47293821 AGGAAACAAAAGATGGGCAAGGG - Intronic
954098174 3:48347706-48347728 AGGAGAACTCAGATGGGCCAAGG + Intergenic
954915155 3:54142539-54142561 AGGAAAACAAAGATGAGAAAAGG - Intronic
957482398 3:80815781-80815803 AAGAACATACAGTTGGGCCATGG + Intergenic
957537063 3:81520004-81520026 AGGAACAGAAAGAGGCACCAGGG + Intronic
957664802 3:83213902-83213924 AAGAACACAAAGAAGGTTCAGGG + Intergenic
959235222 3:103712386-103712408 AGGAACAGGGAGGTGGGCCAAGG - Intergenic
959611769 3:108302991-108303013 AGCAACAAAGAGATGGGGCATGG - Intronic
960087517 3:113606959-113606981 AGGAACACAAAGAGCAGACAGGG - Intronic
960736758 3:120789570-120789592 AGGAACAAAATGATGAGCCCTGG - Intergenic
960853908 3:122083614-122083636 AGGAACAGAAAAATCAGCCAAGG - Intronic
961038050 3:123656742-123656764 TGGAACACAAAGATAAGACATGG - Intronic
962449743 3:135503026-135503048 AGGAATACAAAAATGAGCAAGGG - Intergenic
962973742 3:140428252-140428274 AGAAAAAAAAAGATGGGCCAAGG - Intronic
963087212 3:141449169-141449191 AGGAACAAAAACATGGGCTTTGG - Exonic
963194097 3:142507096-142507118 AGGAACACAAAGATAGGAAGGGG + Intronic
964625019 3:158750394-158750416 AAGACGACCAAGATGGGCCAGGG - Intronic
965093594 3:164193402-164193424 GAGAACACAAAGCTGTGCCAAGG - Intergenic
966387478 3:179415305-179415327 ATGAACATAAAGATGTTCCAAGG + Intronic
966744201 3:183260083-183260105 AGGAACACAGGGATGGGGCTGGG + Intronic
966919544 3:184602774-184602796 AGGAACACAGAGAGGGAACAAGG - Intronic
967030891 3:185605582-185605604 ATGAACACAAAGAAAGGGCAAGG - Intronic
968934471 4:3602808-3602830 AGGGACACAAAGAAGAGCCCAGG - Intergenic
972306905 4:37839407-37839429 AGGAAAACACTGAGGGGCCAGGG - Intronic
972325225 4:38008809-38008831 CAGAACACAAACATGGGCGAAGG - Intronic
972345048 4:38185646-38185668 AGGAACCCAGAGATGCCCCATGG - Intergenic
973647350 4:52962963-52962985 GGGAATAGAAAGAAGGGCCAAGG + Intronic
974235578 4:59177352-59177374 AAGAACACAAAGAAGTACCATGG - Intergenic
976689649 4:87855461-87855483 AGAATTAAAAAGATGGGCCAGGG + Intergenic
976691162 4:87868669-87868691 AGGAACACAATCATCAGCCAGGG + Intergenic
977661241 4:99589350-99589372 ATGAAAACAAGGATGGCCCAGGG - Intronic
977740203 4:100470842-100470864 ATGAACACATAGAGGGGTCAAGG + Intronic
977858936 4:101931883-101931905 AGGAGCAGAAACATGGGCCATGG + Intronic
979442998 4:120774597-120774619 AGGAAAACAAATTTGTGCCAGGG + Intronic
982117206 4:152107564-152107586 AGGAAAACAGTGGTGGGCCAGGG + Intergenic
982892231 4:160869563-160869585 GGGAAAGCAAAAATGGGCCATGG - Intergenic
986424142 5:7613558-7613580 ATGAACACACTGATGTGCCAGGG - Intronic
987954962 5:24727332-24727354 AGGAACAGAAATAGGGGCAAAGG - Intergenic
988852856 5:35196517-35196539 AGGAAAACAAACATAGGGCAGGG + Intronic
990871406 5:60434785-60434807 AGGTACAAAAAGAAAGGCCAGGG + Intronic
994083102 5:95730397-95730419 ACTAACACCAAAATGGGCCAGGG - Intronic
994506087 5:100644583-100644605 AGGAAAACATACATGGTCCATGG + Intergenic
994769077 5:103958295-103958317 AGGAACCCAAAGATGTTCTAAGG + Intergenic
995131554 5:108636012-108636034 AGGTAGACCAAGATGGGCTAGGG + Intergenic
996598026 5:125227339-125227361 AGGAGCACAAATATGTCCCAAGG - Intergenic
996707689 5:126513655-126513677 TCGAACACAAAGAAGGGCCTAGG + Intergenic
999438959 5:151586390-151586412 AGGAACAGAAAAAGGGGCAAGGG + Intergenic
1001022075 5:168191490-168191512 AGGACCACAGAGATGGGGCGGGG - Intronic
1001397808 5:171429277-171429299 AGGAAGACACAGAGAGGCCACGG - Intronic
1002100644 5:176855925-176855947 AGGAACACAGCGAGGGGCCAGGG - Intronic
1003728674 6:8794943-8794965 AGAAAGACAAAGAGGGGACATGG - Intergenic
1005106581 6:22230222-22230244 GGGAAGAAAAAGCTGGGCCAGGG - Intergenic
1005390428 6:25327257-25327279 AAGAACAGAAAGAACGGCCAGGG + Intronic
1005650320 6:27879539-27879561 GGGAACACAAAGATGGGAATAGG + Intergenic
1007041144 6:38723577-38723599 AGAAAGACAAAGTTGGGGCAGGG + Intronic
1011621824 6:89250529-89250551 AGGAAAAAAAAAATGGCCCAAGG - Intergenic
1011767974 6:90644786-90644808 ACAAACACCAAGATGGGGCAGGG - Intergenic
1015120113 6:129692084-129692106 AGGAACAGAAAAATGGGCAGGGG - Intronic
1015932633 6:138376700-138376722 AGGAACACATAAATGGAACAAGG + Intergenic
1016048354 6:139504035-139504057 ATGAACAGAGAGATAGGCCATGG - Intergenic
1016321694 6:142853725-142853747 AGCAAGACACAGATGGGCCAGGG + Intronic
1019576407 7:1739743-1739765 AGCAAGACAAAAATGGGCCCTGG + Intronic
1019611419 7:1938703-1938725 AGGTGCACACACATGGGCCAGGG + Intronic
1019611525 7:1939229-1939251 AGGCACACACACACGGGCCAGGG + Intronic
1022378505 7:29837765-29837787 ATGAATACAAAGATGGGCACAGG + Intronic
1022739569 7:33108734-33108756 TGGGAGACAAAGAAGGGCCAGGG - Intronic
1022780115 7:33573010-33573032 AAGAACAGAAAGAGGAGCCAGGG - Intronic
1022871909 7:34488744-34488766 GGGAAGAAAAAGATGGGTCAGGG + Intergenic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1025014219 7:55425913-55425935 AGAGACACAGAGAGGGGCCAAGG - Intronic
1029313016 7:99685379-99685401 AGCAAGACAAAGATGTTCCAAGG + Intronic
1032750025 7:134830074-134830096 AGGAAAAAAAAAAGGGGCCAGGG + Intronic
1034992715 7:155558271-155558293 AGAAACCCAAAGCTGAGCCATGG + Intergenic
1035914664 8:3606177-3606199 GGGAGGACAGAGATGGGCCAAGG + Intronic
1036836209 8:12070672-12070694 ATGGACATAAAGATGGGACATGG + Intronic
1036858051 8:12317241-12317263 ATGGACATAAAGATGGGACATGG + Intergenic
1037104726 8:15093063-15093085 AGAAACACAAAGTTGGACCCTGG + Intronic
1037455631 8:19060805-19060827 AGGAACTGAAAGATGAGACATGG + Intronic
1038099049 8:24351339-24351361 AGAAACGCAAAGTGGGGCCATGG - Intronic
1039800138 8:40947142-40947164 AGGAACAAACAGATGAGCTATGG + Intergenic
1041267684 8:56081162-56081184 TGGATCACAAAGCTGTGCCATGG - Intergenic
1044843617 8:96359385-96359407 GAGAACACAAGGAAGGGCCAAGG - Intergenic
1046098761 8:109590780-109590802 ACTAACAGAAAAATGGGCCAAGG + Intronic
1047868167 8:129052269-129052291 AGGAACACAAAAATGTGTTATGG - Intergenic
1049319438 8:141988160-141988182 AGGAACACAGAGAGGGGTCCAGG - Intergenic
1049546839 8:143236171-143236193 GGGAACACAGCCATGGGCCATGG + Intergenic
1050663297 9:7907563-7907585 AGGAACACAGAGGTGGGACAGGG - Intergenic
1051101851 9:13531046-13531068 AAGCACACAAAGATGCACCAGGG - Intergenic
1051368497 9:16338485-16338507 AGGTACACAAATACGGTCCACGG + Intergenic
1051560589 9:18436626-18436648 AGCAACACAGAGGTAGGCCATGG - Intergenic
1051788684 9:20774899-20774921 AGGAACACTAAGATGGGGATGGG - Intronic
1052291603 9:26847632-26847654 AGAAACAAAAACATGGGCAAAGG - Intronic
1052391417 9:27882559-27882581 AGGAAGACAGAGATGAGCCCAGG - Intergenic
1053019912 9:34687647-34687669 AGGAACACACAGACGGAGCAGGG - Intergenic
1054455687 9:65429172-65429194 AGGGACACAAAGAAGAGCCCAGG + Intergenic
1055096108 9:72415743-72415765 GGGAACAAAAAGATTGGCCTTGG + Intergenic
1056028335 9:82524625-82524647 AGCTACACAATGATGGGCCACGG + Intergenic
1056422663 9:86444582-86444604 AGAAACACAAAGAAAGACCAAGG - Intergenic
1056505600 9:87255377-87255399 AGGATCACAATGATTGGGCAGGG + Intergenic
1056716335 9:89033574-89033596 ACAAACACAAAGATTGGCCTGGG - Intronic
1056753557 9:89368410-89368432 GAGAGCACAGAGATGGGCCAGGG - Intronic
1060452219 9:123753764-123753786 AGGAAAACAAAGGAGGACCAAGG + Intronic
1061886686 9:133594637-133594659 AGGGACCCAAAGCTGGGCCCAGG - Intergenic
1062077381 9:134598208-134598230 AGGAACAGAGAAAAGGGCCAAGG - Intergenic
1203369051 Un_KI270442v1:285713-285735 AGAAGAACAAAAATGGGCCAGGG - Intergenic
1185687884 X:1944858-1944880 AGAAACGCAAAGGTGGGGCATGG + Intergenic
1186782872 X:12930854-12930876 ATGGACACAAAGATGGGGGATGG - Intergenic
1187270029 X:17771688-17771710 AGGAAAACAGAGATGGGCAGAGG - Intergenic
1187506628 X:19883596-19883618 AGGCACCCACAGCTGGGCCAGGG + Intronic
1187819015 X:23265344-23265366 TGGAACAGAAAAATGGGCAAAGG - Intergenic
1188197503 X:27255547-27255569 AAGAAAACAAAGATGGACAAAGG - Intergenic
1189521785 X:41776616-41776638 AGGAACACAAAGTTAGTACAAGG + Intronic
1190334289 X:49253074-49253096 AGGAAGACAAAGATGGGGTGGGG - Intronic
1190446291 X:50528123-50528145 AGAAACACAGAGAAGGACCATGG - Intergenic
1192794560 X:74415969-74415991 AGGAATACATAGATTGGACAAGG - Intergenic
1195481978 X:105355580-105355602 AGCAACATAAAGATGATCCATGG - Intronic
1198180797 X:134206705-134206727 AGGATCACCAAGATGGCACAAGG - Intergenic
1198562983 X:137871422-137871444 GGGAACAAAGGGATGGGCCAGGG - Intergenic
1200212141 X:154351461-154351483 TGGAACCCAGAGCTGGGCCAGGG + Intronic