ID: 1179002702

View in Genome Browser
Species Human (GRCh38)
Location 21:37477935-37477957
Sequence CATTTCTACCACTTTAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179002697_1179002702 24 Left 1179002697 21:37477888-37477910 CCCTCGTGGGCAACATCCTGTGT 0: 1
1: 0
2: 0
3: 8
4: 181
Right 1179002702 21:37477935-37477957 CATTTCTACCACTTTAAATTTGG 0: 1
1: 0
2: 1
3: 40
4: 342
1179002698_1179002702 23 Left 1179002698 21:37477889-37477911 CCTCGTGGGCAACATCCTGTGTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1179002702 21:37477935-37477957 CATTTCTACCACTTTAAATTTGG 0: 1
1: 0
2: 1
3: 40
4: 342
1179002701_1179002702 -3 Left 1179002701 21:37477915-37477937 CCTAGATTGGCGTATGTCTGCAT 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1179002702 21:37477935-37477957 CATTTCTACCACTTTAAATTTGG 0: 1
1: 0
2: 1
3: 40
4: 342
1179002700_1179002702 8 Left 1179002700 21:37477904-37477926 CCTGTGTGTCTCCTAGATTGGCG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1179002702 21:37477935-37477957 CATTTCTACCACTTTAAATTTGG 0: 1
1: 0
2: 1
3: 40
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179002702 Original CRISPR CATTTCTACCACTTTAAATT TGG Intronic
901178598 1:7323428-7323450 CAATTTTACAATTTTAAATTGGG - Intronic
902173154 1:14629433-14629455 CATTTCAACCAGTTTAACGTGGG - Intronic
902765188 1:18609703-18609725 CGTTTCTGCCACTTTGAGTTTGG - Intergenic
903860660 1:26362613-26362635 CATTTCTGCCCCTGTAAAATGGG + Intronic
904385947 1:30142217-30142239 CATTTCTGCAGCTGTAAATTGGG + Intergenic
906315374 1:44783808-44783830 CATTTCTGGCACGTTAGATTTGG - Exonic
908057146 1:60299964-60299986 CATTTCTACCATCTTACTTTCGG - Intergenic
909077213 1:71064274-71064296 CTTTTCTACCATATTATATTTGG + Exonic
910306242 1:85767394-85767416 CATTTCTTACACTTTTCATTGGG - Intronic
911400543 1:97369240-97369262 CATGTAGACAACTTTAAATTTGG + Intronic
911597631 1:99814919-99814941 CATTTCTTCCTCTATAAAATGGG - Intergenic
912715864 1:111983142-111983164 CGTTATTACCAATTTAAATTGGG + Intronic
913350475 1:117852776-117852798 CATTTCTTCCTCTATAAAGTGGG + Intergenic
913406025 1:118491460-118491482 CATTTCTTCTAATTAAAATTGGG + Intergenic
915008092 1:152659135-152659157 CACTTCTAACACTTTTAACTTGG - Intergenic
915009374 1:152670994-152671016 CACTTCTAACACTTTTAACTTGG - Intergenic
915010629 1:152682726-152682748 CAGTTCTAACACTTTTAACTTGG - Intergenic
916432577 1:164745403-164745425 CATTTCTACCCTTATAAAATTGG + Intronic
917058385 1:171009255-171009277 CATTTGCATCAGTTTAAATTTGG - Intronic
918601052 1:186362279-186362301 CATATATACCTCTTTTAATTTGG + Exonic
919239013 1:194887756-194887778 CATTTTTATGACTTTGAATTAGG + Intergenic
920616123 1:207494614-207494636 CATTTCTTCCACTAGAATTTTGG + Intergenic
921153880 1:212423129-212423151 CATTGGGACCAATTTAAATTAGG + Intergenic
922184471 1:223261924-223261946 CATTTCTTCCTCTGTAAAATGGG - Intronic
923884009 1:238135275-238135297 CATTTCTTCAACTGTAAAATGGG + Intergenic
924693108 1:246370970-246370992 CATTTTTACAACTTTAAAGTTGG - Intronic
1065161135 10:22923645-22923667 TATTTCTCCTACTTTTAATTGGG - Intergenic
1065417749 10:25507214-25507236 CACTTCTTCCTCTTAAAATTAGG - Intronic
1065767358 10:29042780-29042802 TATTTCTGCTACTTTAAATGTGG - Intergenic
1067358359 10:45552464-45552486 CGTTTATATTACTTTAAATTTGG - Intronic
1067919757 10:50441748-50441770 ATTTTCTACTACTTTAAATTAGG - Intronic
1069129287 10:64679103-64679125 CATCTTTTCCCCTTTAAATTTGG + Intergenic
1069177311 10:65308886-65308908 CATTTCCACAACTTCCAATTGGG + Intergenic
1069194577 10:65533950-65533972 AATTTCTAATAATTTAAATTTGG - Intergenic
1069433217 10:68356044-68356066 CATTTCTTCATCTTTAAAATAGG - Intronic
1070260523 10:74850273-74850295 GATTTCCAGCATTTTAAATTTGG + Intronic
1071753400 10:88507923-88507945 TATTTCTGCCACCTTAAAATAGG + Intronic
1073989562 10:109246998-109247020 CATTTCTAAGCCTTTAAAATTGG - Intergenic
1074239680 10:111625181-111625203 AATTTATACCACTTTACATGTGG + Intergenic
1074663007 10:115684259-115684281 TATTTCTACAAATTTATATTGGG + Intronic
1074684423 10:115947226-115947248 CATTCCAGACACTTTAAATTTGG + Exonic
1075250441 10:120865716-120865738 CATTTTTACCACTTCAAATGAGG + Exonic
1076300550 10:129422777-129422799 CATTTCTCCTACTTTACAATTGG + Intergenic
1076933648 10:133552524-133552546 CATTTCTACCCCTTGATTTTTGG - Intronic
1077971935 11:7203128-7203150 CATTTCTAACACTGAAAATTTGG + Intergenic
1078253786 11:9639957-9639979 CATTTCTTCAACTGTAAAATGGG + Intergenic
1078367288 11:10717250-10717272 CATTTAGGCCACTTTGAATTGGG + Intergenic
1079365564 11:19806416-19806438 CATTTCTTCAACTTAAAATTTGG + Intronic
1079505175 11:21145282-21145304 CAATTCTACCACTTATAAGTTGG - Intronic
1079960706 11:26919880-26919902 CATTTCCAACACATAAAATTGGG - Intergenic
1081059681 11:38458623-38458645 AATTTACACTACTTTAAATTGGG - Intergenic
1081143241 11:39530472-39530494 CATTTCAACCTTCTTAAATTTGG + Intergenic
1081319775 11:41677262-41677284 CATTACTACCACTTTCAGATGGG - Intergenic
1081654578 11:44849010-44849032 CATTTCTTCATCTTTAAAATGGG + Intronic
1082019283 11:47518043-47518065 CATTCCTACCACTTAAAAAAAGG + Intronic
1086164064 11:83757320-83757342 TATTTCAAACAATTTAAATTGGG + Intronic
1086975958 11:93133094-93133116 CGTTTCTATCACTTCAAATGTGG - Intergenic
1087309616 11:96525630-96525652 GCTTTCTATCACTATAAATTAGG + Intergenic
1087884724 11:103465900-103465922 CTTTTCTACCCCTTGAACTTGGG - Intronic
1088091309 11:106043162-106043184 TATTGCTAACACTTTCAATTTGG - Intergenic
1088104512 11:106191029-106191051 CATTTAAACTCCTTTAAATTCGG + Intergenic
1090230133 11:125096490-125096512 CATTTTTTCTACTTTAAAGTGGG + Intergenic
1091982563 12:4878379-4878401 AATTTCCACAACTTCAAATTGGG - Intergenic
1092088185 12:5782953-5782975 CCAATCTACCACTTTAAATGGGG + Intronic
1093147556 12:15584934-15584956 ACTTTCTACTACTTGAAATTTGG + Intronic
1094145398 12:27223090-27223112 GATTTCTACCAATTTCATTTTGG - Intergenic
1095328615 12:40929312-40929334 CATTTCTAACTCTATAAAATAGG + Intronic
1096260526 12:50087386-50087408 CATTTCTAACACTTTCAATCCGG + Exonic
1096937088 12:55292740-55292762 CATTTCTCCCACTTTACATATGG + Intergenic
1098009966 12:66040470-66040492 CATTTCTAACTGTTTAAAATGGG + Intergenic
1098334154 12:69384689-69384711 TTTTCCTAACACTTTAAATTTGG - Intronic
1098584438 12:72139241-72139263 CAGTTCTGCCATTTAAAATTTGG - Intronic
1098946519 12:76595354-76595376 CATATCTACCTCTATGAATTTGG - Intergenic
1099195378 12:79609164-79609186 CTGTACTACCACTTTATATTAGG - Intronic
1099272227 12:80524750-80524772 CATTTCCACAACTATAAAATGGG - Intronic
1099448642 12:82781984-82782006 CAATTCTACCAGTTTAGCTTAGG - Intronic
1100352658 12:93799066-93799088 CATTTCTACCAGGGTAACTTTGG + Intronic
1100860101 12:98795868-98795890 CATTGCTCCCACTTTACATATGG - Intronic
1101020719 12:100550943-100550965 CATTTCTACATCTATAAAATAGG - Intronic
1102420659 12:112800527-112800549 CATTACTAACATTGTAAATTAGG - Intronic
1102584881 12:113915732-113915754 CATTTCTTCCACTGTAGAATGGG + Intronic
1102850683 12:116241400-116241422 ATTTTCTAACACTTTAAATAAGG - Intronic
1103178097 12:118882178-118882200 TTTTTCTCCCACTTTAAAATTGG + Intergenic
1107468215 13:40667426-40667448 CATTTCTAGCATTTTAAAAAAGG - Intergenic
1109332717 13:60949884-60949906 GATTTCTAACACATGAAATTTGG - Intergenic
1109587586 13:64427432-64427454 CATATCTACTATATTAAATTTGG + Intergenic
1109921499 13:69068265-69068287 CATTTCTACCCTTTTAACTCTGG + Intergenic
1110975419 13:81827368-81827390 CATTTCCAAAACTTTTAATTAGG - Intergenic
1110997804 13:82135986-82136008 CAATTCTAGCACATTAGATTTGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112372926 13:98810764-98810786 CATTTCTACCAATTGAAGTTTGG + Intronic
1114208656 14:20597489-20597511 CATTGCTTCCACTCTAAAATGGG + Intronic
1114289295 14:21274453-21274475 CATTTCTACATCTTTAAAATGGG - Intergenic
1114912432 14:27217977-27217999 CATTTCTTTCACTTTTAATAAGG + Intergenic
1116015205 14:39398218-39398240 CATTCGTACCACTTAAAACTGGG + Exonic
1116227280 14:42168391-42168413 CATTTCCACCACTATCAAGTTGG - Intergenic
1116882587 14:50186423-50186445 CTTTTCTACCACGTTATAATTGG - Intronic
1117061443 14:51967616-51967638 CATTTATACCACTATTAACTAGG - Exonic
1117908725 14:60616015-60616037 CATATCTATGATTTTAAATTTGG - Intergenic
1118873144 14:69760095-69760117 CATTTCTAACACATTAATTTTGG - Intronic
1120159977 14:81135506-81135528 CATTGCTACCACCTTAGTTTAGG - Intronic
1120496070 14:85237523-85237545 CATTTCTAACACCCTAATTTGGG + Intergenic
1121661628 14:95639560-95639582 CATGTCTCCCACTTGAAATGGGG - Intergenic
1128102585 15:65015401-65015423 AATTTCTTCAACTTTAAAGTGGG + Intronic
1128485694 15:68085317-68085339 ATTTTCCACCACTTTAAAATGGG + Intronic
1131884447 15:96896902-96896924 TATTTCTACCACTTAAAAAAGGG + Intergenic
1134805007 16:17116874-17116896 CATTTCTCCCATTTTTAATGAGG + Intronic
1138241191 16:55428406-55428428 CCTTTCTACCACTTCAAAGAGGG + Intronic
1139882536 16:70187284-70187306 CATTTCTTCCGCTGTAAACTGGG - Intronic
1140369973 16:74408220-74408242 CATTTCTTCCGCTGTAAACTGGG + Intergenic
1140692437 16:77497318-77497340 CATTTCTATCACTTTGTATAGGG + Intergenic
1140960623 16:79908806-79908828 CATTTCTAACACCTTAGATCAGG - Intergenic
1141359171 16:83378696-83378718 AGTTTCTTCCTCTTTAAATTGGG + Intronic
1142991055 17:3731183-3731205 CATTTTTCCCCCTTTAAAATAGG - Exonic
1143794167 17:9322851-9322873 CATTTCTTCAACTTCAAATGAGG - Intronic
1144079016 17:11745218-11745240 CATTTCAACCACTCTTAACTGGG + Intronic
1144451486 17:15383520-15383542 CATTACAACCACTTTAAAAATGG + Intergenic
1145339858 17:21944792-21944814 CCTTTCTAGCCCTTTACATTTGG - Intergenic
1145893145 17:28433051-28433073 TATATATACCACTTTAAATTGGG - Intergenic
1146449784 17:32963902-32963924 CATTTCTTCAACTGTAAAATGGG - Intergenic
1147629803 17:41922681-41922703 TATTTCTAGCAGTTTAAATAGGG + Intronic
1148961765 17:51399188-51399210 CATTTCTCCCACTTTGGAGTAGG + Intergenic
1149027315 17:52042416-52042438 CATTTGCACAATTTTAAATTAGG + Intronic
1151234738 17:72711540-72711562 TATTTATACCATTATAAATTTGG + Intronic
1152011060 17:77717346-77717368 CATTTCTAGCAGTTTTATTTGGG + Intergenic
1153336241 18:3928633-3928655 AATTTCTGCCTCTATAAATTGGG - Intronic
1153592440 18:6687676-6687698 GATTTCTATCACTTCAAATTTGG - Intergenic
1156834435 18:41535628-41535650 CATTTGGACCAGATTAAATTAGG - Intergenic
1157689707 18:49671291-49671313 CACTTATACCACTGTAAGTTTGG - Intergenic
1158275024 18:55757807-55757829 AGTTTCTAACACTTGAAATTTGG + Intergenic
1158491538 18:57914224-57914246 TTTTTCTGCCATTTTAAATTGGG + Intergenic
1158772852 18:60542789-60542811 GGTTTCTTCAACTTTAAATTGGG - Intergenic
1160149145 18:76386049-76386071 CATTTCTGCCCCTCTATATTGGG + Intronic
1165831400 19:38732307-38732329 CATTTCTCCCCCTTTGACTTGGG + Intronic
1166775030 19:45307311-45307333 CATTTCTTCCTCTGTAAAATGGG - Intronic
924996172 2:364023-364045 CATCTCTAACACTTTAAGTCAGG - Intergenic
925597344 2:5568785-5568807 CATTTATCCCACTTTAAGTATGG - Intergenic
926640725 2:15233318-15233340 CAATTCTACCACTAAAGATTTGG - Intronic
926760339 2:16273097-16273119 CATTTCTAGCTCTGTGAATTTGG - Intergenic
929262027 2:39876457-39876479 CATATCTGCCACTCTAAATCAGG - Intergenic
931826844 2:66009234-66009256 TATTTCTACCTCATTAACTTTGG - Intergenic
932465347 2:71919608-71919630 CATTTGTACATTTTTAAATTGGG - Intergenic
932541738 2:72662478-72662500 CATTTTTCCCACTTTTAAATTGG - Intronic
933041967 2:77480414-77480436 CATTGCTAACACATTAAAATCGG - Intronic
933572253 2:84027311-84027333 CATTTCTAGCACTTCAGATAGGG + Intergenic
933686614 2:85146811-85146833 CATTTCTATCCCTTTCACTTAGG + Intronic
934068339 2:88360693-88360715 CATTTCCACCTCTTTATAGTTGG - Intergenic
936702947 2:115035671-115035693 AATTCCTACCAATTTATATTTGG - Intronic
936707814 2:115096695-115096717 CTTTTGTACCATTTTAAAGTTGG + Intronic
936827343 2:116598448-116598470 AAATTCTAACACTTTAAGTTTGG - Intergenic
937595225 2:123664147-123664169 TATTTATTCCACTTAAAATTAGG + Intergenic
938638636 2:133256018-133256040 CATTCCTTCCACTTTGAAATAGG - Intronic
938661168 2:133488661-133488683 CATCTCTACCAAATTAAATTTGG + Intronic
938700255 2:133871598-133871620 CATTTCTACCACAATATATGGGG + Intergenic
938858186 2:135337997-135338019 CATTTCTTATACTTTAGATTTGG - Intronic
939012145 2:136859282-136859304 CATTTCAGACACTTTAAAATTGG - Intronic
939040515 2:137183839-137183861 CATTTCTAACATTTTACTTTGGG + Intronic
939645328 2:144690472-144690494 AATTTCTTCATCTTTAAATTGGG + Intergenic
939665441 2:144945729-144945751 CATTTCTGCTACTTTGAATGGGG - Intergenic
940016756 2:149114526-149114548 CATTTCCAACAGTTTTAATTTGG - Intronic
941517720 2:166500323-166500345 CATTTCTACCACTTTGTGTTTGG + Intergenic
941948317 2:171124846-171124868 CTTTTCTGCCACTTCAAACTTGG + Intronic
942613611 2:177766773-177766795 CATTTTAACCATTTTAAAATGGG - Intronic
942884850 2:180910833-180910855 CATTTCTAGCACTTTTAATTTGG - Intergenic
943539482 2:189194619-189194641 CATTTATAACATTTTAAATTAGG - Intergenic
944358072 2:198817223-198817245 CATTTATAACACTTTGAATAAGG - Intergenic
944566269 2:200994549-200994571 CATTTCTACCTATTTAAGATAGG + Intronic
944629373 2:201607905-201607927 CAACTCTACCACCTTAATTTTGG + Intronic
945263286 2:207864725-207864747 CATTGCTAACAGTGTAAATTTGG - Intronic
945567410 2:211418183-211418205 AATTACTACCATTTTAAGTTTGG - Intronic
945586669 2:211673568-211673590 CATTTTTACCTTTTTAAATAGGG + Intronic
945827822 2:214746083-214746105 CATTTCTTCAATTTTAAATTGGG + Intronic
946850785 2:223904554-223904576 CTTTTCTCCTATTTTAAATTTGG + Intronic
1168975261 20:1961101-1961123 AATTTCTGCCTCTTTAATTTGGG - Intergenic
1169350380 20:4863634-4863656 CCTTTCTAACACATGAAATTGGG + Intronic
1170008413 20:11694067-11694089 GATTTCTAACCCATTAAATTAGG + Intergenic
1170128682 20:12994642-12994664 CATTTATTCAACTGTAAATTGGG - Intergenic
1172318081 20:33972005-33972027 CATTTCTTCAACTGTAAATTGGG - Intergenic
1173882946 20:46432579-46432601 CATTTCTTCCATTTTAACTCAGG - Intronic
1173947091 20:46960255-46960277 CATTTCCTCCACTGTAAAATGGG - Intronic
1175342520 20:58242854-58242876 CACTTGGACCACTTTAAGTTGGG - Intergenic
1176677797 21:9796430-9796452 CATTTCTAGCACTTTTAATCAGG - Intergenic
1177228567 21:18289092-18289114 CATAATTACCACTTAAAATTTGG - Intronic
1178675164 21:34625153-34625175 CATATCTTGCACTTTAAACTAGG - Intergenic
1178745984 21:35250757-35250779 CCTTTCTACCCCTTTCAATGTGG + Intronic
1179002702 21:37477935-37477957 CATTTCTACCACTTTAAATTTGG + Intronic
1179029425 21:37707443-37707465 CATTTCTTCAACTCTAAAATGGG - Intronic
1179709095 21:43202191-43202213 CATTTCTAACATTTTAAAATTGG + Intergenic
1181966256 22:26658352-26658374 CATTTCTTCATCTTTAAAATGGG - Intergenic
1182640926 22:31766990-31767012 AGTTTCTACCTCTATAAATTAGG - Intronic
1182956659 22:34433185-34433207 CCTTTCCACCACTTTTAAGTGGG - Intergenic
1184115569 22:42419924-42419946 CATGTCTACCACTGCAATTTGGG - Intronic
1184884463 22:47333924-47333946 CATTTCTACCACATTCTGTTTGG + Intergenic
1184999505 22:48236237-48236259 AATCTCTATCACTTTAAATATGG - Intergenic
949403519 3:3690369-3690391 TATTTTTACCTTTTTAAATTTGG + Intergenic
949625337 3:5860148-5860170 CAGTTTTGCCACTTTAAAATTGG + Intergenic
951054825 3:18135553-18135575 CATTTCCTCCACTGTAAAATGGG + Intronic
951273973 3:20662588-20662610 CATTTTTACAACTTTATAGTAGG - Intergenic
951477118 3:23118572-23118594 CAAATCTATCACTTTAATTTTGG - Intergenic
952559844 3:34578804-34578826 CATTTCTTCCACTATAAAATGGG - Intergenic
952637630 3:35551056-35551078 CATTTCTCACACTTAAAATTTGG - Intergenic
953580992 3:44156519-44156541 CATTTCTCCCCCTTTTAAGTAGG - Intergenic
954048874 3:47956408-47956430 CAGTCCTACCTCTTTAAATGGGG - Intronic
954757896 3:52851930-52851952 CAGTTCCACCACTGTAAAATGGG + Intronic
955461914 3:59192559-59192581 CAACTCTACCACATTTAATTTGG - Intergenic
956527305 3:70179114-70179136 CATTTCCACATCTTTAAAATGGG - Intergenic
957249460 3:77754640-77754662 GCTCTCTACCACTTTAAGTTAGG - Intergenic
959385702 3:105702701-105702723 CATTTCTATAACTTAACATTTGG - Intronic
960694800 3:120385666-120385688 CATTTCTGACACATGAAATTTGG + Intergenic
963674875 3:148297588-148297610 CATTTCTATGATTTTAATTTGGG - Intergenic
963789734 3:149571836-149571858 CTTTTCTAAAACTTTAAAATTGG + Intronic
964193092 3:154028927-154028949 CATTTGTATCAGTTTATATTAGG + Intergenic
964492084 3:157247761-157247783 CCTTTCTACCCCTTCAAATTAGG + Intergenic
965794517 3:172425955-172425977 CCTTTATACCACTTCAAAATGGG + Intergenic
965929198 3:174021966-174021988 GATTTCTGCCCCTTTAACTTGGG - Intronic
966282225 3:178245251-178245273 CATTGTTACCACTTTAAAAGGGG - Intergenic
968856010 4:3122618-3122640 GATTTCTAATACTTTTAATTTGG + Intronic
969163650 4:5284141-5284163 CATTTTTATCATCTTAAATTAGG + Intronic
970993788 4:22242155-22242177 AATTTCTAACACTGTCAATTAGG - Intergenic
971190685 4:24426299-24426321 TTTTTCTTCCCCTTTAAATTAGG - Intergenic
971589415 4:28447931-28447953 CATTTCTTCATCTGTAAATTTGG + Intergenic
975774801 4:77774354-77774376 CATTTCTTTTCCTTTAAATTTGG - Intronic
975810684 4:78165896-78165918 CATTTCTACCACATTCTGTTTGG + Intronic
976308745 4:83588592-83588614 CATTTCTTCCCCTATAAAATGGG - Intronic
977369845 4:96121653-96121675 CATTTCCACTACTTTTATTTAGG - Intergenic
977434811 4:96980511-96980533 TATTTCTACCACTTACAATTAGG - Intergenic
978836679 4:113158796-113158818 CATTTCAACTAAGTTAAATTTGG + Intronic
979092706 4:116505759-116505781 CATTTCTAGAAGTTTAAGTTTGG - Intergenic
980203021 4:129679748-129679770 CAGTTCTGCCACTTAAAAGTTGG - Intergenic
980860655 4:138496018-138496040 AATCTCTACCACTGTAGATTTGG - Intergenic
981365685 4:143899873-143899895 AATTTTTATGACTTTAAATTTGG + Intronic
981375692 4:144012874-144012896 AATTTTTATGACTTTAAATTTGG + Intronic
981386307 4:144135062-144135084 AATTTTTATGACTTTAAATTTGG + Intronic
981544607 4:145881393-145881415 CATTTCAACTATTTTTAATTTGG - Intronic
981825121 4:148931553-148931575 CATTTCTTCTAGTTTAAATCAGG + Intergenic
981888939 4:149713906-149713928 CATTTCTCCCATCTTAAATAAGG + Intergenic
982318573 4:154057071-154057093 CATCTCTCCAATTTTAAATTGGG + Intergenic
982446284 4:155494431-155494453 AATTTTTTCCACTTTAAACTGGG - Intergenic
982489419 4:156010664-156010686 GATCTCTACCATTTTAAAATGGG - Intergenic
983343755 4:166500968-166500990 CATTTCTACCCCTTAATATTAGG - Intergenic
983393636 4:167165837-167165859 CATATCTATCAATTTACATTTGG - Intronic
983854130 4:172620730-172620752 CATTTCTGCCTCTTTAATTGAGG + Intronic
984628748 4:182038443-182038465 AATTACTGCCACTTTAAAATGGG - Intergenic
984950042 4:185001395-185001417 CAATTGTAGCACTTTAAATTAGG - Intergenic
985037558 4:185856624-185856646 AATTTCCACCACATTAAATTTGG - Intronic
985375617 4:189334291-189334313 CAATACTGCCACATTAAATTAGG + Intergenic
985397729 4:189562363-189562385 CATTTCTAGCACTTTTAATCAGG + Intergenic
985480099 5:104525-104547 TTTTAATACCACTTTAAATTGGG - Intergenic
985910716 5:2878567-2878589 CATTTCCAGCACCTTGAATTGGG + Intergenic
986600703 5:9469726-9469748 CATTTCTGCCATTTATAATTTGG - Intronic
986897575 5:12388495-12388517 CATTTCTAGAACTTTATATAAGG - Intergenic
987428071 5:17795997-17796019 TATTTTTAACAATTTAAATTTGG - Intergenic
987641660 5:20619893-20619915 CATCTCTACCACTGTCAAATGGG + Intergenic
987734448 5:21822509-21822531 CATTTCTATTACTTTAATTTGGG - Intronic
987798267 5:22658297-22658319 CAATTCTACACCTGTAAATTAGG + Intronic
988034139 5:25803775-25803797 CATTTCTTCCATTTGAAATGGGG - Intergenic
991317434 5:65325091-65325113 CCTTTTTACCACTATAGATTAGG - Intronic
991559822 5:67938710-67938732 CATTTTTAACACTTAAAATGTGG - Intergenic
992998468 5:82355904-82355926 CATTTTTAACTATTTAAATTGGG + Intronic
994272601 5:97798746-97798768 TTATTCTACCATTTTAAATTTGG + Intergenic
994869419 5:105327230-105327252 CATTTGAGACACTTTAAATTGGG + Intergenic
995114142 5:108459962-108459984 CATTTCTTTCATTTTTAATTAGG - Intergenic
995412345 5:111872950-111872972 CATTTCAGCCATTTTAACTTGGG + Intronic
995644624 5:114297486-114297508 CATCTCTCCTACTTTACATTAGG + Intergenic
996373041 5:122773659-122773681 TATTTCTACCGCTAAAAATTAGG - Intergenic
996915848 5:128711602-128711624 CTTTCCTACCATTTTACATTTGG + Intronic
997907875 5:137837757-137837779 CATTTCCACATCTTTACATTTGG + Intergenic
998199154 5:140105592-140105614 AATTGCTACCATTTTACATTTGG + Intergenic
999491293 5:152053971-152053993 CATCTATACCAAGTTAAATTTGG - Intergenic
999890909 5:155977791-155977813 CATTCTGACCACTTTAAATGAGG - Intronic
1000180767 5:158808588-158808610 AGTTTCTACCACTTTAATTGAGG + Intronic
1000699581 5:164431969-164431991 CATTTTTTCCAGTTTAAATCTGG - Intergenic
1002821184 6:726448-726470 TATATCTACCACTTAAAATGTGG - Intergenic
1004271482 6:14199991-14200013 CATTTCCAACTCTTTAAAGTTGG + Intergenic
1004590807 6:17050003-17050025 CATAGCTGTCACTTTAAATTTGG - Intergenic
1005591767 6:27336100-27336122 CATTGCTACCTCTTTAATTGTGG + Intergenic
1008718901 6:54324471-54324493 CAATTCTACCACTTTCTATTGGG + Intronic
1008824324 6:55674288-55674310 CATTTATTCTACTTTAAATTAGG - Intergenic
1009747609 6:67838934-67838956 GATTCCTAGCACATTAAATTTGG + Intergenic
1011604356 6:89087698-89087720 CTTTTCTACAATTTGAAATTGGG + Intergenic
1011638605 6:89399077-89399099 CATATCTAGCAGTATAAATTGGG - Intronic
1011801108 6:91017344-91017366 CATTTCCAACACTTAAACTTTGG + Intergenic
1012098371 6:94995322-94995344 AATTCCTACCATTTTAAATTGGG - Intergenic
1012384556 6:98664176-98664198 CATTTCTAGAAATTTAAATTAGG + Intergenic
1012761913 6:103313518-103313540 CATTTGTAAAACTTAAAATTAGG - Intergenic
1012880731 6:104785442-104785464 CATTACTATCACGTTAACTTGGG - Intronic
1013651239 6:112197006-112197028 CATTTCTTCCTCTGTAAATAAGG + Intronic
1013724832 6:113081660-113081682 AATTTCTACAACTTCAAACTTGG - Intergenic
1013849115 6:114492802-114492824 CATTTCTTCTACTTAAATTTAGG - Intergenic
1013936904 6:115607129-115607151 CAGTTCTACCACATGACATTTGG + Intergenic
1018351867 6:162968526-162968548 CATTCCTACTGCTTTAAGTTTGG - Intronic
1020579962 7:9984714-9984736 CTTTTTTCCCATTTTAAATTGGG + Intergenic
1020711402 7:11609934-11609956 CATCTCTACATCTCTAAATTAGG + Intronic
1021404658 7:20250935-20250957 CTTTTCTGACAGTTTAAATTAGG - Intergenic
1021437112 7:20631257-20631279 CATTTCTGCCACATGAATTTTGG + Intronic
1021875864 7:25048566-25048588 CATTTCTTCCTCTGTAAAATGGG - Intergenic
1022147136 7:27555655-27555677 CATTTATATCACTGTAAATTTGG - Intronic
1022155423 7:27657053-27657075 CATTTCCAGAACTTTAACTTAGG - Intronic
1022375728 7:29809206-29809228 CGTTTCTACCTCTTTAAGTTCGG - Intronic
1024850611 7:53711916-53711938 AATTTCCAACACTTGAAATTTGG - Intergenic
1024868229 7:53929324-53929346 CATTTCTCCAACTTTATCTTAGG - Intergenic
1027126594 7:75560749-75560771 CATTTCTACCAGTTTTTATTTGG + Intronic
1028695941 7:93712264-93712286 CATTTCTAAGATTTTAAATATGG + Intronic
1028979094 7:96947059-96947081 CATTTCTGCATCCTTAAATTAGG + Intergenic
1029839978 7:103351929-103351951 CATTGCTACCATTTTTATTTAGG + Intronic
1029865260 7:103620786-103620808 CATTTATACCACTTCTCATTAGG + Intronic
1030653556 7:112141681-112141703 CACTACGACCTCTTTAAATTAGG + Intronic
1030802711 7:113872238-113872260 CATTTCTACTCTTTGAAATTTGG - Intergenic
1031370112 7:120954814-120954836 TATAACTCCCACTTTAAATTAGG - Intronic
1031653746 7:124325259-124325281 CATTGCCACCACTTTAGTTTAGG - Intergenic
1031721664 7:125184255-125184277 CATCTATACTACTTTAAAGTTGG + Intergenic
1031943355 7:127813198-127813220 CATTACTACCACTTCCAAGTGGG - Intronic
1032227977 7:130049144-130049166 CAGTTTTGCCACTTTATATTAGG - Exonic
1032484289 7:132272258-132272280 CATTTCTACAGCCTTAAATCAGG + Intronic
1032876336 7:136042121-136042143 CTTTTTTATCACTTTAACTTCGG + Intergenic
1033802433 7:144916920-144916942 TATTTCTACCAGTTTTAAATAGG - Intergenic
1034001668 7:147420141-147420163 CATTTCTAACAGTATACATTTGG - Intronic
1034707797 7:153161945-153161967 AGTTTCTAACACATTAAATTTGG + Intergenic
1035123016 7:156584576-156584598 GACTTATACCCCTTTAAATTTGG - Intergenic
1035948619 8:3993723-3993745 CATTTCTTCCGCTTTGGATTAGG - Intronic
1036180857 8:6583916-6583938 CATTTTTACTACTTTCAAGTGGG + Intronic
1038135138 8:24777300-24777322 CAGTAATACCTCTTTAAATTTGG + Intergenic
1038365349 8:26926452-26926474 CATTTTTATCACTTTATATAGGG - Intergenic
1038585723 8:28787342-28787364 TATTACTACCTTTTTAAATTGGG - Intronic
1038762679 8:30399174-30399196 CTTTTCTAGCATTTTAAATTTGG - Intronic
1039263402 8:35797731-35797753 CTTTCTGACCACTTTAAATTAGG + Intergenic
1041716239 8:60934904-60934926 CACTGCTACCCCTTTAAATCTGG + Intergenic
1042485939 8:69345718-69345740 CATCTCTACCACTTTCATTTTGG - Intergenic
1042586321 8:70343397-70343419 TATTTATAGCACTTTAAAATGGG + Intronic
1043247118 8:78018104-78018126 GATTTCTACTACAATAAATTTGG + Intergenic
1043553967 8:81408251-81408273 CTTTGCTACCACTCTAAATGTGG + Intergenic
1045014961 8:97993143-97993165 CATTTCCATAAGTTTAAATTGGG + Intronic
1045471815 8:102519352-102519374 CATTTCTACCACCTTCTATGAGG - Intergenic
1045826552 8:106404548-106404570 CATTTCTACCACATAAAAACTGG + Intronic
1046091196 8:109504382-109504404 CATTACTAACCCTTTAAATGAGG + Exonic
1046354148 8:113056981-113057003 CATTTCTTAATCTTTAAATTTGG + Intronic
1046410540 8:113836260-113836282 CTTTTCAAATACTTTAAATTTGG - Intergenic
1047876753 8:129146958-129146980 GATGTCAACTACTTTAAATTGGG - Intergenic
1048089243 8:131220801-131220823 CATTTCCTCAACTTTAAAATAGG - Intergenic
1048732734 8:137461713-137461735 CATGTCTACCATTTTTAACTTGG - Intergenic
1048926934 8:139279864-139279886 CATTTCTTCCTCTGTAAAATGGG + Intergenic
1050068913 9:1790111-1790133 CCTTTGCACCACTTTAATTTTGG - Intergenic
1050352272 9:4751552-4751574 CATTTCCAACACATGAAATTAGG + Intergenic
1050456662 9:5840934-5840956 CCTTTCATCAACTTTAAATTAGG - Intergenic
1050809367 9:9724765-9724787 CATTTCCTCCACTGTAAATGGGG - Intronic
1050825334 9:9938285-9938307 CTGTTCTACAACTTGAAATTAGG + Intronic
1051575470 9:18610486-18610508 CATTTCTATCTGTCTAAATTGGG - Intronic
1055182572 9:73405954-73405976 CATTTCTAATTTTTTAAATTTGG - Intergenic
1056121882 9:83496704-83496726 CATGTTTGCCACTTTAAATCTGG + Intronic
1056217919 9:84422477-84422499 CATTTCTTCCACTTTCAAGCTGG - Intergenic
1057325987 9:94064284-94064306 GACTTCTACCCCTTTAAAATAGG + Intronic
1058764400 9:108167313-108167335 CATTCCTTCCACTTTAACCTTGG - Intergenic
1059861354 9:118466726-118466748 AATTTCTAGCACCTTAATTTTGG - Intergenic
1185921479 X:4097677-4097699 CTTTTCAACCTCTTTGAATTGGG + Intergenic
1186022297 X:5269820-5269842 CATTTCTACTACATTAAAATGGG + Intergenic
1186421564 X:9431000-9431022 ATTTTCTAACATTTTAAATTAGG + Intergenic
1186636283 X:11408651-11408673 AATTTCTACAACTCTCAATTTGG - Intronic
1186735585 X:12460089-12460111 TATTTTTACCATTTAAAATTGGG + Intronic
1188122870 X:26331812-26331834 AGTTTCTAACACTTAAAATTTGG - Intergenic
1188143619 X:26583205-26583227 CATTTTAACCACTTAAATTTAGG - Intergenic
1188654662 X:32677543-32677565 TCTTTCTACCTCTTAAAATTTGG + Intronic
1189015261 X:37090413-37090435 CTTTTCTAGCATTTTAAATTTGG - Intergenic
1189165259 X:38854803-38854825 AAATTTTACCACTTTAAATCAGG + Intergenic
1190441349 X:50477603-50477625 CATATCTACCTCTTTATTTTTGG + Intergenic
1191961591 X:66708718-66708740 CATATGTACCTCTATAAATTTGG + Intergenic
1193783958 X:85735908-85735930 CATTCCTAATACATTAAATTTGG - Intergenic
1194004321 X:88471539-88471561 AATTTGTACCACTTCAAATGTGG + Intergenic
1194177735 X:90672391-90672413 GATTTCTATGATTTTAAATTTGG - Intergenic
1194307625 X:92268018-92268040 CATTTCTAACACATAAAATTTGG + Intronic
1195288325 X:103407005-103407027 CATTTCTGTCACTGTAGATTTGG + Intergenic
1195811143 X:108831527-108831549 CATTTCTAGGGCATTAAATTTGG + Intergenic
1195907475 X:109859374-109859396 CTTTTGTAGCAATTTAAATTGGG + Intergenic
1195953462 X:110303254-110303276 CATTTTTTTCACTTTAAAATGGG + Intronic
1196794976 X:119495039-119495061 CATTTCTTCCACCGTAAAATGGG + Intergenic
1197091541 X:122544456-122544478 GTTTTCTTCCACTTTATATTTGG - Intergenic
1197444514 X:126533841-126533863 CATTTATATCAGTTCAAATTTGG - Intergenic
1197616874 X:128702360-128702382 CATTTATAAGACTTTAAAATTGG + Intergenic
1198973750 X:142311406-142311428 CATTTCTGGCACTATAATTTTGG + Intergenic
1199408938 X:147496681-147496703 AATTTCTAACACATGAAATTTGG - Intergenic
1200293419 X:154893488-154893510 CATTTCTCCCATTAAAAATTAGG + Intronic
1200524405 Y:4254540-4254562 GATTTCTATGATTTTAAATTTGG - Intergenic
1201618865 Y:15932481-15932503 AATTTCTAAGACCTTAAATTGGG - Intergenic
1202194191 Y:22279493-22279515 CATTATTACCATTTTACATTTGG + Intergenic
1202603946 Y:26622867-26622889 CAATTCTTCAGCTTTAAATTGGG - Intergenic