ID: 1179010414

View in Genome Browser
Species Human (GRCh38)
Location 21:37552028-37552050
Sequence CTGAACATACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179010410_1179010414 5 Left 1179010410 21:37552000-37552022 CCACCAAGTGGGCATTTGCACTG No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data
1179010407_1179010414 14 Left 1179010407 21:37551991-37552013 CCCTGAGGCCCACCAAGTGGGCA No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data
1179010408_1179010414 13 Left 1179010408 21:37551992-37552014 CCTGAGGCCCACCAAGTGGGCAT No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data
1179010403_1179010414 24 Left 1179010403 21:37551981-37552003 CCCAGCAGCACCCTGAGGCCCAC No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data
1179010400_1179010414 29 Left 1179010400 21:37551976-37551998 CCAGCCCCAGCAGCACCCTGAGG No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data
1179010411_1179010414 2 Left 1179010411 21:37552003-37552025 CCAAGTGGGCATTTGCACTGAGA No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data
1179010402_1179010414 25 Left 1179010402 21:37551980-37552002 CCCCAGCAGCACCCTGAGGCCCA No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data
1179010404_1179010414 23 Left 1179010404 21:37551982-37552004 CCAGCAGCACCCTGAGGCCCACC No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data
1179010409_1179010414 6 Left 1179010409 21:37551999-37552021 CCCACCAAGTGGGCATTTGCACT No data
Right 1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179010414 Original CRISPR CTGAACATACAAATGGACAA TGG Intergenic
No off target data available for this crispr