ID: 1179013452

View in Genome Browser
Species Human (GRCh38)
Location 21:37574443-37574465
Sequence CCATGCAAGCAGCCCTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179013447_1179013452 13 Left 1179013447 21:37574407-37574429 CCGAAGCTGGGATCTTGGGGTAG No data
Right 1179013452 21:37574443-37574465 CCATGCAAGCAGCCCTGGCAAGG No data
1179013441_1179013452 29 Left 1179013441 21:37574391-37574413 CCTTTCTTTCATGTAACCGAAGC No data
Right 1179013452 21:37574443-37574465 CCATGCAAGCAGCCCTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179013452 Original CRISPR CCATGCAAGCAGCCCTGGCA AGG Intergenic
No off target data available for this crispr