ID: 1179013538

View in Genome Browser
Species Human (GRCh38)
Location 21:37574946-37574968
Sequence ACCAGAGCGCTAAGGGTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179013531_1179013538 12 Left 1179013531 21:37574911-37574933 CCGGGTGCTGCTGGCTCAAGGAC No data
Right 1179013538 21:37574946-37574968 ACCAGAGCGCTAAGGGTCCTCGG No data
1179013530_1179013538 13 Left 1179013530 21:37574910-37574932 CCCGGGTGCTGCTGGCTCAAGGA No data
Right 1179013538 21:37574946-37574968 ACCAGAGCGCTAAGGGTCCTCGG No data
1179013533_1179013538 -10 Left 1179013533 21:37574933-37574955 CCCCACTTGGAGAACCAGAGCGC No data
Right 1179013538 21:37574946-37574968 ACCAGAGCGCTAAGGGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179013538 Original CRISPR ACCAGAGCGCTAAGGGTCCT CGG Intergenic
No off target data available for this crispr