ID: 1179014822

View in Genome Browser
Species Human (GRCh38)
Location 21:37587485-37587507
Sequence CCTGCCTTGCAGGTTGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179014816_1179014822 -5 Left 1179014816 21:37587467-37587489 CCCACAGGGATCATCTTGCCTGC No data
Right 1179014822 21:37587485-37587507 CCTGCCTTGCAGGTTGGGTATGG No data
1179014817_1179014822 -6 Left 1179014817 21:37587468-37587490 CCACAGGGATCATCTTGCCTGCC No data
Right 1179014822 21:37587485-37587507 CCTGCCTTGCAGGTTGGGTATGG No data
1179014815_1179014822 -2 Left 1179014815 21:37587464-37587486 CCTCCCACAGGGATCATCTTGCC No data
Right 1179014822 21:37587485-37587507 CCTGCCTTGCAGGTTGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179014822 Original CRISPR CCTGCCTTGCAGGTTGGGTA TGG Intergenic
No off target data available for this crispr