ID: 1179015653

View in Genome Browser
Species Human (GRCh38)
Location 21:37592707-37592729
Sequence GGTCGGGACCAGGACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179015653_1179015671 30 Left 1179015653 21:37592707-37592729 CCCTGAGAGTCCTGGTCCCGACC No data
Right 1179015671 21:37592760-37592782 CCTCATGACCCCTAATCTTTGGG No data
1179015653_1179015669 29 Left 1179015653 21:37592707-37592729 CCCTGAGAGTCCTGGTCCCGACC No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179015653 Original CRISPR GGTCGGGACCAGGACTCTCA GGG (reversed) Intergenic
No off target data available for this crispr