ID: 1179015669

View in Genome Browser
Species Human (GRCh38)
Location 21:37592759-37592781
Sequence CCCTCATGACCCCTAATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179015654_1179015669 28 Left 1179015654 21:37592708-37592730 CCTGAGAGTCCTGGTCCCGACCT No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015657_1179015669 13 Left 1179015657 21:37592723-37592745 CCCGACCTGGTGAGCCCTGCTCC No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015660_1179015669 -1 Left 1179015660 21:37592737-37592759 CCCTGCTCCCGCCCCAGATGACC No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015661_1179015669 -2 Left 1179015661 21:37592738-37592760 CCTGCTCCCGCCCCAGATGACCC No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015653_1179015669 29 Left 1179015653 21:37592707-37592729 CCCTGAGAGTCCTGGTCCCGACC No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015656_1179015669 19 Left 1179015656 21:37592717-37592739 CCTGGTCCCGACCTGGTGAGCCC No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015662_1179015669 -8 Left 1179015662 21:37592744-37592766 CCCGCCCCAGATGACCCCTCATG No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015659_1179015669 8 Left 1179015659 21:37592728-37592750 CCTGGTGAGCCCTGCTCCCGCCC No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015658_1179015669 12 Left 1179015658 21:37592724-37592746 CCGACCTGGTGAGCCCTGCTCCC No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data
1179015663_1179015669 -9 Left 1179015663 21:37592745-37592767 CCGCCCCAGATGACCCCTCATGA No data
Right 1179015669 21:37592759-37592781 CCCTCATGACCCCTAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179015669 Original CRISPR CCCTCATGACCCCTAATCTT TGG Intergenic
No off target data available for this crispr