ID: 1179020029

View in Genome Browser
Species Human (GRCh38)
Location 21:37631557-37631579
Sequence GTTCACAATAGCAGGACGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179020025_1179020029 22 Left 1179020025 21:37631512-37631534 CCTCTGGACAATGTACAAAATGA 0: 1
1: 0
2: 1
3: 25
4: 257
Right 1179020029 21:37631557-37631579 GTTCACAATAGCAGGACGATTGG 0: 1
1: 0
2: 0
3: 5
4: 61
1179020026_1179020029 -3 Left 1179020026 21:37631537-37631559 CCACCTGAAGACTCTAGAAAGTT 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1179020029 21:37631557-37631579 GTTCACAATAGCAGGACGATTGG 0: 1
1: 0
2: 0
3: 5
4: 61
1179020027_1179020029 -6 Left 1179020027 21:37631540-37631562 CCTGAAGACTCTAGAAAGTTCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1179020029 21:37631557-37631579 GTTCACAATAGCAGGACGATTGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179020029 Original CRISPR GTTCACAATAGCAGGACGAT TGG Intronic
900011182 1:110514-110536 GTTCACAATAGCAAAAGTATGGG + Intergenic
900027286 1:287078-287100 GTTCACAATAGCAAAAGTATGGG + Intergenic
906908823 1:49924819-49924841 GTTCCCATGAGGAGGACGATTGG - Intronic
908939276 1:69411547-69411569 TTTCAAAATAGCTGGAAGATAGG - Intergenic
914772438 1:150700880-150700902 ATTCACAATAGCCGAAAGATGGG - Intronic
917656709 1:177133627-177133649 CTTTACATTAGCAGGACTATAGG - Intronic
920452989 1:206074269-206074291 GTTCCCAATAGCATGAGGATGGG + Intronic
922259625 1:223926516-223926538 GTTCACAATAGCAAAAGTATAGG + Intergenic
924134876 1:240954986-240955008 ATTCACAATAGCAGCAAAATTGG + Intronic
924340787 1:243029072-243029094 GTTCACAATAGCAAAAGTATAGG + Intergenic
1063393964 10:5669407-5669429 GTTAACAATGGCAGGAAGATTGG - Intergenic
1063861038 10:10307785-10307807 GTTCACTAGAGCAAGCCGATGGG - Intergenic
1066735685 10:38476335-38476357 GTTCACAATAGCAAAAGTATAGG - Intergenic
1068331319 10:55574490-55574512 GTTGCCAATAGCAGGAGGCTTGG - Intronic
1076400419 10:130180382-130180404 GTTCTCAATAGGAGGACCAAAGG - Exonic
1085325120 11:75600691-75600713 GTTCACATTTTCAGGACCATAGG - Intronic
1090138939 11:124232476-124232498 GTTCAAAAAAGAAGGATGATTGG + Intergenic
1094110395 12:26855766-26855788 GTTCATAACAGCAGGATGAGAGG - Intergenic
1095259708 12:40083840-40083862 GTAAACAACAGCAGGAAGATTGG - Intronic
1103226990 12:119296267-119296289 GCTCACAGTTGCAGGACGGTGGG - Intergenic
1118792183 14:69105207-69105229 ATTCACAATAGCCAGAAGATGGG + Intronic
1120788999 14:88562462-88562484 GTTCAGAGAAGCAGGAGGATGGG + Intergenic
1124877027 15:33604621-33604643 ATTCAAAATGGCAGGATGATGGG + Intronic
1129377417 15:75142723-75142745 GTTACCAACAGCAGGAGGATAGG - Intergenic
1130539718 15:84813431-84813453 GTTCAAAATAACTGGAAGATGGG + Intergenic
1134330772 16:13249236-13249258 GTTCATAAAAGCAGGACGTTTGG + Intergenic
1142453167 16:90196391-90196413 GTTCACAATAGCAAAAGTATGGG - Intergenic
1149862337 17:60128985-60129007 GTTCACACCAGCAGGAGGCTAGG + Intergenic
1153087452 18:1304064-1304086 GTTCACTATAGCAGCACCTTGGG + Intergenic
1153346026 18:4027074-4027096 ATTAACAATAGCAGTAGGATAGG + Intronic
926238122 2:11065023-11065045 GTTAAAAATAGCAGGCAGATTGG - Intergenic
933535282 2:83565311-83565333 GTTCACTATAGCAGGCCGCTAGG - Intergenic
949084605 2:242141056-242141078 GTTCACAATAGCAAAAGTATGGG - Intergenic
1174603765 20:51745481-51745503 GTTCTCAATAGCAGGGCGGGGGG + Intronic
1174748534 20:53088499-53088521 GTTGACAACAGCAGGACGGAGGG - Intronic
1176281184 20:64313550-64313572 GTTCACAATAGCAAAAGTATAGG - Intergenic
1177392621 21:20495829-20495851 ATTCAAAATAGCATGACCATGGG - Intergenic
1179020029 21:37631557-37631579 GTTCACAATAGCAGGACGATTGG + Intronic
1180746177 22:18090559-18090581 GTTCACAATTACAAGACCATGGG - Exonic
949387946 3:3525679-3525701 GTGCCAAGTAGCAGGACGATTGG + Intergenic
950465593 3:13151522-13151544 GTTCAGAATGGGAGCACGATGGG + Intergenic
950945014 3:16936349-16936371 GTCCACATTAGCATGACCATGGG + Intronic
956067585 3:65413367-65413389 GTTAACAACAGCAAGGCGATCGG + Intronic
965020369 3:163221177-163221199 GTACACAATAGAAGAAGGATTGG - Intergenic
968315380 3:197719945-197719967 GTTCAGAATAGCTGGAAGAGAGG - Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977488672 4:97682903-97682925 GTCCACAGTAGTAGGACCATGGG + Intronic
982664969 4:158250794-158250816 GTTCATAAAAGCAGGACCCTGGG - Intronic
983149800 4:164264062-164264084 GTTCACAATAGCAAAAGTATAGG + Intronic
992285867 5:75235401-75235423 GTAAACAATAGCAGGTAGATTGG + Intronic
998440605 5:142158505-142158527 CTTCAGAATGGCAGGACTATGGG + Intergenic
1002561867 5:180088033-180088055 GTTAACAATAGCAGGTGGATAGG + Intergenic
1005592689 6:27345059-27345081 GTCCATAATAGCAGGAACATAGG - Intergenic
1006527556 6:34620113-34620135 GTACCCTATAGCAGGAGGATGGG + Intronic
1007468837 6:42074945-42074967 GCTCACAAGAGCAGGACGGCAGG - Intronic
1014132057 6:117846187-117846209 TTCCACAATAGCAGGATGACAGG - Intergenic
1027721081 7:81742342-81742364 TTTCACTATAGCAGAATGATGGG - Intronic
1039233840 8:35479508-35479530 GTTCACAATGGCAGCAGCATGGG + Intronic
1040596646 8:48844664-48844686 GTTTACAATCACAGGACAATGGG + Intergenic
1051977193 9:22965287-22965309 CTGGAAAATAGCAGGACGATAGG + Intergenic
1054473376 9:65556039-65556061 CTTCTGAATAGCAGGACTATAGG + Intergenic
1059736577 9:117105876-117105898 ATTCACAATAACTGGATGATGGG + Intronic
1193032566 X:76915213-76915235 ATTCACAGTAGCAGAAAGATAGG + Intergenic
1194440726 X:93930170-93930192 TTTCACAAAGGCAGGACTATTGG - Intergenic
1199292273 X:146118788-146118810 ATTCACAATAGCAGAAACATTGG + Intergenic
1202384117 Y:24307764-24307786 GTTCACAATAGCAAAAGTATAGG - Intergenic
1202486666 Y:25362356-25362378 GTTCACAATAGCAAAAGTATAGG + Intergenic