ID: 1179022408

View in Genome Browser
Species Human (GRCh38)
Location 21:37652173-37652195
Sequence ACCAGGAAGCTTCAGGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179022408 Original CRISPR ACCAGGAAGCTTCAGGTCAT AGG Intronic
900320138 1:2079468-2079490 ACCACGCAGCTTCAGGCCCTGGG - Intronic
901987961 1:13091172-13091194 CCCTGGAAGCTTCAGGCCAGAGG + Intergenic
901993851 1:13135595-13135617 CCCTGGAAGCTTCAGGCCAGAGG - Intergenic
902274591 1:15330397-15330419 AACAGGTAGAATCAGGTCATGGG + Intronic
904013600 1:27404299-27404321 ACATGGAACCTTCAGGTCAGTGG + Exonic
905064693 1:35170460-35170482 GCCAGGCAGCTCCAGGTCAGAGG - Intergenic
906251099 1:44311660-44311682 ACCAGGACTCTTGAGGTTATGGG - Intronic
906856111 1:49306766-49306788 ATCTGGAAACTTCAAGTCATGGG + Intronic
910768840 1:90810365-90810387 ACCAAGAAGATACAGTTCATGGG + Intergenic
911187692 1:94919849-94919871 ACCAGGAAGCTTCAGGGTGTGGG - Intronic
911393361 1:97274437-97274459 CTCAGGAAGCTTCTGATCATCGG - Intronic
913659041 1:120990573-120990595 ACCAGGAAGCTTGAGATCTGTGG - Intergenic
914010408 1:143773698-143773720 ACCAGGAAGCTTGAGATCTGTGG - Intergenic
914167414 1:145187415-145187437 ACCAGGAAGCTTGAGATCTGTGG + Intergenic
914649027 1:149682357-149682379 ACCAGGAAGCTTGAGATCTGTGG - Intergenic
915367967 1:155325896-155325918 TCCAGGAAGATGCAGGTCAGAGG + Exonic
916301288 1:163277206-163277228 AGCAGGAGGTTCCAGGTCATAGG - Intronic
924372240 1:243363145-243363167 ACAAGGAAGCTGCAGGTCATAGG - Intronic
1063658206 10:8012547-8012569 ACGTGGGAGCTTCAGGGCATAGG + Intronic
1063907536 10:10796572-10796594 ACCAGGGAGATTCAGGTCTGGGG - Intergenic
1069840923 10:71338908-71338930 ACCAGGAAGCCTCAGATGCTGGG - Intronic
1071388832 10:85149476-85149498 TCCAGGAAGAATCAGGTCACAGG - Intergenic
1072505074 10:96057631-96057653 ACCAGGAAGGTTCACATCAAGGG + Intronic
1074719280 10:116250737-116250759 ACCAGGAAGCTTCAAATCCATGG - Intronic
1075813955 10:125250048-125250070 GCCAGCAAGTTTCTGGTCATTGG - Intergenic
1076250262 10:128979385-128979407 CCCTGGAAGCTCCAGGTCCTTGG + Intergenic
1078038796 11:7837649-7837671 ACGATGAAGCTTTAGGTCATAGG + Intergenic
1078764458 11:14280936-14280958 TCCAGGAAGCTTAAGGTGTTGGG - Intronic
1079087189 11:17454846-17454868 ACTAGGATGCTTAAGGTCAAAGG - Intronic
1080730050 11:34941186-34941208 ACCAGGTTGCCTCAGGTCTTTGG + Intronic
1084234692 11:67779517-67779539 ACCAGGAAGCCTGAGGTCCCAGG + Intergenic
1090673631 11:128969559-128969581 AGCAGGAAGCTTCCTGACATGGG - Exonic
1092237789 12:6820892-6820914 ACCAGGAATCTTCTGGTCTTTGG + Intergenic
1093343019 12:18002053-18002075 ACGGGGAAGCTTCATGACATTGG + Intergenic
1097733484 12:63154930-63154952 AGCGGGAGGTTTCAGGTCATAGG - Intergenic
1098918992 12:76285676-76285698 ACCAGGCAGCTTGAGGTGTTGGG - Intergenic
1101794023 12:107956316-107956338 CCCAGGATGCTTCAGGTAATGGG + Intergenic
1104537892 12:129635485-129635507 TCCAAGAAGCCTCAGGTCAAGGG + Intronic
1104747540 12:131219670-131219692 AGCAGGAAACCTCAGGGCATGGG + Intergenic
1106786589 13:33113673-33113695 ACCAGGCAGCCTAAGGTTATGGG + Intronic
1107666959 13:42700361-42700383 ACCAGCAAGCCTGAGGTCAAGGG + Intergenic
1108897868 13:55357536-55357558 GCTAGGAAGCTTAAGGTCAAAGG - Intergenic
1110151534 13:72260606-72260628 AAAAAGAAGCTCCAGGTCATGGG + Intergenic
1110967741 13:81722323-81722345 AACAGGAAGCTACATGTTATTGG - Intergenic
1112929419 13:104715483-104715505 CTCAGGAAGCTTCCAGTCATGGG + Intergenic
1113395830 13:109946687-109946709 ACCAGGAAGCTTCTGATGAAAGG + Intergenic
1113646259 13:111998648-111998670 ACCTTGAAGCTTAAGGTCACAGG - Intergenic
1118001406 14:61526870-61526892 ACAAGGAGGCTGCAGGTCACGGG - Intronic
1119696589 14:76718343-76718365 AACAGGAAGCATCAGTTTATAGG + Intergenic
1119933041 14:78566543-78566565 ACCAGAAAGCGTTAGGTTATGGG + Intronic
1120491163 14:85180211-85180233 TCCAGGAAGAGTCAGGTCATAGG - Intergenic
1121108525 14:91296409-91296431 TCCAGGAGGTTTCAGGTCAGGGG - Intronic
1121697615 14:95926514-95926536 ACCAGGAGGTTTCTGGCCATAGG - Intergenic
1125067082 15:35500234-35500256 AACAGGAAGCTTCTGATCAAAGG - Intronic
1127820013 15:62646567-62646589 ACCAAGAAGCTTCACGTGATTGG - Intronic
1127995042 15:64148834-64148856 TCCAGGAAGCCTCAGATCAGTGG - Intergenic
1128055825 15:64699548-64699570 ACCAGGAAGCTTGATTTCCTTGG + Intronic
1129787277 15:78317945-78317967 TCCAGCCAGCTTCAGGTCTTCGG - Intergenic
1131371218 15:91883365-91883387 ACCAAGAAGCCTCAGGTCTCTGG - Intronic
1132184665 15:99792644-99792666 ATCAGCAAGCTTCAGGGCAGTGG - Intergenic
1132432318 15:101772010-101772032 ATCAGCAAGCTTCAGGGCAGTGG + Intergenic
1132660282 16:1058061-1058083 TCCAGGCAGATTCAGTTCATGGG + Intergenic
1133970042 16:10560879-10560901 ACCAAGAAGCTTAAGGGCCTTGG + Intronic
1134492743 16:14707863-14707885 AGCAAGAAACTTGAGGTCATGGG + Intergenic
1134498124 16:14746985-14747007 AGCAAGAAACTTGAGGTCATGGG + Intronic
1134574726 16:15322630-15322652 CCCAGCAATCTTCAGGCCATAGG + Intergenic
1134592611 16:15467884-15467906 AGCAGGAACTTTCAAGTCATAGG + Intronic
1136134097 16:28244079-28244101 ATCAGGAGGCTTCAGGTGAGAGG + Intergenic
1136358643 16:29763164-29763186 ACCATGAAGCATCAGGCCACCGG - Intergenic
1140473567 16:75227740-75227762 AGCTGGAAGCGTCAGCTCATGGG + Intergenic
1140906895 16:79416754-79416776 AGCAAGCTGCTTCAGGTCATAGG - Intergenic
1141609253 16:85171769-85171791 ACCGGGGAGCTCCAGCTCATGGG - Exonic
1143254256 17:5544068-5544090 ACCATGGAGCCTCAGCTCATAGG + Intronic
1143420473 17:6787596-6787618 ACCTGGAGCCTTCAGGTCATGGG - Exonic
1147522684 17:41189757-41189779 ACCAGGAAAATTCTGCTCATTGG + Intergenic
1148050593 17:44768203-44768225 GCCAGGATGGTTCAGGCCATGGG + Intronic
1149043636 17:52219685-52219707 TCCAGTAAACTGCAGGTCATTGG - Intergenic
1151158386 17:72143604-72143626 GCCCGGAAGCTTAGGGTCATAGG - Intergenic
1151335902 17:73439591-73439613 TCCAGGAAGTTTCAGGTCAAGGG + Intronic
1152925569 17:83086102-83086124 ACCAGGAGGCATGAGGTCCTGGG + Intronic
1155514035 18:26606046-26606068 AGCAGGAGATTTCAGGTCATAGG + Intronic
1157714923 18:49877865-49877887 AACAGCAAACTCCAGGTCATAGG - Exonic
1159469796 18:68837227-68837249 GCCAGGAAGCTTCAGATCCTGGG - Exonic
1159925537 18:74265879-74265901 AGCAGGAATGTTTAGGTCATGGG - Intronic
1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG + Intronic
1163533239 19:17862820-17862842 AACAGGATGTGTCAGGTCATTGG + Intronic
1164905095 19:31960712-31960734 ACCAGGAGGCTTCAGGGGTTAGG - Intergenic
1165931606 19:39362741-39362763 CCCAGGAAGCTACAGGACAGTGG - Intronic
1167550830 19:50159632-50159654 TCCTGGAAGCTTCAGGTAGTGGG - Intronic
1168143814 19:54407873-54407895 ACCAGGAAGTTTGATGTCCTAGG + Intergenic
1168721099 19:58555468-58555490 GCCAGGAAGCCACAGGTCACTGG + Intergenic
1202706375 1_KI270713v1_random:27267-27289 ACCAGGAAGCTTGAGATCTGTGG - Intergenic
926506469 2:13721961-13721983 TCCAGGAAGAATCAGGTCACAGG - Intergenic
936835352 2:116703146-116703168 ACCAGGAAGCCTCAATTCACTGG + Intergenic
936957161 2:118034123-118034145 TCCAGGCAGCCTCAGGTGATTGG + Intergenic
938171387 2:129079798-129079820 ACAAGGAAGCTACAAGTCAAGGG - Intergenic
939592639 2:144084194-144084216 ACCAGAAAGGTTCAGCCCATGGG + Intronic
940602456 2:155879012-155879034 AGCAGAAATCTTCAGGTCAAGGG + Intergenic
946610118 2:221448873-221448895 CCCGGGCAGCTTCAGGCCATGGG - Intronic
946712174 2:222517545-222517567 TCCAGGAAGGATCAGGTCACAGG - Intronic
948425513 2:237884740-237884762 ACCTGGAAGCTTTAGGGCAGAGG - Intronic
948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG + Intergenic
948793144 2:240389353-240389375 ACTAGGCAGCTCCAGGTCAGGGG - Intergenic
1170105475 20:12750629-12750651 TCCAGGAAGAATCAGGTCATAGG - Intergenic
1172657897 20:36548179-36548201 ACGAGGAAGCCTCAGGTCCGTGG + Exonic
1174087133 20:48017251-48017273 CTCAGGAAGCTTCCGATCATGGG - Intergenic
1174717546 20:52776031-52776053 ATCAGGAAGCTCCAACTCATGGG - Intergenic
1175484373 20:59334729-59334751 ACAAGGAAGCTTCTGGGCATGGG + Intergenic
1178603471 21:34015094-34015116 CTCAGGAAGCTTCCAGTCATGGG + Intergenic
1178819955 21:35966050-35966072 GCCAGGAAGCTTCAGGGAATTGG + Intronic
1179022408 21:37652173-37652195 ACCAGGAAGCTTCAGGTCATAGG + Intronic
1179026190 21:37680734-37680756 TCCAGGAAACTGCAGGTCTTGGG + Intronic
1179031987 21:37729035-37729057 ACCAGAAAGTTTGAAGTCATAGG + Intronic
1184514501 22:44953656-44953678 ACCTGGAAGCTGCAGGTCTCAGG - Intronic
952160861 3:30691674-30691696 TCCAGGAAGCATCAGTTCAGGGG - Exonic
952547207 3:34433381-34433403 GCCAGGAAGCTCGAGGTCAGTGG - Intergenic
954181574 3:48885368-48885390 ACGAGGAAGATTCAGGACCTGGG + Intronic
956781963 3:72610850-72610872 AACATGCAGCTTCAGGTCCTCGG + Intergenic
957231703 3:77526182-77526204 ACAGGGAAGCTTCAGACCATAGG - Intronic
957244722 3:77702463-77702485 TCCAGGAAGAATCAGGTCACAGG - Intergenic
959378032 3:105608799-105608821 TCCAGGAAGAATCAGGTCACAGG - Intergenic
960110099 3:113837534-113837556 AGGAGGAACTTTCAGGTCATTGG + Intronic
962094943 3:132284030-132284052 AGCAGGAACTTACAGGTCATTGG + Exonic
967596011 3:191327682-191327704 AACAGGAAGCCACAGGTCAAAGG + Intronic
974124080 4:57674359-57674381 ATCAGGACTTTTCAGGTCATAGG + Intergenic
974250299 4:59376458-59376480 CCCAGTAAGGTTCAGGTCTTTGG - Intergenic
975961489 4:79912924-79912946 ACCAGCATGCTGCAGGTAATGGG + Intronic
976362634 4:84197643-84197665 AGCAGGAGGCTGCAGCTCATTGG - Intergenic
978400265 4:108323602-108323624 ATCATGATGCTTCAGGTCTTTGG - Intergenic
979553577 4:122019160-122019182 ACAAGGCAGCTTCAGCTCAGAGG + Intergenic
979846739 4:125523002-125523024 TCCAGGAAGAATCAGGTCACAGG - Intergenic
980534096 4:134092465-134092487 TCCAGGAAGTATCAGGTCATGGG - Intergenic
980678558 4:136124618-136124640 ACCAGGAAGCTAGATGTGATAGG - Intergenic
982849608 4:160296113-160296135 ACCAGGAAACTTCTCATCATAGG + Intergenic
984373458 4:178895910-178895932 TCAAGAAAGCTTGAGGTCATAGG - Intergenic
987071060 5:14337557-14337579 ACATGGAAGCTTGTGGTCATAGG + Intronic
990018630 5:51098380-51098402 ACCAGGAAGCTGCTGATCACCGG + Intergenic
990054978 5:51562970-51562992 AACAGGAAACTATAGGTCATAGG - Intergenic
991342175 5:65624008-65624030 ACCAGGCAATTTCAGGCCATAGG + Intronic
996080704 5:119255440-119255462 AACCTGAAGGTTCAGGTCATAGG + Intergenic
996167356 5:120241507-120241529 ATCAGAAAGCTTCAGAACATGGG + Intergenic
1000202450 5:159025084-159025106 ACCAGGAAAATTCAGGGCTTTGG - Intronic
1000234431 5:159344473-159344495 TCCAGGAAGAATCAGGTCACAGG + Intergenic
1000852865 5:166362043-166362065 TCCAGGAAGAATCAGGTCACAGG + Intergenic
1011127908 6:84026700-84026722 ATGAGGAAGCTTCAGTTTATTGG - Intergenic
1013525089 6:110966556-110966578 ACCAGGAAGGTGAAGATCATTGG + Intronic
1016920675 6:149289915-149289937 AGCAGGGAGTTCCAGGTCATAGG + Intronic
1017078189 6:150639623-150639645 CCCAGGAAGCTCTTGGTCATCGG - Intronic
1017334531 6:153239906-153239928 ACCAGGAATGTTCTGGTTATCGG + Intergenic
1020366345 7:7384726-7384748 ACCAGGAAACTTGATATCATTGG + Intronic
1020806996 7:12802341-12802363 ACCAGGAAGCAGGAGGACATGGG - Intergenic
1023736005 7:43236555-43236577 AGCAGGAACTTCCAGGTCATAGG + Intronic
1024376742 7:48648127-48648149 ACTAGGTGGCTTAAGGTCATAGG + Intergenic
1026119223 7:67522162-67522184 AGCAGGAGCTTTCAGGTCATAGG - Intergenic
1026984245 7:74544994-74545016 ACCAGGAAGTTCCTGGTCAAAGG + Intronic
1029743352 7:102503481-102503503 ACCAGGCAGCTGCAGGCCAGTGG + Intronic
1029761341 7:102602642-102602664 ACCAGGCAGCTGCAGGCCAGTGG + Intronic
1029971514 7:104794253-104794275 ACCAAGAAGTTTCAGGTCTGGGG - Intronic
1034647956 7:152665118-152665140 ACCAGGAAGGATCAGGAAATAGG + Intronic
1035370369 7:158375958-158375980 TCCAGGAAGAATCAGGTCACAGG - Intronic
1036409566 8:8486707-8486729 AACAGTAACATTCAGGTCATTGG - Intergenic
1036657891 8:10689650-10689672 ATCAGTAAGCTTCTGGTCAACGG - Intronic
1036710992 8:11078504-11078526 GCCAGGAACCTTGAGGTCACTGG + Intronic
1036764436 8:11538610-11538632 GCCAGGAAGCTTAAAGTCAATGG + Intronic
1036808421 8:11850947-11850969 TGCAGGCAGCTTCAGGTCCTCGG + Exonic
1038337482 8:26656982-26657004 ACCAGGAAGCAGCAGGCCCTCGG - Exonic
1042839319 8:73107891-73107913 ACCAGGCAGCTTCTGGTCTTAGG - Intronic
1044106932 8:88221053-88221075 ACCAGAAAGCTTCAGGACTTAGG + Intronic
1044598551 8:93981332-93981354 ACCCGGGAGCTGCAGGTCATCGG - Intergenic
1044924104 8:97195258-97195280 ACCAAGAAACGGCAGGTCATAGG - Intergenic
1045838674 8:106553854-106553876 ATCAGGGAGCTTAAGGTAATGGG - Intronic
1046532246 8:115461967-115461989 AACAGGAAGCTTCCACTCATTGG - Intronic
1051336382 9:16070116-16070138 TCCAGGCCGCTTCAGCTCATTGG - Intergenic
1052588928 9:30465987-30466009 TCCAGGAAGAATCAGGTCACAGG - Intergenic
1052909419 9:33867038-33867060 ACCAGGAATATTTAGGACATTGG - Intronic
1055450135 9:76423448-76423470 ACTAGGAAGTTCAAGGTCATGGG - Intronic
1057367486 9:94436612-94436634 ACCAAGAAGATTAAGGACATGGG - Intronic
1057655843 9:96951441-96951463 ACCAAGAAGATTAAGGACATGGG + Intronic
1059599877 9:115765367-115765389 ACCAGAAATCTTCAGGTCACTGG - Intergenic
1061541524 9:131280118-131280140 ACCAGGAAGCATCAGTCCATGGG + Intergenic
1186218369 X:7324178-7324200 GTGAGGAGGCTTCAGGTCATAGG + Intronic
1186400331 X:9252573-9252595 ACAAGGCAGCTTCAGCCCATTGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189572976 X:42319476-42319498 TTCAGGAAGCTTCCAGTCATGGG + Intergenic
1190137329 X:47808620-47808642 ACATGGAACCTTCAGGTCAGTGG - Intergenic
1190566133 X:51732191-51732213 TCCAGGAAGAATCAGGTCACAGG - Intergenic
1191105755 X:56771081-56771103 ACCAGGAAGCTTCTTGTCGATGG - Intergenic
1191106748 X:56776483-56776505 ACCAGGAAGCTTCTTGTCGATGG - Intergenic
1191108347 X:56786300-56786322 ACTAGGAAGCTTCTTGTCAATGG - Intergenic
1195008432 X:100710805-100710827 ACCAGGTAGCTGGAGTTCATAGG + Intronic
1199617088 X:149664959-149664981 ATGATGAAGCTTCAGGTCCTAGG + Intergenic
1199625553 X:149738289-149738311 ATGATGAAGCTTCAGGTCCTAGG - Intergenic