ID: 1179023471

View in Genome Browser
Species Human (GRCh38)
Location 21:37659675-37659697
Sequence GGCAAGTCCCACATCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179023471_1179023474 -7 Left 1179023471 21:37659675-37659697 CCCCATCTGATGTGGGACTTGCC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1179023474 21:37659691-37659713 ACTTGCCTTGACCCAATGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179023471 Original CRISPR GGCAAGTCCCACATCAGATG GGG (reversed) Intronic
900265861 1:1756901-1756923 AGGAAGGCCCACGTCAGATGTGG + Intronic
902664773 1:17929899-17929921 GGCAATTCCCAAAGCAGATCCGG + Intergenic
904138221 1:28330528-28330550 GGCCAGTGCCACAACAGATCTGG + Intronic
907050232 1:51325361-51325383 GGCAGGGACCACATCAGGTGGGG - Intronic
909680681 1:78288062-78288084 GGCAGGTCACAGGTCAGATGGGG - Intergenic
909681588 1:78298062-78298084 GGCCACTCCCTCAACAGATGGGG - Intergenic
910017444 1:82544916-82544938 TGCAAGTCACACATCCGATAAGG + Intergenic
910631060 1:89354767-89354789 GGCAAGTTCCAGAGCAGAAGGGG - Intergenic
910859686 1:91731507-91731529 GGCAAAACCCTCAGCAGATGTGG - Intronic
911387066 1:97189888-97189910 AGCAAGTCTCACATCAGTTCAGG + Intronic
915602233 1:156929589-156929611 GGCAAGTCCCACCTCCGGAGGGG - Intronic
915822893 1:159044171-159044193 GGCTAGTCCCATCTCACATGTGG + Intronic
918132697 1:181643552-181643574 GGCATGGCCCACCCCAGATGTGG - Intronic
919864242 1:201767618-201767640 GGCTAGTCCCAATTGAGATGTGG - Intronic
922746894 1:228049222-228049244 GGCAAGTGGCACAGCAGAGGTGG + Intronic
924552239 1:245089617-245089639 GGCCTCTCCCACAGCAGATGTGG + Intronic
1064097375 10:12433939-12433961 GGCCAGTACCACTTCAGAGGAGG - Intronic
1064256093 10:13743832-13743854 GGCAAGTTCCAGAGCAGAGGTGG - Intronic
1065857952 10:29845628-29845650 GGTGAGTCCAACATCTGATGCGG + Intergenic
1070260671 10:74851960-74851982 GAAAAGTCCCAGAACAGATGAGG - Intronic
1070360082 10:75679786-75679808 GGCAAATCCTACTTCTGATGTGG + Intronic
1070563222 10:77583608-77583630 GTCAAGTCACTCATCAGAGGAGG - Intronic
1075443985 10:122501094-122501116 TGCAGGTCCCACAGCAGGTGGGG - Intronic
1075630423 10:123997394-123997416 GGAAAGTCCCAGCACAGATGAGG + Intergenic
1077121716 11:911759-911781 GGCACGTCCCCCACCAGCTGTGG + Intronic
1078194566 11:9124804-9124826 GGCAAGAAACACATCAGGTGAGG + Intronic
1079332053 11:19541680-19541702 GGCATGTCCCACATCAGCCTGGG - Intronic
1079875834 11:25856130-25856152 GGAAAGGCCCACACCAGATATGG + Intergenic
1080297603 11:30748388-30748410 GGCAAGTCCAAAATCTGCTGTGG - Intergenic
1083183340 11:61002757-61002779 GAGAAGGCCCTCATCAGATGTGG - Intronic
1083842239 11:65311081-65311103 GGCAAGTCCCAAACCAGATAAGG - Intergenic
1088448017 11:109953053-109953075 GGCAGATCCCACATCTGGTGAGG + Intergenic
1088894057 11:114064587-114064609 CTCAAGTCCTACATCAGGTGCGG - Intronic
1094017753 12:25883189-25883211 GGCATGTCCCACATTAAATCTGG - Intergenic
1094064810 12:26351126-26351148 AGCAAGTCACTCATCAGAGGTGG - Intronic
1095943636 12:47741336-47741358 GGGAATTCCCCCATCAGCTGAGG + Intronic
1100168362 12:91944461-91944483 GGCAAGATCCACATAACATGTGG + Intergenic
1100198436 12:92273278-92273300 GGCAAGTCCACAATCTGATGGGG - Intergenic
1100227722 12:92575493-92575515 TGCAAATCACACATCAGAGGAGG - Intergenic
1104146920 12:126043356-126043378 GCCATGTCCAGCATCAGATGGGG + Intergenic
1105213561 13:18271842-18271864 GGCAAGTCCAGCATCAGAGCAGG - Intergenic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1105941895 13:25154892-25154914 AGCAAGGCCCTCACCAGATGTGG + Intergenic
1107131407 13:36900221-36900243 GTAAAGTCCCAAAGCAGATGAGG - Intronic
1109160619 13:58969299-58969321 GGCCTGTCCCACAACACATGGGG - Intergenic
1110279985 13:73681847-73681869 GTCAAGTCCAAAATCGGATGGGG + Intergenic
1115021919 14:28692229-28692251 GACAAGTCCCAAATCAGCTCAGG - Intergenic
1116522667 14:45869471-45869493 GGCAAGTTTCACAGCAGAAGTGG + Intergenic
1116780936 14:49236741-49236763 GGCAAGTCCAAAATCCAATGAGG - Intergenic
1121954770 14:98203956-98203978 GGCTATGCACACATCAGATGAGG + Intergenic
1124388875 15:29235094-29235116 CTCATGTCCCACAACAGATGTGG + Intronic
1129075075 15:72987699-72987721 GGCAAGCCCTACATCTGATAAGG + Intergenic
1130570463 15:85038582-85038604 TGCAAATCACACATCAGATAAGG + Intronic
1130651499 15:85764527-85764549 AGCCAGTCCCAGATCTGATGGGG - Intronic
1132227698 15:100155258-100155280 GGCAGGTCCCACATCATGTCAGG - Exonic
1132533671 16:466778-466800 GGCCAATCCCACAGCAGCTGGGG + Intronic
1134166621 16:11935260-11935282 TGCAAATCCCATCTCAGATGTGG + Intronic
1134494086 16:14718444-14718466 TGCAAATCCCATCTCAGATGTGG - Intronic
1134499466 16:14757568-14757590 TGCAAATCCCATCTCAGATGTGG - Intronic
1134526016 16:14944196-14944218 TGCAAATCCCATCTCAGATGTGG - Intronic
1134546391 16:15112167-15112189 AGCAAATCCCATCTCAGATGTGG + Intronic
1134713596 16:16342683-16342705 TGCAAATCCCATCTCAGATGTGG - Intergenic
1134721466 16:16386041-16386063 TGCAAATCCCATCTCAGATGTGG - Intronic
1134945960 16:18325843-18325865 TGCAAATCCCATCTCAGATGTGG + Intronic
1134953223 16:18365987-18366009 TGCAAATCCCATCTCAGATGTGG + Intergenic
1135312011 16:21412674-21412696 TGCAAATCCCATCTCAGATGTGG + Intronic
1135364960 16:21845130-21845152 TGCAAATCCCATCTCAGATGTGG + Intronic
1135446880 16:22526209-22526231 TGCAAATCCCATCTCAGATGTGG - Intronic
1135650361 16:24201120-24201142 GGTAAGTCTCACATGAGTTGGGG - Intronic
1136151181 16:28350599-28350621 TGCAAATCCCATCTCAGATGTGG + Intronic
1136167413 16:28464438-28464460 TGCAAATCCCATCTCAGATGTGG + Intronic
1136195564 16:28650579-28650601 TGCAAATCCCATCTCAGATGTGG - Intronic
1136211902 16:28764695-28764717 TGCAAATCCCATCTCAGATGTGG - Intronic
1136256622 16:29044640-29044662 TGCAAATCCCATCTCAGATGTGG - Intronic
1136322131 16:29493197-29493219 TGCAAATCCCATCTCAGATGTGG + Intronic
1136402291 16:30025236-30025258 GGCAGGCCCCACGGCAGATGAGG + Exonic
1136436810 16:30233169-30233191 TGCAAATCCCATCTCAGATGTGG + Intronic
1136473749 16:30499009-30499031 TGCACGTCCCCCCTCAGATGTGG - Intronic
1139856418 16:69984097-69984119 TGCAAATCCCATCTCAGATGTGG + Intergenic
1140366313 16:74383965-74383987 TGCAAATCCCATCTCAGATGTGG - Intronic
1145267840 17:21388999-21389021 CTCAAGTCACACAGCAGATGGGG - Intronic
1150970964 17:70027921-70027943 GGCATGTCCCACTTAAAATGGGG + Intergenic
1151148484 17:72063728-72063750 GGCCAGGCCCACATCATTTGTGG - Intergenic
1152464513 17:80458255-80458277 GGCCAGACCCACTTCAGGTGGGG - Intergenic
1154117892 18:11627361-11627383 TGCAAATCCCATCTCAGATGTGG + Intergenic
1156346114 18:36258482-36258504 GGCAACTCCCACAACCTATGAGG - Intronic
1156465906 18:37347747-37347769 GGCAAGTCCCACACCACACAGGG + Intronic
1160038327 18:75321511-75321533 GGCACTTCACACATCAGGTGAGG - Intergenic
1163282010 19:16324271-16324293 GGGTGGTCCCACAACAGATGAGG + Intergenic
1167621721 19:50564502-50564524 GGCAGGTTTCACAGCAGATGGGG + Intronic
1168307291 19:55442533-55442555 GGCAGGTGCCACAGCAGAAGCGG + Exonic
929699791 2:44152137-44152159 GGCAAGACCCTCCCCAGATGTGG + Intergenic
929940772 2:46332499-46332521 TGCAAGACACACATCAGACGAGG - Intronic
932423462 2:71614564-71614586 GGCAAGTCTCACAGGAGAAGAGG - Intronic
933570357 2:84003442-84003464 GGCAAGTCCCACATGCCATTAGG - Intergenic
934942468 2:98512515-98512537 GGGAAGACCCTCACCAGATGCGG - Intronic
940612821 2:156011641-156011663 GAAAAGTCCCACAACAGATGGGG + Intergenic
942548560 2:177090962-177090984 GGCAAGTCCCACATCCACTCTGG - Intergenic
943894271 2:193333313-193333335 GGCAGGTCCCAAATCCAATGAGG + Intergenic
1172865914 20:38097155-38097177 GGCAAATCCCAAATCTGCTGGGG + Intronic
1173896532 20:46555251-46555273 AGCAAGTCCAAAATCTGATGGGG - Intergenic
1176363032 21:6014504-6014526 CGCAAATCCCACATCTGATAAGG - Intergenic
1177317091 21:19476771-19476793 GGCAAGTCCAAAATCCGATAGGG + Intergenic
1177383482 21:20376676-20376698 AGCAAGGCCCTCATCAGATGTGG + Intergenic
1179023471 21:37659675-37659697 GGCAAGTCCCACATCAGATGGGG - Intronic
1179651922 21:42816726-42816748 AGGAAGGCCCTCATCAGATGTGG - Intergenic
1179760486 21:43524041-43524063 CGCAAATCCCACATCTGATAAGG + Intergenic
1180724875 22:17939382-17939404 AGCAAGTCACACACCAGCTGAGG + Intronic
1181699123 22:24610040-24610062 GGCAAGTCCAGCATCAGAGCAGG + Intronic
1184424765 22:44402964-44402986 GGCAATTCCCTCCTCAGGTGTGG - Intergenic
950495591 3:13332396-13332418 GGCAAGTTTCACTTCCGATGGGG + Intronic
950686219 3:14620366-14620388 GGCACACCCTACATCAGATGAGG + Intergenic
951138418 3:19131309-19131331 GGCAAGTTCCAGAGCAGAAGTGG - Intergenic
955005174 3:54961909-54961931 AGCAAGTCCCTCACCACATGGGG - Intronic
956255967 3:67283604-67283626 TGCAAGTCCCTCGCCAGATGTGG - Intergenic
960435373 3:117620016-117620038 TTCAAGTTCCACATCAGATTGGG - Intergenic
960873187 3:122271428-122271450 GGCAAGTCCAACTTCGGATGTGG - Intronic
969133601 4:5011828-5011850 AGCAAGTCCCGCTTCTGATGGGG + Intergenic
969246008 4:5933448-5933470 GGTCAGCCCCACAGCAGATGGGG - Intronic
969533744 4:7743156-7743178 GCACAGTCCCACATCTGATGGGG + Intergenic
970061586 4:12039843-12039865 GGCAAGTCCGAAACCAGGTGGGG - Intergenic
978892125 4:113842598-113842620 GGCAAGTCCAAAATTTGATGAGG + Intergenic
979789188 4:124756680-124756702 GACAAGTCCCAAATCTGATGTGG - Intergenic
984524328 4:180839971-180839993 GGCAAGTTCAAAATCTGATGTGG + Intergenic
988789515 5:34594361-34594383 AGGAAGGCCCTCATCAGATGTGG + Intergenic
991511019 5:67376327-67376349 GCCAAGTCACCCATCAGAGGGGG - Intergenic
995612016 5:113920891-113920913 GGCAAGTCACACAGAAGTTGTGG + Intergenic
996802855 5:127422608-127422630 GGGAAATCCCACAACAGAAGAGG - Intronic
1002448681 5:179306989-179307011 GGCCAGTCCCACATCTGTTGTGG + Intronic
1002791210 6:439298-439320 GGCAGGTCACAGATGAGATGAGG - Intergenic
1007231833 6:40353671-40353693 GGCAGGTCTGAAATCAGATGGGG + Intergenic
1013602451 6:111717877-111717899 GGAAAGTCCCACTTGGGATGGGG - Intronic
1015724280 6:136284815-136284837 GGCAAGTGCCACATTGGAGGGGG + Intronic
1019091217 6:169536259-169536281 TGCAAGGCTCATATCAGATGTGG - Intronic
1019597027 7:1862970-1862992 GACAAGTCCCACATGTGTTGGGG + Intronic
1019940973 7:4290850-4290872 GGTAACTCCCACAACACATGGGG - Intergenic
1020195850 7:6038486-6038508 GGCAACTCCTACATGAGATGGGG + Intronic
1020255710 7:6502147-6502169 GTCAAGGACCCCATCAGATGGGG + Intronic
1025171080 7:56757215-56757237 AGCATGGCCCACATCAGATGAGG + Intergenic
1025700796 7:63818474-63818496 AGCATGGCCCACATCAGATGAGG - Intergenic
1026978331 7:74512408-74512430 CTCAAGTCCCACAGCAGAAGTGG + Intronic
1027861327 7:83585881-83585903 GGCAGGTCCCACTACAAATGAGG - Intronic
1027920885 7:84392946-84392968 GGCAAGTCATACATCTGATAAGG - Intronic
1029682020 7:102117868-102117890 GGCATTTCCCACATCAGAAACGG + Intronic
1030453408 7:109742726-109742748 GGTAAGTCCAAAATCTGATGGGG + Intergenic
1030858725 7:114596032-114596054 GGCATGTCCCACATCTGAACAGG + Intronic
1034157423 7:148967067-148967089 GGCAAGTCCCAGAGAAGGTGAGG + Intergenic
1035101651 7:156402401-156402423 GGCCAGTCCCACAGCAGCTGTGG + Intergenic
1041534374 8:58909544-58909566 GGCAAGTCTGAAATCAGGTGTGG - Intronic
1045863388 8:106838431-106838453 GGCAAATCATACTTCAGATGAGG - Intergenic
1048948597 8:139474013-139474035 GGCAGGCCCCACATCACATCAGG + Intergenic
1052219247 9:25999254-25999276 GACAAGTCCCAAATAAGAGGAGG - Intergenic
1052452529 9:28650477-28650499 TGAAATCCCCACATCAGATGAGG + Intronic
1053363919 9:37509404-37509426 GGAAAGTTCCCTATCAGATGTGG - Intergenic
1054712428 9:68524676-68524698 GATGAGTCCCACATCAGATGAGG - Intronic
1057315669 9:93966880-93966902 GGCAAGTCCCAGGGCAGAGGTGG + Intergenic
1061691758 9:132338681-132338703 GGCATGTCCCAGAACAGAAGAGG - Intronic
1187269366 X:17765764-17765786 GGCAAGGCCCAGGTCACATGTGG - Intergenic
1189070105 X:37854794-37854816 GGCAAGTCCATAATCTGATGAGG + Intronic
1190212527 X:48459682-48459704 GACAAGGCCCATATTAGATGGGG + Intronic
1194592508 X:95816620-95816642 AGCAAGTCCAAAATCTGATGGGG - Intergenic
1199051220 X:143239225-143239247 TGCAAATCACACATCAGATAAGG + Intergenic