ID: 1179025371

View in Genome Browser
Species Human (GRCh38)
Location 21:37675024-37675046
Sequence CAGGACTGCATGAGTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179025371_1179025374 1 Left 1179025371 21:37675024-37675046 CCAGGTGGACTCATGCAGTCCTG 0: 1
1: 0
2: 0
3: 17
4: 290
Right 1179025374 21:37675048-37675070 TCGGAGCTCCTCTGCTGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 155
1179025371_1179025375 2 Left 1179025371 21:37675024-37675046 CCAGGTGGACTCATGCAGTCCTG 0: 1
1: 0
2: 0
3: 17
4: 290
Right 1179025375 21:37675049-37675071 CGGAGCTCCTCTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179025371 Original CRISPR CAGGACTGCATGAGTCCACC TGG (reversed) Intronic
900242599 1:1624167-1624189 CAGGGCGGCATGAGACCTCCAGG + Intronic
900322655 1:2092815-2092837 CAGCCCTGCAGGGGTCCACCTGG - Intronic
900865770 1:5267671-5267693 CAGGACTGCAAGAGTCCAGTGGG - Intergenic
901433659 1:9233561-9233583 CAGGACTGAATGGGGCCAACAGG - Intergenic
902074937 1:13776877-13776899 CTGGACTGGATGAGGTCACCTGG - Intronic
902305976 1:15539632-15539654 CAGGACTGCTTAAGCCCACGAGG - Intronic
903114336 1:21166338-21166360 GAGGACTGCTTGAGCCCAGCAGG + Intronic
903538255 1:24081650-24081672 GAGGACTGCATGAGCCCAGAAGG - Intronic
905016051 1:34779710-34779732 CAGGACTGGGTGAGCTCACCTGG + Intronic
905853519 1:41291468-41291490 CAGGACAGCATTAGCCAACCTGG + Intergenic
907098757 1:51807615-51807637 GAGGACTGCTTGAGTTCAGCAGG + Intronic
907399551 1:54216478-54216500 CGGGACTGAAGGAGTCCTCCAGG - Intronic
907784369 1:57597343-57597365 AAGGACAGCAAGAGTCAACCAGG + Intronic
909306765 1:74090802-74090824 AAGGACTGCTTGAGTCCAGGAGG + Intronic
910650626 1:89562561-89562583 CAGGACTGCTTGAGTTCAGGAGG - Intronic
914358495 1:146909503-146909525 CTGGCCTGCATGAGACCTCCTGG - Intergenic
914494930 1:148187504-148187526 CTGGCCTGCATGAGACCTCCTGG + Intergenic
915929133 1:160047828-160047850 GAGGACTGCTTGAGTCCAGGAGG - Intronic
916171699 1:162005935-162005957 CAGGACAGCAGGAGTAAACCAGG + Intronic
917089422 1:171337838-171337860 CAGGCCTGGATGAGGCCACCTGG - Intronic
917324598 1:173819142-173819164 TAGGACTGCATGAGCCCAGGAGG + Intronic
917586318 1:176430720-176430742 GAGGACTGCTTGAGCCCAGCAGG + Intergenic
924561323 1:245157953-245157975 AAGGACTGCATGAATGGACCTGG - Intronic
924725323 1:246664358-246664380 CAGGACGGCCTCAGGCCACCTGG - Intronic
1062920526 10:1275382-1275404 CAGGACTGAATGTGCACACCTGG - Intronic
1064037060 10:11922942-11922964 CAGGACTGCTTGAGCCCAGGAGG + Intronic
1064091525 10:12389484-12389506 CAGGCCTGGATGAAACCACCTGG - Intronic
1065739716 10:28786125-28786147 CAGGACTGGATGATAGCACCGGG + Intergenic
1066006890 10:31154000-31154022 CAGGAATCCATGGGCCCACCCGG + Intergenic
1066343362 10:34557842-34557864 GAGGACTGCTTGAGTCCAGGAGG + Intronic
1066365977 10:34777293-34777315 CAGATCTGGCTGAGTCCACCAGG - Intronic
1067529314 10:47059024-47059046 CAGGATTGGATGTGTGCACCTGG + Intergenic
1069939512 10:71944879-71944901 CAGGACTGGATGGCTCCAGCTGG + Intergenic
1070388208 10:75946209-75946231 GAGGACTGAGTCAGTCCACCAGG - Intronic
1071575589 10:86723531-86723553 CAGGGCACCATGAGACCACCTGG + Intronic
1071664208 10:87538024-87538046 AAGGACTGCTTGAGCCCACCAGG - Intronic
1076607769 10:131700622-131700644 CAGGACTGCCTGGGTGCAACTGG - Intergenic
1077125888 11:936300-936322 GAGGACTGCTTGAGTCCAGGAGG - Intronic
1077459620 11:2702311-2702333 GAGGACTGAAGGAGTCCACCAGG - Intronic
1079524235 11:21365066-21365088 CAGCTTTGCATCAGTCCACCGGG + Intronic
1083411079 11:62492786-62492808 GAGGACTGCCTGAGTCCAGGAGG + Intronic
1083586541 11:63863860-63863882 CAGGACTGTGTGAGTCCAGGAGG - Intronic
1083783548 11:64930961-64930983 GAGGACTGCTTGAGCCCAGCAGG - Intronic
1084626497 11:70311931-70311953 GAGGACTGCTTGAGTCCAGGAGG - Intronic
1084627593 11:70320508-70320530 GAGGACTGCTTGAGCCCAGCAGG - Intronic
1085764650 11:79272142-79272164 CAGGACTGGTTGAGTCCCTCTGG - Intronic
1086312553 11:85550538-85550560 CATGAGTGCTTGAATCCACCAGG - Intronic
1086344553 11:85883005-85883027 GAGGACTGCATGAGCCCAGGAGG - Intronic
1089445205 11:118546399-118546421 GAGGACTGCTTGAGTCCAGCAGG + Intronic
1089447156 11:118562348-118562370 GAGGACTGCATGAGCCCAGGAGG + Intronic
1089753645 11:120669817-120669839 TAAGACTGCATGAGATCACCAGG - Intronic
1090239105 11:125169563-125169585 CAGGGCTGCATGACTCCAGTGGG + Intronic
1090942937 11:131404504-131404526 CAGGACTGGATGAGATCTCCCGG - Intronic
1091783251 12:3227289-3227311 CTGGGCTGAATGTGTCCACCAGG + Intronic
1093068565 12:14684810-14684832 CAGGCGTGCATGACTACACCTGG + Intronic
1093869955 12:24278619-24278641 GAGGACTGCTTGAGTCCAGGAGG + Intergenic
1096286138 12:50302228-50302250 GAGGACTGCTTGAGCCCAGCAGG - Intergenic
1096306639 12:50483693-50483715 GAGGATTGCCTGAGTCCAGCAGG - Intergenic
1096338353 12:50775167-50775189 GAGGATTGCTTGAGTCCCCCAGG - Intronic
1096358723 12:50965345-50965367 GAGGATTGCTTGAGCCCACCAGG - Intronic
1096496882 12:52043799-52043821 CAGGGCTCCCTGAGACCACCAGG + Intronic
1097047970 12:56201573-56201595 GAGGACTGCTTGAGCCCAGCAGG + Intergenic
1097505259 12:60459688-60459710 GAGGATTGCATGAGGCCACAAGG - Intergenic
1098229145 12:68354952-68354974 CAGGACTTCATGAGACATCCAGG + Intergenic
1100053571 12:90481472-90481494 CAGGTATGCATGAGTTCGCCTGG - Intergenic
1101625744 12:106439553-106439575 GAGGATTGCATGAGTCCAGGAGG + Intronic
1102134345 12:110560309-110560331 GAGGACTGCTTGAGTCCAGGAGG + Intronic
1102226198 12:111229922-111229944 GAGGACTGCATGAGCCCAGGAGG + Intronic
1103032669 12:117630003-117630025 CACTTCTGCATGAGTCCAGCAGG - Intronic
1103725662 12:122996315-122996337 CAGCACTTCCTGAGTCCATCTGG - Intronic
1103819446 12:123685813-123685835 AAGGACTGCTTGAGTCCAGGAGG - Intronic
1104640592 12:130464594-130464616 CAGCAATGCATGACTCCCCCAGG - Intronic
1104921895 12:132294949-132294971 CAGGATTGCTTGATCCCACCAGG + Intronic
1107496448 13:40930090-40930112 CAGGAATGCATCACTACACCTGG + Intergenic
1108625312 13:52222771-52222793 GAGGACTGCATGAGCCCAGGAGG + Intergenic
1108660746 13:52583645-52583667 GAGGACTGCATGAGCCCAGGAGG - Intergenic
1108670164 13:52678766-52678788 GAGGACTGCTTGAGTCCAGGAGG - Intronic
1108700391 13:52938806-52938828 CAGGAGTGCCTGAGTCTGCCAGG - Intergenic
1108985857 13:56586218-56586240 CAGTAATGCATGAATCCACAAGG - Intergenic
1112207318 13:97337515-97337537 CAGGAATGGATGAGACCACAAGG - Intronic
1113471763 13:110551985-110552007 GAGGACTGCTTGAGCCCACGAGG + Intronic
1113859568 13:113472509-113472531 CAGCACTCCATGAGTTCACGGGG + Intronic
1114299852 14:21365876-21365898 GAGGACTGCTTGAGCCCACGAGG + Intronic
1115002503 14:28439711-28439733 CAGGAGTGCATGACCACACCTGG + Intergenic
1116065399 14:39975563-39975585 CAGGACTGCTTGAGTCAATCTGG - Intergenic
1117780050 14:59222913-59222935 CAGAACTTCAGCAGTCCACCTGG - Intronic
1118067452 14:62207298-62207320 CAGGCCTGCTTGAGCCCAACTGG + Intergenic
1119398498 14:74346501-74346523 GAGGATTGCTTGAGTCCACAAGG - Intronic
1120644019 14:87050641-87050663 CAGGACTTTATAACTCCACCTGG - Intergenic
1120922435 14:89767160-89767182 CTCCACTGCTTGAGTCCACCAGG - Intergenic
1121060038 14:90898653-90898675 TAGGACTGCATCACCCCACCTGG + Intronic
1121427810 14:93865193-93865215 CAGGACTAGATGAGGTCACCTGG - Intergenic
1121613179 14:95294882-95294904 CAGGGCTGCATTCTTCCACCTGG + Intronic
1122250227 14:100433693-100433715 TAGGAGTCCATGAGTCCACATGG - Intronic
1122399320 14:101457967-101457989 CAGGCCTGCGTGTGTGCACCTGG - Intergenic
1124819908 15:33034485-33034507 AAGGACTGCTTGAGCCCAGCAGG + Intronic
1126045198 15:44633239-44633261 GAGGACTGCTTGAGTCCAGGAGG + Intronic
1128130729 15:65225462-65225484 CAGGCCTGCCTGAGGCCTCCTGG + Intergenic
1129007567 15:72386884-72386906 CAGGATTGCTTGAGTCCAGGAGG - Intergenic
1129745248 15:78014658-78014680 GAGAACTGCTTGAGCCCACCAGG + Intronic
1129793315 15:78356939-78356961 GAGGACTGCATGAGCCCAGGAGG - Intergenic
1129808850 15:78489603-78489625 CAGGATTGCTTGAGTCCAGGAGG - Intronic
1129969918 15:79769190-79769212 CAGGGCCGCCTGATTCCACCGGG + Intergenic
1130068530 15:80627164-80627186 GAGGATTGCTTGAGTCCAGCAGG - Intergenic
1130549769 15:84882822-84882844 CAGGAGTGCTTAAGGCCACCAGG - Intergenic
1131593366 15:93772647-93772669 CAGGACTGGAAGGGTTCACCAGG + Intergenic
1132116374 15:99139002-99139024 CAGGGCTGCAGGAGGCCACAGGG + Intronic
1133335095 16:5001860-5001882 GAGGACTGCTTGAGCCCAGCAGG - Intronic
1134161355 16:11892417-11892439 GAGGACTGCCTGAGTCCATGAGG + Intronic
1134621673 16:15694162-15694184 CAGGCCTGGACGACTCCACCGGG + Exonic
1135512956 16:23103823-23103845 GAGGACTGCTTGAGCCCACAAGG + Intronic
1137750604 16:50858612-50858634 CAGGGCTGCCTGCGTCCCCCAGG + Intergenic
1138395427 16:56700760-56700782 CAGGACTGCTTGAGTCTGCGAGG + Intronic
1138461208 16:57148874-57148896 GAGGACTGCTTGAGCCCACAAGG - Intergenic
1138634740 16:58328717-58328739 GAGGATTGCTTGAGTCCACGAGG + Intronic
1139258957 16:65573755-65573777 CAGAACTGCAAGAGACCACTGGG + Intergenic
1139719297 16:68839969-68839991 GAGGAGTGCCTGAGTCCACGAGG - Intergenic
1139872885 16:70121852-70121874 AAGGACTGCTTGAATCCACGAGG - Intronic
1140362893 16:74359468-74359490 AAGGACTGCTTGAATCCACGAGG + Intergenic
1141817964 16:86425733-86425755 CAGGCCTGCACCAGTACACCTGG - Intergenic
1142236653 16:88925602-88925624 CAGGCCTGCCTGAGGCCACCTGG + Intronic
1142873213 17:2834705-2834727 GAGGACTGCTTGAGCCCACGAGG + Intronic
1143220177 17:5255058-5255080 CAGGACTGCAAGAGGCCCCAAGG + Intergenic
1143763927 17:9125149-9125171 GAGGACTGCTTGAGCCCACCTGG - Intronic
1144244913 17:13353231-13353253 GAGGACTGCAGCAGTCAACCGGG - Intergenic
1146927298 17:36753826-36753848 AATGAATGAATGAGTCCACCAGG - Intergenic
1148571552 17:48673928-48673950 CAGGATTGCTTGAGCCCACGAGG - Intergenic
1148675192 17:49440796-49440818 CAGGACTTCCTGAGTCCAGATGG - Intronic
1149753679 17:59169973-59169995 CAGGAATGAATGACTGCACCCGG - Intronic
1150042696 17:61880660-61880682 GAGGACTGCTTGAGCCCAGCAGG + Intronic
1150238046 17:63609066-63609088 AAGGACTGCTTGAGTCCAGGAGG - Intergenic
1151944397 17:77311567-77311589 CAGGAGTGCCTGGCTCCACCTGG + Intronic
1152178056 17:78800725-78800747 CAGGACTGCAAGAGCCCATGCGG + Intronic
1153925012 18:9827932-9827954 CTGGACTGCATCAGACCAACTGG - Intronic
1155607179 18:27620164-27620186 CAGGACTGCAGGACTTCACTGGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1158524733 18:58202476-58202498 CCTGACTGCATGAGTCACCCAGG - Intronic
1159307891 18:66669354-66669376 GAGGACTGCTTGAGTCCAGGAGG + Intergenic
1161941517 19:7407600-7407622 CCAGACTGCATGAGCCCAGCTGG + Intronic
1162263737 19:9552918-9552940 GAGGACTGCCTGAGCCCAGCAGG + Intergenic
1162842127 19:13364237-13364259 GAGTACTGGATGAGTCCTCCTGG - Intronic
1163227187 19:15971969-15971991 AAGGACTGCCTGAGTCCAGGAGG + Intergenic
1163401179 19:17093780-17093802 CAGGACTACTTGAGCCCAGCGGG - Intronic
1164552154 19:29220895-29220917 CAGGTCTGCCCAAGTCCACCAGG - Intergenic
1165014258 19:32869434-32869456 AAGGACTGCTTGAGGCCAGCCGG - Intronic
1165120750 19:33556918-33556940 CAGGTCCTCATGAGTCCAGCAGG + Intergenic
1165352802 19:35285405-35285427 CAGGGCTGCATGTGGCCTCCAGG - Intergenic
1165781978 19:38440200-38440222 CAGGATTGCTTGAGTCCAGGAGG + Intronic
1167345907 19:48945563-48945585 GAGGACTGCTTGAGTCCAGGAGG + Intergenic
1167711120 19:51111677-51111699 CAGGAGTGGATGAGCTCACCTGG - Intergenic
1168612915 19:57815180-57815202 CAGGACTGCTTGAGCCCAGGTGG + Intronic
925846909 2:8042997-8043019 CAGGAATGCATGACACCATCAGG + Intergenic
926089382 2:10040591-10040613 CAAAACTGCATGAGACCGCCGGG - Intergenic
926674322 2:15607674-15607696 GAGGACTGCTTGAGTCCAGGAGG - Intronic
927896847 2:26788239-26788261 GAGGACTGCATGAGCCCAGGAGG - Intronic
929794882 2:45051456-45051478 GATGACTGAATGAGTACACCTGG - Intergenic
931301402 2:60982157-60982179 CAGGACTGCCTGACTCCAGCAGG + Intronic
932088337 2:68782230-68782252 CAGGGCTGCATGTATCTACCAGG + Exonic
938763996 2:134448445-134448467 CAGGAAGGCATGTGTGCACCAGG - Intronic
938860128 2:135359491-135359513 GAGGACTGCTTGAGTCCAGAAGG + Intronic
940594149 2:155767937-155767959 CAGGATTGCTTGAGCCCAGCAGG + Intergenic
940884225 2:158974820-158974842 AAGGATTGCATGAGTCCAGGAGG - Intronic
944660289 2:201916103-201916125 CAGGGGTGCATGATTCCACAGGG + Intergenic
945015263 2:205508480-205508502 GAGGACTGCTTGAGTCCAGGAGG + Intronic
945410609 2:209501900-209501922 CAGGACAGCTTGAGCCCACCAGG + Intronic
947568731 2:231214138-231214160 CAGAGCTGTGTGAGTCCACCTGG - Intronic
947609771 2:231517251-231517273 GAGGACTGCTTGAGTCCAGGAGG - Intergenic
947768876 2:232655242-232655264 GAGGACTGCTTGAGCCCAGCAGG - Intronic
1170512116 20:17088173-17088195 CAAGACTCAATGAGTCCACAAGG - Intergenic
1173703665 20:45094766-45094788 CAGGACAGCATGAGTGATCCTGG + Exonic
1173756719 20:45523035-45523057 CGGGGTTGCATGAGTCCTCCTGG - Intergenic
1173996588 20:47343193-47343215 GAGGACTGCTTGAGTCCAGCAGG + Intronic
1174242224 20:49146174-49146196 AAGGACTGCTTGAGTCCAGGAGG + Intronic
1176083534 20:63285573-63285595 CAGGAGTGCAGGAATCCCCCGGG - Intronic
1176953577 21:15073826-15073848 TAGGACTGGATTAGTCCTCCTGG - Intergenic
1177791910 21:25731472-25731494 GAGGATTGCATGAGTCCAGGAGG - Intronic
1177879309 21:26673258-26673280 CAGGAGTGCATGACTACACCTGG + Intergenic
1178937572 21:36876215-36876237 CAGGGCTGAATGAGCCCAGCAGG + Intronic
1178989984 21:37344993-37345015 GAGGACTGCTTGAGCCCAACAGG - Intergenic
1179025371 21:37675024-37675046 CAGGACTGCATGAGTCCACCTGG - Intronic
1179099920 21:38347421-38347443 GGGGACAGCATGAGTCCACTGGG + Intergenic
1179622115 21:42623871-42623893 CTGGATTGCATGAGGGCACCGGG - Intergenic
1183365709 22:37405714-37405736 CAGGGCTGCATGAGACTACCTGG + Intronic
1183945118 22:41321137-41321159 CAGGATTGCTTGAGTCCAGGAGG - Intronic
1184162073 22:42702813-42702835 CAGGACCGCCTGACTCCACCAGG - Intronic
1184423910 22:44397808-44397830 CAGGAATGAATGAGTCCTCCTGG - Intergenic
1184501182 22:44873259-44873281 GAGGACTGCTTGAGTCCAGGAGG + Intergenic
1184564092 22:45281230-45281252 CAGGATTGCTTGAGTCCAGGAGG + Intergenic
1184745263 22:46452392-46452414 CAGGACTTCCCGAGTCCACTCGG - Intronic
1185026773 22:48418699-48418721 CAGCACGTCATGAGTCCTCCAGG + Intergenic
1185304360 22:50104979-50105001 GAGGACTGCTTGAGCCCACGAGG - Intronic
949335520 3:2970534-2970556 CAGGATTGCTTGAGCCCAGCAGG - Intronic
950217273 3:11168559-11168581 CGGCAGTGCCTGAGTCCACCGGG - Intronic
950527875 3:13535240-13535262 CAGGACAGCGTGTGTCCTCCAGG - Intergenic
950573072 3:13814032-13814054 CATGAGTGCATGGGTGCACCGGG - Intergenic
951653738 3:24981657-24981679 CAGGAGTGCATGGCTCTACCAGG + Intergenic
955264185 3:57425491-57425513 GAGGACTGCCTGAGTCCAGAAGG - Intronic
956178165 3:66493704-66493726 GAGGACTGCTTGAGCCCACGAGG + Intronic
956442282 3:69292287-69292309 AAAGAATGCATGAGTTCACCAGG + Intronic
956445578 3:69322684-69322706 GAGGACTGCTTGAGCCCAGCAGG - Intronic
956536560 3:70283245-70283267 GAGGACTGCATGAGTTTACAAGG - Intergenic
956821358 3:72957226-72957248 CAGAACAGCATGATTCCAACAGG + Exonic
957220499 3:77376295-77376317 CAGGCCTGCACCAGTACACCTGG + Intronic
960170597 3:114455960-114455982 TAGGACTCCAGGAGCCCACCAGG + Intronic
960704532 3:120469274-120469296 AAGGACTGCTTGAGTCCAGAAGG - Intergenic
961034156 3:123630694-123630716 CAGAACTGCATGAGATCTCCGGG - Intronic
961670632 3:128526325-128526347 GAGGACTGCATGAGCCCAGGAGG + Intergenic
964861224 3:161203935-161203957 GAGGACTGCTTGAGTCCAGGAGG - Intronic
965003808 3:162990227-162990249 CAGGAGTGGATGAGCTCACCTGG + Intergenic
968148527 3:196319360-196319382 GAGGACTGCTTGAGTCCAAGAGG - Intronic
971204044 4:24545019-24545041 GAGGACTGCTTGAGTCCAGGAGG + Intronic
972768120 4:42170364-42170386 GAGGACTGCTTGAGCCCACGAGG + Intergenic
974049189 4:56924545-56924567 CAGGACTGCCTGAGCCCAAGAGG - Intronic
974535931 4:63175069-63175091 CAGGCATGCATCACTCCACCTGG - Intergenic
975130687 4:70829713-70829735 CAGGACTGCTTGAGCCCAGAAGG + Intronic
975314689 4:72938095-72938117 GAGGACTGCTTGAGTCCAAGAGG + Intergenic
976628478 4:87212350-87212372 GAGGACTGCTTGAGCCTACCAGG + Intronic
979333714 4:119444750-119444772 CAGGCCTGCATCACTGCACCCGG - Intergenic
979694433 4:123596581-123596603 CAGGTCTGTATTATTCCACCAGG + Intergenic
980047721 4:128007227-128007249 GAGGACTGCTTGAGCCCAGCAGG + Intronic
981905239 4:149915238-149915260 CAGGACGGCATGAGAACACTGGG - Intergenic
982098933 4:151949645-151949667 CAGGACTGCAGGTGGCCTCCAGG + Intergenic
984162006 4:176264410-176264432 CAGGACTGTTTTAGTCCATCTGG - Intronic
985419181 4:189766053-189766075 CAGGACTACATGAGGCTCCCAGG - Intergenic
985936646 5:3102623-3102645 CAAGACAGCCTGAGTTCACCCGG + Intergenic
987092820 5:14522868-14522890 CAGGACTGAAGGAGTCCAGGTGG - Intronic
989149767 5:38287459-38287481 AAGGACTGCTTGAGTCCAGGAGG - Intronic
990000965 5:50892250-50892272 GAGGACTGCTTGAGTCCAGGAGG - Intergenic
992408780 5:76484738-76484760 GAGGACTGCTTGAGTCCAGGAGG - Intronic
993660169 5:90623499-90623521 GAGGACTGCATGAGCCCAGGAGG - Intronic
997486702 5:134236983-134237005 GAGGATTGCTTGAGTCCAGCAGG + Intergenic
997923425 5:138004785-138004807 CAGGACTGCTTGAGCCCAAGAGG + Intronic
999908351 5:156168483-156168505 GAGGACTGCTTGAGCCCAGCAGG + Intronic
1001311538 5:170614372-170614394 CTGGAATGCATGTGTCCTCCTGG - Intronic
1001929779 5:175664722-175664744 GAGGACTGCTTGAGCCCAGCAGG - Intronic
1002430624 5:179201974-179201996 GAGCACTTCATGAGGCCACCTGG - Intronic
1003481463 6:6537460-6537482 GAGGACTGCTTGAGTCCAGAAGG + Intergenic
1005000141 6:21232094-21232116 GAGGACTGCTTGAGTCCAGGAGG - Exonic
1006078652 6:31551114-31551136 GAGGACTGCTTGAGCCCACGAGG - Intronic
1006275945 6:33005803-33005825 CAGGACTGCTTGAGGCCAAGAGG - Exonic
1006371513 6:33647111-33647133 CAGGATTGCTTGAGTCCAGGAGG - Intronic
1006760720 6:36458140-36458162 GAGGACTGCTTGAGTCCAGAAGG - Intronic
1007597032 6:43057485-43057507 CAGGACTGCACCATTACACCTGG + Intronic
1007648411 6:43400506-43400528 GAGGACTGCTTGAGTCCAGGAGG - Intergenic
1010424114 6:75707451-75707473 GAGGACTGCTTGAGTCCAGGAGG - Intronic
1011710180 6:90045003-90045025 CAAGACTGGATGAGATCACCAGG + Intronic
1011761376 6:90569568-90569590 TAGGATTGCATGAGTCCAGGAGG - Intronic
1013096031 6:106945507-106945529 GAGGACTGCATGAGCCCAGGGGG + Intergenic
1013478437 6:110530894-110530916 GATGACTGGATGACTCCACCTGG - Intergenic
1013780366 6:113722096-113722118 GAGGACTGCTTGAGTCCAGGAGG - Intergenic
1016512688 6:144861184-144861206 CAGGAGTGTATGTGTCCATCTGG - Intergenic
1018997251 6:168719299-168719321 CAAACCCGCATGAGTCCACCAGG + Intergenic
1019163330 6:170083349-170083371 CAGGTCTGTAGGTGTCCACCGGG - Intergenic
1019700119 7:2470758-2470780 CAGGGCTGCAAGAGCCCAGCAGG + Intergenic
1019700574 7:2473135-2473157 CAGGACTGCTTGAGCCCAGGAGG - Intergenic
1021996460 7:26182881-26182903 GAGGACTGCCTGAGTCCAGGAGG - Intronic
1022067815 7:26878082-26878104 GAGGACTGCTTGAGTCCAGGTGG + Intronic
1022850425 7:34256015-34256037 CAGGTCTGCAGGTGTCCTCCAGG + Intergenic
1023309004 7:38863774-38863796 CAGGCCTGCCTGAATGCACCAGG + Intronic
1023898171 7:44452344-44452366 GAGGACTGCTTGAGGCCAGCAGG + Intronic
1025144850 7:56494016-56494038 CAGGGCACCATGAGTCCTCCTGG - Intergenic
1025260436 7:57414471-57414493 CAGGGCACCATGAGTCCTCCTGG - Intergenic
1025833927 7:65078276-65078298 GAGGACTGCTTGAGCCCACGGGG + Intergenic
1025936652 7:66043380-66043402 CAGGATTGCTTGAGTCCAGAAGG + Intergenic
1026648759 7:72196205-72196227 GAGAACTGCTTGAGTCCACGAGG - Intronic
1029311356 7:99668396-99668418 CTGGACTGCATGAGGCCTGCAGG - Intronic
1029469330 7:100744247-100744269 CAGGAGTGCAGGAGTCCAAGTGG - Intronic
1029726717 7:102411016-102411038 GAGGATTGCTTGAGCCCACCAGG - Intronic
1034874030 7:154709267-154709289 GAGGATTGCTTGAGTCCAGCAGG - Intronic
1036043974 8:5119339-5119361 TAGGACTGCAGGTGTGCACCTGG + Intergenic
1036638216 8:10565634-10565656 CATGTCCCCATGAGTCCACCTGG + Intergenic
1037700150 8:21266654-21266676 CAGGAAGGCCTGAGACCACCAGG + Intergenic
1037872893 8:22516026-22516048 GAGGACTGCTTGAGTCCAGAAGG - Intronic
1038884659 8:31650066-31650088 GAGGACTGCTTGAGTCCATGAGG - Intronic
1039752826 8:40493895-40493917 CAGGACTGCATCAGGTTACCAGG + Intergenic
1041425256 8:57713646-57713668 CAAGACTGCAACAGTCCACTTGG - Intergenic
1042538952 8:69888231-69888253 AAGGATTGCTTGAGTCCAGCAGG + Intergenic
1042609225 8:70578541-70578563 GAGGACTGCTTGAGCCCACAAGG + Intronic
1043429132 8:80177573-80177595 GAGGACTGCATGAGCCCAGGAGG - Intronic
1045226029 8:100246488-100246510 AAGGACTGCTTGAGTCCAGGAGG - Intronic
1045268122 8:100638025-100638047 CAGGTGTGCATGACTGCACCTGG - Intronic
1045392226 8:101726782-101726804 AAGGACTGAATGAGTGCACCAGG + Intronic
1048306159 8:133286078-133286100 TAGGACTGCTTGAACCCACCTGG - Intronic
1048581376 8:135732097-135732119 CAGGACTGCCTGCAGCCACCAGG - Intergenic
1049504197 8:142986086-142986108 CAGGGCTGCATGAGGCACCCGGG - Intergenic
1050000407 9:1071567-1071589 GAGGACTGCTTGAGTCCAGGAGG + Intergenic
1051383836 9:16485717-16485739 GAGGACTGCTTGAGCCCACGAGG + Intronic
1051949523 9:22614691-22614713 CAGCACTGCATGAGTCTAGGAGG - Intergenic
1052490287 9:29158264-29158286 GAGGACTGCATGAGCCCAGGAGG + Intergenic
1053254503 9:36604527-36604549 AAGGACTGCTTGAGTCCAACAGG + Intronic
1053330932 9:37206439-37206461 GAGGATTGCTTGAGTCCAGCAGG - Intronic
1055219513 9:73911263-73911285 GAGGACTGCTTGAGTCCAGGAGG + Intergenic
1056359157 9:85836090-85836112 GAGGACTGCTTGAGCCCACGAGG - Intergenic
1057129931 9:92647800-92647822 GTGGACTGCATGAGTCCAGGAGG + Intronic
1057610667 9:96540712-96540734 CCTGCCTGCATGAGCCCACCTGG + Intronic
1061171921 9:128962690-128962712 GAGGACTGCTTGAGCCCAGCCGG - Intronic
1185968667 X:4636656-4636678 CAGGACTGCTTGAGCCCAGGAGG + Intergenic
1186576050 X:10766817-10766839 GAGGACTGCTTGAGCCCAGCAGG + Intronic
1187577074 X:20568513-20568535 TAGCACTGCATGAGCCCATCAGG + Intergenic
1191637773 X:63396187-63396209 TAGGATTGCATGAGCCCACTAGG - Intergenic
1191984080 X:66959783-66959805 GGGGACTCCAAGAGTCCACCTGG + Intergenic
1192492591 X:71589375-71589397 GAGGACTGCATGAGCCCAGGAGG - Intronic
1193320759 X:80118605-80118627 GAGGATTGCTTGAGTCCAGCGGG + Intergenic
1196345301 X:114648636-114648658 GAGGACTGCTTGAGCCCAACAGG + Intronic
1197053916 X:122094307-122094329 CAGGACCCCATGAGCCCACTTGG - Intergenic
1199138082 X:144277323-144277345 TAGGTCTGCATGACTCCACAGGG - Intergenic
1199233077 X:145461895-145461917 CATGACTGCATGAATCCAGGAGG + Intergenic
1201334906 Y:12870115-12870137 GAGGACTGCTTGAGTCCAGGAGG - Intergenic