ID: 1179030401

View in Genome Browser
Species Human (GRCh38)
Location 21:37714975-37714997
Sequence CAGAGGTACGTGAGGAAAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179030401_1179030409 16 Left 1179030401 21:37714975-37714997 CCGTCTTTCCTCACGTACCTCTG 0: 1
1: 0
2: 1
3: 18
4: 252
Right 1179030409 21:37715014-37715036 CGATCTCGGCTGATGTGTCTTGG 0: 1
1: 0
2: 0
3: 1
4: 36
1179030401_1179030411 30 Left 1179030401 21:37714975-37714997 CCGTCTTTCCTCACGTACCTCTG 0: 1
1: 0
2: 1
3: 18
4: 252
Right 1179030411 21:37715028-37715050 GTGTCTTGGCAGGTCATCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 95
1179030401_1179030406 2 Left 1179030401 21:37714975-37714997 CCGTCTTTCCTCACGTACCTCTG 0: 1
1: 0
2: 1
3: 18
4: 252
Right 1179030406 21:37715000-37715022 TTTTCCTTTTGGTCCGATCTCGG 0: 1
1: 0
2: 1
3: 17
4: 202
1179030401_1179030404 -9 Left 1179030401 21:37714975-37714997 CCGTCTTTCCTCACGTACCTCTG 0: 1
1: 0
2: 1
3: 18
4: 252
Right 1179030404 21:37714989-37715011 GTACCTCTGGATTTTCCTTTTGG 0: 1
1: 0
2: 1
3: 13
4: 207
1179030401_1179030410 20 Left 1179030401 21:37714975-37714997 CCGTCTTTCCTCACGTACCTCTG 0: 1
1: 0
2: 1
3: 18
4: 252
Right 1179030410 21:37715018-37715040 CTCGGCTGATGTGTCTTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179030401 Original CRISPR CAGAGGTACGTGAGGAAAGA CGG (reversed) Exonic
901916116 1:12501991-12502013 CAGCAGCACGTGTGGAAAGAAGG + Intronic
902075406 1:13780758-13780780 AAGAGGTACGGTAGGAAGGAGGG - Exonic
902589761 1:17465396-17465418 CAGAGGTAAGTGACTCAAGAGGG + Intergenic
903773776 1:25780331-25780353 CAGAGGGAGCTGAGGAAGGAGGG - Intronic
904390824 1:30184659-30184681 AAGAGGAAAGAGAGGAAAGATGG - Intergenic
908180503 1:61599640-61599662 CAGAGGAAAGTAAGGAAACAGGG + Intergenic
909444724 1:75735775-75735797 CAGAGGTTGCTGAGTAAAGATGG + Intronic
909600147 1:77453094-77453116 CAGAGGAATGTGACTAAAGAGGG - Intronic
910718957 1:90264125-90264147 CAGAGCTATCTGAGGAACGAGGG + Intergenic
912185630 1:107272529-107272551 CACAGGTACGTGGCGCAAGATGG + Intronic
912230583 1:107788069-107788091 CAGAGGCATGGGAGGAGAGAAGG - Intronic
912842399 1:113050703-113050725 CAGAGGAGCATGAGGAATGATGG + Intergenic
913531521 1:119737302-119737324 CAGAGGGAGGAGAGGAAGGAAGG + Intronic
915535728 1:156534271-156534293 CAGAGGTAGGGCAGGACAGAGGG - Intronic
915962408 1:160278303-160278325 CAAGGGAACATGAGGAAAGATGG + Exonic
916608823 1:166369750-166369772 GAAAGGAAAGTGAGGAAAGAGGG - Intergenic
917406737 1:174714784-174714806 AAGAGGTAGGTCAGGAAAGAGGG - Intronic
917491104 1:175499444-175499466 CAGAGGTACGTGGGAAACAAAGG - Intronic
917655246 1:177119593-177119615 GAGAGGTTTGAGAGGAAAGAAGG - Intronic
920855431 1:209657583-209657605 CAGAGGAATGTCAGGAAATATGG - Intergenic
921384648 1:214556426-214556448 CAGAAGAACGTGAAAAAAGAAGG - Intergenic
922723242 1:227909686-227909708 AAGAGGTAAGGGAGGAAGGAGGG + Intergenic
923935932 1:238760218-238760240 CAGAAATACCTGAGGAAAAAAGG - Intergenic
924444488 1:244116626-244116648 CAGAGGGAGGTGAGGAACAAAGG - Intergenic
1063069578 10:2647921-2647943 CAGAGGTGAATGAGGACAGAAGG - Intergenic
1063308842 10:4933817-4933839 CAGAGGAAAAGGAGGAAAGACGG - Intronic
1064870460 10:19931287-19931309 CAGAGGTGAGAGTGGAAAGAAGG - Intronic
1064986178 10:21212442-21212464 CAGAGTGATGGGAGGAAAGAAGG + Intergenic
1065134987 10:22659084-22659106 CAGAGGGACCTGAGGCCAGAGGG - Intronic
1065366677 10:24944067-24944089 CAGAGGTAGAGGAGGAAAGGGGG - Intronic
1065627405 10:27645804-27645826 CAGATGCACGTGAAGAATGATGG + Intergenic
1067784158 10:49230266-49230288 CAGGGGCCCGGGAGGAAAGATGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069792996 10:71035250-71035272 TAGAGGTATGTAAGGAAAGGTGG + Intergenic
1070279395 10:75037794-75037816 CAGAGGCACTTGGGGACAGAGGG - Intergenic
1070395952 10:76011409-76011431 CAGAGGTACGGGAGACGAGATGG - Intronic
1071224806 10:83516390-83516412 CAGAGGAACATGAGGACAGGTGG + Intergenic
1071736945 10:88311574-88311596 AAGAGGCAGGTGAAGAAAGAAGG - Intronic
1072562576 10:96589757-96589779 CAGCAGTAGGTGTGGAAAGAAGG + Intergenic
1072571905 10:96665752-96665774 CAGAGGTTACTGAGGAAAGAAGG + Intronic
1074270469 10:111948704-111948726 CAGAGGTGCATGAGGAAATTTGG + Intergenic
1074665024 10:115712375-115712397 CAGTGGTATCTAAGGAAAGAAGG + Intronic
1075643692 10:124084077-124084099 CAGAGCTAGGGAAGGAAAGACGG + Intronic
1080005903 11:27406095-27406117 CAGAGGAGCATGAGCAAAGATGG - Intronic
1080749310 11:35138363-35138385 CAGAAGGACATAAGGAAAGATGG + Intergenic
1081554529 11:44146129-44146151 CAGAGGTGCGTGAATACAGAGGG - Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1081857543 11:46313095-46313117 CAGGTGTAGGTGAGGAAAAATGG - Intronic
1082809618 11:57471547-57471569 CACAGGCAGGTGAGGAAACATGG + Intronic
1083144869 11:60750583-60750605 CAGTGGGACGTGCGGAAAGCAGG - Intergenic
1083344295 11:61978763-61978785 CAGAGAAGCATGAGGAAAGAAGG - Intergenic
1086400752 11:86459374-86459396 CACAGATACGGGAGGGAAGAAGG - Intronic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1087527137 11:99330098-99330120 AAGAAGTACATCAGGAAAGAAGG + Intronic
1089518507 11:119048696-119048718 CAGAAGTAAGTGAGGACAGCTGG - Exonic
1091027801 11:132157743-132157765 CAGAGGATGGTCAGGAAAGAAGG - Intronic
1091857997 12:3754263-3754285 CAGCCTTATGTGAGGAAAGAAGG + Intronic
1092258133 12:6938103-6938125 CAGAGGGAAGGAAGGAAAGAGGG - Intronic
1092784019 12:12011676-12011698 CAGAGGTAGGTGAGGAGCTAGGG - Intergenic
1094601238 12:31910887-31910909 AAGAGGTAACTGAGGCAAGATGG + Intergenic
1095413713 12:41952522-41952544 CAGAAGTATGTGAGCAAAGATGG - Intergenic
1095873776 12:47058046-47058068 GAGAGCTACGTGATGAAAGCAGG + Intergenic
1096842968 12:54390498-54390520 AAGAAGGAAGTGAGGAAAGAGGG + Intronic
1096953072 12:55495742-55495764 CAGAGGTCCATGAGGCAATAAGG - Intergenic
1097155894 12:57012166-57012188 CAGAGGAAAGAGATGAAAGACGG + Exonic
1097585813 12:61514868-61514890 CAGAGGTACAGGGGGAAAGTAGG + Intergenic
1098981008 12:76955680-76955702 GAGAGATAAGTGAGTAAAGAAGG - Intergenic
1102079728 12:110088039-110088061 CAGAGGAAAGGAAGGAAAGAAGG + Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1105069555 12:133226419-133226441 CAGAGGAACGTGAGGAAAAGGGG - Exonic
1110573853 13:77034457-77034479 GAGAGGAACGTGAGGAGAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113415697 13:110126787-110126809 CAGAGGAACGTGAGGAGAGCTGG - Intergenic
1113859651 13:113472975-113472997 CAGAGGCACGGGGGGACAGAAGG - Intronic
1117654316 14:57939040-57939062 CAGAGGTAGCTGAGCAAAGTGGG + Intronic
1118810164 14:69267303-69267325 CAGAGGTACTTTGGGAAAGAGGG + Intronic
1118848555 14:69567044-69567066 CAGAGGAACATGAGGAAACTTGG - Intergenic
1119227507 14:72955509-72955531 CAGAGGAGCCTGTGGAAAGAGGG - Exonic
1119919431 14:78432672-78432694 AAGAGGAAGGTGAGGGAAGAAGG - Intronic
1120163443 14:81169896-81169918 CAGAAATACGTGAGGAGAGTGGG - Intergenic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1120281729 14:82447294-82447316 CAAAGATACCTGAGGCAAGAGGG + Intergenic
1122172457 14:99888528-99888550 CAGAAGGAGGTGAGGACAGAAGG - Intronic
1126323057 15:47446088-47446110 CAGAGGTGGGTGAAGAATGAAGG - Intronic
1130664260 15:85855959-85855981 CAGAAGCAAGAGAGGAAAGAGGG - Intergenic
1131646635 15:94351983-94352005 CAGAGGAAACTGAGGAAGGATGG - Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1133095274 16:3440842-3440864 CAGAGGTCCCTCAGCAAAGATGG - Exonic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1137500932 16:49011149-49011171 CAGAGGTTGGTGGGGGAAGAGGG + Intergenic
1137536698 16:49332702-49332724 CAGAGATTCCTGAGGAAGGAGGG + Intergenic
1137772097 16:51024590-51024612 CCGGGGTACCTGAGGAAAGCAGG + Intergenic
1139500238 16:67357512-67357534 GAGAGGAAGGGGAGGAAAGAGGG + Intronic
1140015742 16:71182165-71182187 AAGAGGTCCGTGAGGAAGGCAGG + Intronic
1141309798 16:82902593-82902615 AAGAAGCACGTGAGAAAAGAGGG - Intronic
1141345289 16:83239327-83239349 CAAGGGTGCGTGAGGAGAGAGGG + Intronic
1141389067 16:83649394-83649416 CAGTGGGAGGTGAGGAAATACGG + Intronic
1142900728 17:3009819-3009841 AAGAGGAACGGGAGGAGAGAGGG + Intronic
1144410259 17:14993957-14993979 CAGAGGTTCTTGGGGAAGGATGG - Intergenic
1148470740 17:47891625-47891647 CACAGGAAAGTGAAGAAAGAAGG + Intergenic
1150136135 17:62696353-62696375 CAGAGAGACGTGAGGAGAGCAGG - Intergenic
1150864590 17:68836297-68836319 CAGAGGTATGGGAGGGTAGAGGG + Intergenic
1151095424 17:71492175-71492197 CTGAGGTAAGAGAGGAGAGAAGG + Intergenic
1151514621 17:74584815-74584837 GACAGGAACGTGAGCAAAGAAGG + Intronic
1152185276 17:78852386-78852408 CAGAGGTATGTGTTGAATGAAGG + Intergenic
1152639561 17:81443979-81444001 CAGAGCCACGTGGAGAAAGAGGG + Intronic
1153342101 18:3986061-3986083 CAGAGGTGTGTGGGGAGAGATGG - Intronic
1155582137 18:27321557-27321579 CAAAGGAAAGTGTGGAAAGATGG - Intergenic
1158024353 18:52878101-52878123 GAGAGGAACGTTAGGAAATATGG - Intronic
1158619640 18:59021555-59021577 CAGCTGTGGGTGAGGAAAGATGG - Intergenic
1159246140 18:65807883-65807905 AAGGGGAACTTGAGGAAAGAAGG - Intronic
1162111188 19:8400547-8400569 CAGATGTACCTGAGGGATGAAGG - Intronic
1165344864 19:35238762-35238784 GAGAGGTAGGTGAGAAGAGAAGG + Intergenic
1166251899 19:41577031-41577053 CAGAGGTACTGAAGGAATGAGGG + Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1167686394 19:50959433-50959455 CAGAGGTACTTACTGAAAGATGG + Intronic
925122282 2:1428548-1428570 AAGGGGTACGTCAGGAAAGCAGG - Intronic
926648093 2:15311962-15311984 TGGAGGGACTTGAGGAAAGAGGG - Intronic
927046469 2:19283894-19283916 CATAGATATGTCAGGAAAGAAGG + Intergenic
929411913 2:41706616-41706638 GAGAGCTCCTTGAGGAAAGAAGG + Intergenic
929585723 2:43113078-43113100 GAAAGGTACAGGAGGAAAGAGGG + Intergenic
930032106 2:47064647-47064669 AAGAGGTACCTGAGGAAACCAGG + Intronic
930488430 2:52038223-52038245 CACAGGTAGGTGAGAAAAAATGG - Intergenic
930873633 2:56190825-56190847 CTGGGGTAGGGGAGGAAAGAAGG - Intronic
932764746 2:74462487-74462509 AAGAGGTACGGGTGGAAAGAGGG + Exonic
935673779 2:105576894-105576916 CTGAGGCCAGTGAGGAAAGAAGG + Intergenic
935684922 2:105674697-105674719 GCGAGGCAAGTGAGGAAAGAGGG + Intergenic
935782012 2:106516401-106516423 CAGGGGTACATCGGGAAAGAAGG - Intergenic
936233558 2:110724896-110724918 CAGAGGGAGGGAAGGAAAGAAGG + Intergenic
936233632 2:110725181-110725203 CAGAGGGATGGAAGGAAAGAAGG + Intergenic
936495373 2:113015855-113015877 CAGAGATACTCAAGGAAAGAAGG - Intergenic
937006562 2:118521699-118521721 GAGAGGGAGGTGAGGAAAGTAGG + Intergenic
937352179 2:121173111-121173133 CAGAAGTACGGGAAGTAAGAGGG + Intergenic
939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG + Intronic
941377221 2:164746728-164746750 CGGAGGTAAGGGAGGAAGGAAGG - Intronic
941901829 2:170686316-170686338 AAGAGGGAGGGGAGGAAAGAAGG + Intergenic
942042003 2:172076025-172076047 CAGAGGAACGAGAGGTATGATGG + Intronic
942513543 2:176728113-176728135 TAGAGGTAGGGGAGAAAAGAAGG - Intergenic
943450685 2:188039125-188039147 CACAGGGACGTGAGTAAAAATGG + Intergenic
943748054 2:191482911-191482933 CTGAGCTACAAGAGGAAAGATGG + Intergenic
944867933 2:203880675-203880697 CAGAAGCACATGACGAAAGAGGG + Intergenic
945097647 2:206234696-206234718 CAGAGTTATGAGAGTAAAGAAGG - Intergenic
945936555 2:215908069-215908091 CCCAGGTATGAGAGGAAAGAAGG - Intergenic
947192541 2:227522703-227522725 ATGAAGTAGGTGAGGAAAGAAGG - Intronic
947395165 2:229679313-229679335 AAAAGGTATGTAAGGAAAGAAGG + Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948197844 2:236108353-236108375 CAGAGGAAGGAGAGAAAAGAGGG - Intronic
948991335 2:241555993-241556015 CAGAGGTACTTCAGGAACCATGG + Intergenic
1169340947 20:4795797-4795819 CAGGGGTGAGTGAGGAGAGACGG - Exonic
1170888855 20:20363301-20363323 GAGAGGGACGAGAGGAGAGAGGG + Intergenic
1173190559 20:40872554-40872576 CAGAAGGACATGAGGAAAGGTGG - Intergenic
1173648579 20:44649045-44649067 CAGAGGTAGTTTAGGAAAGATGG + Intronic
1175342148 20:58239624-58239646 CAGAGGCACGTGCAGAAAGAGGG - Intergenic
1175440111 20:58984441-58984463 CAGAGGCAAATGTGGAAAGAAGG + Intronic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1176365350 21:6029570-6029592 CAGGGGTATGTGGGGAAAGTAGG - Intergenic
1177649702 21:23944901-23944923 AAGAGGGAGGTGGGGAAAGAGGG - Intergenic
1178978934 21:37244792-37244814 CAGGGGGACGTGATGAAAAACGG + Intronic
1179030401 21:37714975-37714997 CAGAGGTACGTGAGGAAAGACGG - Exonic
1179758168 21:43508975-43508997 CAGGGGTACGTGGGGAAAGTAGG + Intergenic
1181877657 22:25952617-25952639 GAGACATACGTGAGGATAGATGG - Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1184309094 22:43629631-43629653 ATGAGGGACGTGAGGAGAGAGGG + Intronic
953041358 3:39257553-39257575 CAGAGGTTAGGGAGGCAAGAAGG + Intergenic
954156577 3:48688279-48688301 CAGAGATAAGTGAGGAGAGTGGG - Exonic
955415752 3:58689473-58689495 AAGAAGCAAGTGAGGAAAGAAGG - Intergenic
958468733 3:94491741-94491763 AAGAGGTACGTGATGGAAGAAGG + Intergenic
958760619 3:98303399-98303421 CAGAGGTTGGTGAGGATAGTAGG + Intergenic
958797414 3:98720495-98720517 CCTAGGTACATCAGGAAAGATGG - Intergenic
960288955 3:115861073-115861095 GAGAGGGAGGGGAGGAAAGAGGG - Intronic
961470811 3:127110380-127110402 CAGAGATGGGTGAGGGAAGAAGG + Intergenic
961522728 3:127476632-127476654 AAGAGGCAAGTGAGGAAGGAAGG + Intergenic
962302571 3:134255596-134255618 GAAAGGTATGTGAAGAAAGAGGG - Intergenic
962552376 3:136508113-136508135 TAGAGGAACGTGAGGGAACAAGG + Intronic
962993629 3:140603219-140603241 CAGAGTACTGTGAGGAAAGAGGG - Intergenic
963141933 3:141953432-141953454 CAGAAATACATGAGGTAAGAAGG + Intronic
963238748 3:142982117-142982139 CAGGGGTACATGAAGACAGACGG + Intronic
964242600 3:154614584-154614606 CAGAGGAAAGTGACGAATGATGG - Intergenic
964672164 3:159238631-159238653 CAGAGGTTGCTGAGGAAGGAGGG + Intronic
966270385 3:178097755-178097777 CAAAGGGAAGTGGGGAAAGAAGG - Intergenic
969547562 4:7841463-7841485 CAGAGCTACCTGAGCACAGAAGG + Intronic
970589923 4:17550628-17550650 GAGAGGGAGGAGAGGAAAGAAGG + Intergenic
970914994 4:21322027-21322049 CAGAGGCAGGGGAGGAAGGAAGG + Intronic
971131709 4:23818249-23818271 CAGATTTATGTGAGGACAGATGG + Intronic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
975144488 4:70952724-70952746 CTGAGGTAGGTGGGGTAAGAGGG + Intronic
979001406 4:115225508-115225530 TAGAGATATTTGAGGAAAGATGG + Intergenic
979994353 4:127412543-127412565 CAGAGGGAGGTGGGGAAGGAGGG + Intergenic
980070949 4:128242577-128242599 CAGAGGTAGGTGAGCATAGCAGG + Intergenic
980198270 4:129620235-129620257 CAATGGAACGTGAGCAAAGATGG + Intergenic
980710181 4:136556184-136556206 CAGAGGACCCTGGGGAAAGAAGG - Intergenic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
984287389 4:177749569-177749591 CAGAGGTGGGTGAGGGTAGAGGG - Intronic
987683778 5:21170275-21170297 CAGAGGTACTTAAGGAAAGCAGG + Intergenic
989362348 5:40617040-40617062 CAGAGTTATATAAGGAAAGATGG - Intergenic
989795583 5:45467296-45467318 CAGAGGGCAGTGAGGAAATAAGG - Intronic
991135570 5:63178011-63178033 CTAAGCTATGTGAGGAAAGAGGG - Intergenic
992250079 5:74867098-74867120 GAGAGGCACGGGAGGAAAGCCGG - Intergenic
994829752 5:104764661-104764683 CAACGGTAAGTGAGAAAAGATGG + Intergenic
995353935 5:111215353-111215375 AAGATGTCTGTGAGGAAAGATGG - Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
1000975453 5:167759581-167759603 CAGAGGGACGTGAGGAGAGATGG + Intronic
1004003850 6:11621424-11621446 CAGAGGGACATGGGGAGAGAAGG - Intergenic
1004006107 6:11638513-11638535 CAGAGGTGTGTGAGGCAAGGAGG - Intergenic
1004123616 6:12850800-12850822 CAGAGGCACGTGCAGGAAGAGGG - Intronic
1004235065 6:13868036-13868058 GAGAGGTAGATTAGGAAAGAGGG + Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004854388 6:19734500-19734522 CAGAGGGATGTGAGGAATAAAGG - Intergenic
1005060423 6:21771873-21771895 CAGAGGAATGTTAGGAGAGAGGG + Intergenic
1006038111 6:31229953-31229975 CAGAGGCAGGTGGGGAGAGAAGG - Intergenic
1007784733 6:44273081-44273103 CAGAGGGACTTGGTGAAAGAGGG - Exonic
1008268572 6:49462862-49462884 CGGAGGTACTTCTGGAAAGAAGG - Intronic
1010044511 6:71425481-71425503 CAAAGGTGGGAGAGGAAAGAAGG + Intergenic
1012321793 6:97857131-97857153 CTGAGGTAGGTATGGAAAGATGG - Intergenic
1012439575 6:99250916-99250938 CAGAGGTGGGTGAGGAATGGGGG + Intergenic
1012731821 6:102892910-102892932 CTGAGGGCCGTGAGTAAAGATGG + Intergenic
1014480505 6:121930265-121930287 CAGATGTAAGGGAGGAAAGATGG - Intergenic
1015137984 6:129895334-129895356 CAGTGGTATGTGAGTAAACATGG + Intergenic
1017516390 6:155159881-155159903 AATAGATACGTGAGTAAAGATGG + Intronic
1018631477 6:165826423-165826445 CAAAGGAACGTAAGGACAGAGGG - Intronic
1018631486 6:165826471-165826493 CAGAGGGACGTGGGGACAGGTGG - Intronic
1018848021 6:167568581-167568603 CAAAGATACTTGAGTAAAGACGG - Intergenic
1019212424 6:170417392-170417414 CGCAGGTACGTGGGGAAGGAGGG - Intergenic
1020435358 7:8156674-8156696 CAGAAGTAAGAGAGGAAAGGAGG + Intronic
1022049092 7:26647742-26647764 CAGAGGCAGGTGAGGGGAGATGG - Intergenic
1024149336 7:46553998-46554020 CAGAGGAAGTTGAGAAAAGAGGG + Intergenic
1024695401 7:51851454-51851476 CAAAGGTACATGAGCAATGAAGG - Intergenic
1026900283 7:74033311-74033333 GAGAGGCACGTGAAGAATGAGGG + Intronic
1027428742 7:78088325-78088347 CAGAGGTCAGAGAGGAGAGAAGG - Intronic
1027428831 7:78088958-78088980 CAGAGGTCAGAGAGGACAGAAGG + Intronic
1027903403 7:84148365-84148387 CAGAGCTCCGTGCGGAAGGATGG + Intronic
1031036336 7:116792165-116792187 CTGAGGTAAGTGAGCAAGGAAGG - Intronic
1031856125 7:126924622-126924644 CAGAAGGAAGGGAGGAAAGAAGG - Intronic
1033463948 7:141573735-141573757 CAGAGGGACGTGGGGACATAGGG + Intronic
1033717819 7:144021114-144021136 CAGAGATGCGTGAGGCAAGGAGG - Intergenic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035562658 8:617824-617846 CAGAGGGCAGTGAGGACAGATGG - Intronic
1035562693 8:618132-618154 CAGAGGGCAGTGAGGACAGATGG - Intronic
1035910655 8:3562165-3562187 CAGTAGTAGGTGGGGAAAGATGG + Intronic
1036033642 8:4996325-4996347 CAGGGATACATGAGGCAAGACGG - Intergenic
1037418526 8:18677177-18677199 CAGAGGAACTAGAGGAAGGAGGG + Intronic
1037768741 8:21787105-21787127 CGGAGGGAGGTGAGGAAAGGCGG - Intronic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038914637 8:32007038-32007060 CAGTGGGATGTGAGGAAAAATGG - Intronic
1040436785 8:47398872-47398894 CTGAGGCAAGTGAGGAGAGAGGG + Intronic
1043546075 8:81317090-81317112 CAGAGGCATGTGAAGACAGAGGG + Intergenic
1047909817 8:129515830-129515852 CACAGACACATGAGGAAAGAAGG - Intergenic
1047925509 8:129679010-129679032 CAGAGGTACGCAGGGAAAGTAGG + Intergenic
1047928602 8:129704416-129704438 CAGAGGGAAGGGAGGAGAGAAGG - Intergenic
1049148254 8:141017770-141017792 CAGAGGCACGTGGGGAATGCAGG + Intergenic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1050560509 9:6830206-6830228 CAGTGGTATGTGAGGAAACCAGG + Intronic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052445933 9:28561079-28561101 AAGTGGCAAGTGAGGAAAGAAGG + Intronic
1052760107 9:32581561-32581583 CAGAGATAAGTGAGAAAGGATGG - Intergenic
1055742512 9:79405305-79405327 CAGAGATACATGAGGAGAGAAGG - Intergenic
1057031665 9:91780440-91780462 CAGAGGTCTGTGTTGAAAGAAGG - Intronic
1059254587 9:112918039-112918061 CAGAGGTATGACAGGAAAGGAGG + Intergenic
1059685356 9:116629809-116629831 CAGAGGTAAGTGTGGCAATAGGG - Intronic
1061034054 9:128103665-128103687 CAAAGATCTGTGAGGAAAGATGG - Exonic
1061403207 9:130379474-130379496 CAGGGGTGCGTGAAGAAAGTGGG + Intronic
1062359488 9:136180811-136180833 CAGAGGTACGGGAGCCCAGAGGG + Intergenic
1185492537 X:528790-528812 CAGAGGGAAGGAAGGAAAGAAGG - Intergenic
1185535100 X:854870-854892 GAGAGGAAAATGAGGAAAGATGG - Intergenic
1186889268 X:13944087-13944109 CAGAGGTTAGTGGGGAGAGAGGG + Intergenic
1193747362 X:85298403-85298425 CAGAGGTACATGGTGAAAGTGGG + Intronic
1194199070 X:90933268-90933290 CACAGGTAGGTGAGAAAAAATGG - Intergenic
1196251514 X:113465776-113465798 CAGAGCTAGGCCAGGAAAGATGG - Intergenic
1197852004 X:130872501-130872523 CAGAGGTAGGTTAGGAATGAAGG - Intronic
1200014122 X:153146395-153146417 CAGAGGTAGGTGATGGAATAGGG + Intergenic
1200025478 X:153253557-153253579 CAGAGGTAGGTGATGGAATAGGG - Intergenic
1200545067 Y:4509700-4509722 CACAGGTAGGTGAGAAAAAATGG - Intergenic