ID: 1179030959

View in Genome Browser
Species Human (GRCh38)
Location 21:37719087-37719109
Sequence GATGAAGGAGGAGCCCCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179030952_1179030959 9 Left 1179030952 21:37719055-37719077 CCAAGGAAATGTGAGAGTTCTGG 0: 1
1: 1
2: 3
3: 25
4: 364
Right 1179030959 21:37719087-37719109 GATGAAGGAGGAGCCCCGAGGGG 0: 1
1: 0
2: 3
3: 35
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179030959 Original CRISPR GATGAAGGAGGAGCCCCGAG GGG Intronic
900286154 1:1901600-1901622 GGTGTAGGAGGAGCCCCGTCCGG - Intergenic
900988643 1:6087404-6087426 GATGAAGGAGGACCCCCCAGGGG + Intronic
901115749 1:6842361-6842383 TATGAAGGAGGAGCACTGACTGG - Intronic
902464032 1:16603559-16603581 TAGGAGGGACGAGCCCCGAGTGG + Intronic
904190258 1:28737546-28737568 AATAAAGGAGCAGGCCCGAGGGG - Intronic
904344656 1:29859917-29859939 GATGAGGAAAGAGCCCAGAGAGG - Intergenic
905741249 1:40373629-40373651 GCTGAAGGAAGAGCCCAGTGCGG + Intronic
907518531 1:55008409-55008431 GTTGGAGGATGAGCCCCAAGAGG + Exonic
908046718 1:60178405-60178427 GAGGCACGAGGAGCCCAGAGTGG + Intergenic
908602542 1:65756608-65756630 GATTAAGGAGGACCTCAGAGAGG - Intergenic
909032650 1:70560620-70560642 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
909215159 1:72877588-72877610 GAGGTAGGAGGAGCCCAAAGTGG - Intergenic
909714477 1:78691383-78691405 GATGAAGGAGGAGCCATCAAAGG + Intergenic
911496889 1:98642929-98642951 GAGGTATGAGGAGCCCCAAGTGG - Intergenic
912706784 1:111920649-111920671 GAAGTAGGAGGAGCCTGGAGTGG - Intronic
913425541 1:118724773-118724795 GTTGTTGGAGGAACCCCGAGTGG - Intergenic
913474889 1:119227666-119227688 GAGGAAGGAGGAGGCCCGCAGGG - Intergenic
914313767 1:146489456-146489478 AATGAAGGATGGGCCCCAAGTGG + Intergenic
914417829 1:147500456-147500478 GGTGAAGGAGAAGCCTAGAGAGG + Intergenic
914500582 1:148243925-148243947 AATGAAGGATGGGCCCCAAGTGG - Intergenic
914504200 1:148274723-148274745 AATGAAGGATGGGCCCCAAGTGG - Intergenic
915076196 1:153309699-153309721 GGGGAGGGAGGAGCCCGGAGAGG + Intronic
915492308 1:156257837-156257859 GATGAAGAAGAAACCCTGAGGGG + Intronic
917975220 1:180233751-180233773 GGAGAAGGAGGAGCCCCGCGGGG + Intronic
918626202 1:186658513-186658535 GATGAAGGAGGAAACCATAGGGG + Intergenic
918783238 1:188730876-188730898 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
920096017 1:203487281-203487303 GAAGATGGAGGAGTCCCCAGGGG - Exonic
922355774 1:224773869-224773891 GCTGGAGGAGGAGCCTCTAGTGG - Intergenic
922804665 1:228379049-228379071 GAGGACGGAGACGCCCCGAGGGG - Intergenic
923126823 1:231040405-231040427 GAGGGAGGAGGAGACCCGGGTGG - Intergenic
923464176 1:234233423-234233445 GCTGAAAGAGGACCCCCAAGTGG + Intronic
923474919 1:234323153-234323175 GAAGAAGGAGGAGCCTGCAGAGG + Exonic
923957471 1:239039330-239039352 GAGGAAGGAGGAGCCCAAAGTGG - Intergenic
1063082532 10:2782166-2782188 GATGTAGGAGGAGTCCACAGCGG - Intergenic
1064932172 10:20640223-20640245 GATAAAGGAGCAGACCAGAGTGG + Intergenic
1069265693 10:66454775-66454797 GATGAAGGAGGAGGAAGGAGAGG + Intronic
1069551652 10:69368431-69368453 GATGAAGCAGAAGCCCATAGGGG - Intronic
1069879331 10:71581833-71581855 GAGGAAGGATGAGGCCAGAGGGG - Intronic
1069897779 10:71689581-71689603 GATGAATCAGCAGTCCCGAGGGG - Intronic
1070809274 10:79289442-79289464 GGTGAAGGAGGAGCTCAGATTGG + Intronic
1071364246 10:84882848-84882870 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
1071601647 10:86961487-86961509 GAGGAGGGAGGAGCCCCCTGGGG - Intronic
1071673699 10:87635753-87635775 GAGGCAGGAGGAGCCCAAAGTGG + Intergenic
1073957529 10:108890504-108890526 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
1074422250 10:113319601-113319623 CCTGAAGGAGGAGCCATGAGTGG - Intergenic
1074458256 10:113614017-113614039 GAGGAAGGTGTAGCCCAGAGGGG + Intronic
1074953315 10:118362685-118362707 GGTAAAGGAGGAGAACCGAGAGG - Intergenic
1075855059 10:125622842-125622864 GAGGCAGGAGGAGCCCAGAGTGG + Intronic
1076402710 10:130194256-130194278 GACGATGGAGGAGCCCCCAGGGG + Intergenic
1076522137 10:131087909-131087931 GATGAAGGAGGAGCGAGGGGAGG + Intergenic
1077129813 11:965562-965584 GAGGTAGGAAGAGCCCAGAGGGG - Intronic
1077638012 11:3856303-3856325 GGTGCAGGAGGAGTCCCCAGAGG - Exonic
1081185439 11:40036787-40036809 GTTGAAGGAGGAGCCTGGTGGGG - Intergenic
1081586325 11:44386522-44386544 GATGGAGATGGAGCCCAGAGGGG - Intergenic
1082934192 11:58639389-58639411 GAAAAAGGAGGAGCCCCTAGAGG - Intergenic
1083581261 11:63826977-63826999 GCGGATGGAGGAGCCCCCAGCGG + Exonic
1084722987 11:70920416-70920438 GATGAAGGAAGAGACAAGAGTGG + Intronic
1085470178 11:76752668-76752690 GAGGAAGGAGGAGTCTGGAGAGG + Intergenic
1086814817 11:91356735-91356757 GATAAACGAGGAGACCAGAGTGG - Intergenic
1087732916 11:101798714-101798736 GCAGGAGGAGGAGCCCCTAGTGG + Intronic
1089569023 11:119390168-119390190 GATGAAGGAGAAGGGCAGAGAGG - Intergenic
1090425160 11:126602507-126602529 GATGAGGGAGAGGCCCAGAGAGG + Intronic
1091364252 11:135004565-135004587 AAGGAAGGAGGAGCACAGAGAGG - Intergenic
1091949526 12:4581270-4581292 GATGAAAGAGGTACCCTGAGGGG - Intronic
1092047577 12:5443014-5443036 GAGGAAGGAGGAGCCCTTATAGG + Intronic
1096178977 12:49540240-49540262 GCAGATGGAGGAGCCCGGAGTGG - Intronic
1096515485 12:52153032-52153054 GATGAAGCTGGGGCCCCAAGAGG - Intergenic
1100502957 12:95192016-95192038 TATACAGGAGGAGCCGCGAGTGG - Intronic
1101416993 12:104517078-104517100 GATGAAGGAAGAGCCTTGAGAGG + Intronic
1101731880 12:107433509-107433531 GAGGAAGGAGCAGCCCCCATGGG + Intronic
1102394280 12:112574317-112574339 AATGAAGGTGGAGCACGGAGAGG + Intronic
1102566767 12:113802210-113802232 GAGGAAGCAGGAGCCCAGAGAGG - Intergenic
1102693928 12:114783208-114783230 GGAGACAGAGGAGCCCCGAGAGG + Intergenic
1103126091 12:118423811-118423833 GAGGAAACTGGAGCCCCGAGAGG - Intergenic
1105065366 12:133192757-133192779 GCTGAAGCAGGAGACCCGGGAGG - Intronic
1106683743 13:32034755-32034777 GATGAACGAGGAGCTCAAAGAGG - Intronic
1107108864 13:36674440-36674462 GCTGCAGGAGGAGCCGCGAGGGG + Intronic
1110880946 13:80571598-80571620 GATAAAGGAAGAGACCCAAGAGG + Intergenic
1112191849 13:97185896-97185918 AAGGAAGGAGGAGCCACCAGAGG - Intergenic
1114804466 14:25818636-25818658 GATTAAGGAGGAGCCACAAATGG + Intergenic
1116531243 14:45976592-45976614 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
1119468067 14:74875353-74875375 GAGGAACCAGGAGCCCAGAGAGG + Intergenic
1121115904 14:91342560-91342582 TATGAAGGAGAAGCCCGGGGTGG - Intronic
1122091018 14:99340639-99340661 GATGAAGAATGAGGCCAGAGAGG + Intergenic
1122350006 14:101083715-101083737 CAGGAAGGGGGTGCCCCGAGTGG - Intergenic
1122415461 14:101547557-101547579 GAAGAAGCTGGAGCCCAGAGAGG + Intergenic
1123468531 15:20533653-20533675 GATGAGGGCGGGGCCCCAAGGGG - Intronic
1123649583 15:22467409-22467431 GATGAGGGCGGGGCCCCAAGGGG + Intronic
1123728849 15:23128864-23128886 GATGAGGGCGGGGCCCCAAGGGG - Intronic
1123747013 15:23326329-23326351 GATGAGGGCGGGGCCCCAAGGGG - Intergenic
1124279282 15:28349645-28349667 GATGAGGGCGGGGCCCCAAGGGG - Intergenic
1124303416 15:28561963-28561985 GATGAGGGCGGGGCCCCAAGGGG + Intergenic
1124532314 15:30518405-30518427 GATGAGGGTGGGGCCCTGAGGGG + Intergenic
1124766339 15:32489240-32489262 GATGAGGGTGGGGCCCTGAGGGG - Intergenic
1126841769 15:52724368-52724390 GATGAAGGAGAAGCTGAGAGGGG - Intergenic
1130096385 15:80859302-80859324 AATGAATGAGGAGCCCACAGAGG - Intronic
1130851380 15:87797577-87797599 GATGGAGGAGGAGGCTAGAGTGG + Intergenic
1131215290 15:90530504-90530526 GGAGGACGAGGAGCCCCGAGAGG + Intronic
1132812674 16:1809033-1809055 GAGGAGGAAGGAGGCCCGAGGGG + Exonic
1133255029 16:4511522-4511544 GAGGAAGGAGCAGCCACAAGTGG - Exonic
1133266417 16:4587092-4587114 GATGGAGGAGGAGCTGAGAGAGG + Exonic
1133385581 16:5367501-5367523 AGGGAAGGAGGAGCCCAGAGTGG + Intergenic
1133993222 16:10726875-10726897 GATCAAGCAAGAGCCCCAAGTGG - Intergenic
1134178746 16:12030547-12030569 GAGGATGGAGGAACCGCGAGTGG - Intronic
1135305492 16:21364290-21364312 GATGATGGAGGAAACGCGAGTGG - Intergenic
1138252179 16:55509537-55509559 GAGGAGGGAGGTGGCCCGAGGGG + Intronic
1138396012 16:56705389-56705411 GATGCACAAGGAGCCCCAAGTGG + Intronic
1138533422 16:57647131-57647153 GATGAAGGAGGGGCGCTAAGTGG + Intronic
1138997361 16:62472163-62472185 CTTGAAGGTGGAGCCCCAAGGGG - Intergenic
1139851030 16:69951697-69951719 GGTCAAGGAGGAACGCCGAGGGG + Intronic
1140019232 16:71221456-71221478 AATGAAGGAGGACCTCAGAGAGG - Intronic
1140479077 16:75252838-75252860 GATGAGAAAGGAGCCCAGAGAGG - Intronic
1203139788 16_KI270728v1_random:1754679-1754701 TATGCAGGAGCAGCCCCGGGTGG - Intergenic
1142640081 17:1280526-1280548 GAGGAAGGAGGAGGCCAGTGAGG - Intronic
1143007309 17:3845696-3845718 GATAAAGGGGGAGCCCTGGGCGG - Intronic
1143258935 17:5584147-5584169 GGGGAGGGAGGAGCCCAGAGGGG + Intronic
1146184990 17:30718974-30718996 GATGCAGGAGGAGCTGTGAGGGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146964743 17:37015981-37016003 GATAATGGAGGAGGCCCAAGTGG + Intronic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147548256 17:41419847-41419869 GGTGGAGGAGCAGCCCAGAGAGG - Intergenic
1149609329 17:57948607-57948629 GATGAAGTAGAGGCCCCTAGAGG - Intronic
1149635829 17:58168496-58168518 GAAGATGGAGGAGCCGGGAGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150538804 17:66075790-66075812 AATGAACCAGGAACCCCGAGGGG + Intronic
1151539547 17:74758105-74758127 GAGGAAGGAGGAGCAGGGAGCGG + Intronic
1151594005 17:75065714-75065736 GCTGAGAGAGGAGGCCCGAGAGG + Exonic
1152040469 17:77899530-77899552 GATGAAGGAAGAAAGCCGAGCGG + Intergenic
1152997903 18:425348-425370 GATGAAGAATGAGCCCTGGGTGG - Intronic
1153285055 18:3449577-3449599 GCTGGAGGAAGAGCCCCGGGAGG + Intronic
1154273021 18:12936281-12936303 GAAGCATGAGGAGCCCCAAGTGG + Intergenic
1154485372 18:14867944-14867966 GATGAAGGAGGTGTCCCCTGTGG + Intergenic
1155078203 18:22381618-22381640 GAGGAAGGAAGAGCCCAAAGTGG - Intergenic
1160227012 18:77019424-77019446 GATGGAGGAGGAGCCTGGAGGGG + Intronic
1160448640 18:78947010-78947032 GAGGAAGGAGGAGGGACGAGGGG + Intergenic
1161112873 19:2479481-2479503 GAAGAGGCGGGAGCCCCGAGGGG + Intergenic
1161288213 19:3479484-3479506 TATAAAGGAGGAGCTCAGAGGGG + Intronic
1161288237 19:3479584-3479606 AAAGAAGGAGGAGCTCAGAGGGG + Intronic
1161288286 19:3479775-3479797 AAAGAAGGAGGAGCTCAGAGGGG + Intronic
1161288338 19:3479969-3479991 AAAGAAGGAGGAGCCCAGAGGGG + Intronic
1161479308 19:4502722-4502744 GAGGAAAGAGAAGCCCCGAGTGG - Exonic
1161494196 19:4578811-4578833 TATGTTGGAGGAGCCCTGAGTGG - Intergenic
1162586114 19:11559571-11559593 GATGAAGAGGGAGGCCTGAGAGG + Intronic
1162973786 19:14196715-14196737 GATGCAGGAGGAGCTGTGAGGGG - Intronic
1163000562 19:14363983-14364005 GAGGCAGGAGGGGCCACGAGCGG - Intergenic
1164156946 19:22602823-22602845 GCTGAAGGAGCAGCACCGAGAGG + Intergenic
1165080061 19:33301916-33301938 GATCAAGCAGGAGCCCCGCGAGG - Exonic
1165365162 19:35360745-35360767 GATGAAGGAGTGGCCCAGAGAGG + Intergenic
1165366980 19:35373213-35373235 GATGAAGGAGTGGCCCAGAGAGG + Intergenic
1167640789 19:50680271-50680293 GAAGCAGGAAGAGCCCAGAGAGG + Intronic
1168069592 19:53942300-53942322 GAGGCAGGGGGAGCTCCGAGGGG - Exonic
1202679691 1_KI270711v1_random:40999-41021 TAGGAGGGACGAGCCCCGAGTGG + Intergenic
925070855 2:965527-965549 GGTCAAGGAGGAGGACCGAGAGG - Intronic
925473904 2:4191946-4191968 GATGAGGGAGGGGCCAGGAGTGG - Intergenic
926892492 2:17650198-17650220 AGTGAGGGAGGAGCCCCCAGAGG - Intronic
927660651 2:24990307-24990329 GAAGTAGGAGGAGCCCAAAGTGG - Intergenic
927810181 2:26176106-26176128 GATGAACGAGGGGCCCCGTCGGG + Intronic
927997377 2:27495309-27495331 GTCGTGGGAGGAGCCCCGAGAGG - Intergenic
929269597 2:39959155-39959177 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
929877200 2:45806758-45806780 GATGAGGGAGGACCCCGGGGTGG + Intronic
930480945 2:51947619-51947641 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
933795381 2:85915311-85915333 GCTGGAGGAGGAGTCCTGAGTGG + Intergenic
937732131 2:125245924-125245946 TATGAAGGAGGAGCACGAAGGGG - Intergenic
938464516 2:131517416-131517438 GCTGAGGGAGGATCCCCCAGAGG - Intergenic
943182502 2:184561289-184561311 GAGGTAGGAGGAGCCCAAAGTGG - Intergenic
946533884 2:220606240-220606262 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
948075763 2:235164130-235164152 GATGATGGAAGCGCCCAGAGAGG + Intergenic
948170770 2:235900328-235900350 GAGGTAGGAGGAGCCCAAAGTGG + Intronic
949059977 2:241951185-241951207 GCAGAATGTGGAGCCCCGAGTGG + Intergenic
1168975506 20:1962650-1962672 GCTGATGGAGGAGGCCAGAGGGG + Intergenic
1171255970 20:23689209-23689231 GATGGAGGAGGAGGCCTGGGAGG - Intergenic
1171263318 20:23751106-23751128 GATGGAGGAGGAGGCCTGGGAGG - Intronic
1172092446 20:32443559-32443581 CATGAAGGAGCTGCCCCCAGAGG + Exonic
1173224452 20:41154075-41154097 AATGAAGGAGGTGCCAGGAGTGG + Intronic
1173756474 20:45521106-45521128 GAGGCAGGAGGAGCCCAAAGTGG + Intergenic
1175156698 20:56976295-56976317 GATAAGGGAGGAGCACGGAGGGG + Intergenic
1176717890 21:10368694-10368716 GATGAAGGGGGTCCCCGGAGTGG + Intergenic
1176724009 21:10414852-10414874 GATGAAGGAGGAGTCCCCTGTGG + Intergenic
1176795962 21:13371532-13371554 GATGAAGGAGGTGTCCCCTGTGG - Intergenic
1178122468 21:29482909-29482931 AATGAATGAGGACCCCTGAGAGG - Intronic
1178329095 21:31671723-31671745 GGGGAAGGAGGAGCCCTGACCGG - Exonic
1179030959 21:37719087-37719109 GATGAAGGAGGAGCCCCGAGGGG + Intronic
1180075729 21:45460526-45460548 GATGAAGGAGCAGCCCCTCGGGG - Intronic
1180235716 21:46458526-46458548 GACCAAGGAGGAGCCCCGAGAGG + Intergenic
1180299117 22:11021600-11021622 GATGAAGGGGGTCCCCGGAGTGG + Intergenic
1180305253 22:11068026-11068048 GATGAAGGAGGAGTCCCCAGTGG + Intergenic
1181111558 22:20605740-20605762 GCTGAGGGAGGATCCCCCAGAGG + Intergenic
1182492414 22:30682277-30682299 GAGGAAGGTGAAGCTCCGAGGGG - Intergenic
1183189502 22:36312637-36312659 TATGTAGGAGGAGCCCCTTGAGG + Intronic
1183342071 22:37286980-37287002 GGTGATGGAGGAGACCCAAGGGG + Intronic
1183583785 22:38740496-38740518 GATGAAAGAGGACCCCCTAGTGG + Intronic
1183705295 22:39471954-39471976 GAAGAGGGAGGAGTCCCTAGAGG + Intronic
1183732732 22:39627798-39627820 GATGAAGTGGGAGCCCCTTGTGG - Intronic
1184470273 22:44692182-44692204 GTGGGAGGAGGAGCCCCGGGTGG - Intronic
1184470300 22:44692256-44692278 GTGGGAGGAGGAGCCCCGGGAGG - Intronic
1184856183 22:47147977-47147999 GAGGAAGGAGGAGCCTGGTGGGG - Intronic
1184996196 22:48209362-48209384 GATGACGGAGGAGTGCCGCGAGG - Intergenic
1185075259 22:48679298-48679320 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075277 22:48679344-48679366 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075286 22:48679367-48679389 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075304 22:48679413-48679435 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075313 22:48679436-48679458 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075331 22:48679482-48679504 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075349 22:48679528-48679550 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075367 22:48679574-48679596 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075376 22:48679597-48679619 GATGGACGGGGAGCCCGGAGAGG - Intronic
1185075394 22:48679643-48679665 GATGGACGGGGAGCCCGGAGAGG - Intronic
951208334 3:19947304-19947326 GAGGAAGGGGGAGCGGCGAGAGG + Exonic
952382855 3:32818043-32818065 GAGGAGGGAGGAGACCAGAGAGG - Exonic
953136331 3:40185465-40185487 GAGGGAGCAGGATCCCCGAGGGG + Intronic
954301230 3:49701828-49701850 GATGAAGGAGGAGACCGCAGAGG + Exonic
956012406 3:64845489-64845511 GGTGCAGGAGGAGCCCAGATTGG - Intergenic
957689840 3:83553614-83553636 GAGGAAGGAAGAGCCCAAAGTGG + Intergenic
957873217 3:86113420-86113442 GATTTAGGAGGAGCCAGGAGTGG + Intergenic
958046401 3:88289189-88289211 GATGAAAGAGAAGCCCAGACAGG + Intergenic
958919281 3:100085554-100085576 GATGAAAGAGGAACACAGAGGGG - Intronic
959950305 3:112174241-112174263 CATGGAGGTGGAGCCCCCAGGGG - Intronic
960811778 3:121633140-121633162 GATGATGGAGGAGTCCCAACTGG + Exonic
962169594 3:133087144-133087166 GACAAGGGAGGAGCCCAGAGAGG - Intronic
962372069 3:134828911-134828933 GATAAAGGAGGAGGTCTGAGTGG + Intronic
962607401 3:137044300-137044322 GAGGAAGGAGGAGAGCAGAGAGG + Intergenic
962807973 3:138940106-138940128 GAGGTTGGAGGAGCCCCGGGCGG + Intergenic
964720792 3:159765348-159765370 GAGGAAGGAGGAGCAGCCAGAGG + Intronic
965071223 3:163917314-163917336 GAGGTAGGAAGAGCCCCAAGTGG - Intergenic
965736141 3:171823158-171823180 GATGAAGCAGGAGCTCTCAGAGG + Intergenic
968519508 4:1029229-1029251 GAGAAGGGAGGAGCCCAGAGTGG + Intergenic
969089957 4:4686209-4686231 GAAGAAAGCGGAGCCTCGAGAGG + Intergenic
969574687 4:8030054-8030076 GATGAAGCTGGAGCCCCCACCGG - Intronic
970697426 4:18694786-18694808 TATGTAGGAGGACCCCTGAGAGG - Intergenic
971126660 4:23761953-23761975 GAGGTAGGAGGAGCCCAAAGTGG - Intronic
971382042 4:26107933-26107955 GATGAAGCAGGAGCCCAAGGAGG - Intergenic
971766804 4:30842798-30842820 TATGGAGGAGGAACCACGAGAGG + Intronic
971857442 4:32061202-32061224 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
975849119 4:78553237-78553259 GAAGAAGCTGGAGCCCAGAGAGG - Intronic
977508122 4:97928275-97928297 AATTAAGGAGGAACCCAGAGTGG - Intronic
981979173 4:150771023-150771045 GAGGCAGGAGGAGCCCAAAGTGG + Intronic
985106739 4:186507000-186507022 GATGAAGTAGGTGCCCTGTGTGG - Intronic
985827178 5:2201177-2201199 GATGAAGATGGAGCCCTGGGAGG - Intergenic
986504833 5:8438984-8439006 GAAGCAGGAGGAGACCAGAGAGG - Intergenic
987192322 5:15490979-15491001 GATGAAGGAGAAGCACCGTAGGG - Intergenic
988832264 5:34999354-34999376 AAGGAAGGAGGAGACCTGAGTGG - Intronic
996283086 5:121755853-121755875 GATGAAGGGGCATTCCCGAGTGG - Intergenic
996908735 5:128632308-128632330 GAGGAAGGAGGAGCCCAAAGTGG + Intronic
998157211 5:139793884-139793906 GAGGAAGTAGGAGCCCAGAAAGG + Intergenic
999321831 5:150619923-150619945 GAAGAAGGAGGACCCCAGGGAGG + Intronic
1000296591 5:159917525-159917547 GATGTAGAAGGAGCCCAGAGAGG - Exonic
1001474739 5:172042460-172042482 TGTGAAGGACGAGCCACGAGGGG + Exonic
1001599394 5:172919214-172919236 AATGAAGGAGGAGACCCCTGAGG + Intronic
1001988082 5:176092947-176092969 TAGGAAGGAGGAGCCCTAAGAGG + Intronic
1001998453 5:176181029-176181051 TAAGAAGCAGGAGCCCTGAGAGG - Intergenic
1002227580 5:177735160-177735182 TAGGAAGGAGGAGCCCTAAGAGG - Intronic
1002228786 5:177745193-177745215 TAGGAAGGAGGAGCCCTAAGAGG - Intronic
1002266560 5:178038590-178038612 TAGGAAGGAGGAGCCCTAAGAGG + Intronic
1002424150 5:179165878-179165900 GATGCAGGAGGAGTCCTGAGTGG + Intronic
1002724149 5:181283383-181283405 GATGAAGGAGGAGTCCCCTGTGG + Intergenic
1004068537 6:12275221-12275243 TATGAGGGAAGAGCCCCAAGCGG - Intergenic
1004850231 6:19691679-19691701 GATGGCGGAGCAGCCCCGAGCGG - Intergenic
1005023049 6:21435815-21435837 GATGAAGGATCAGCCCTCAGAGG + Intergenic
1007400166 6:41598801-41598823 GGTGAAGGAGGAGCCAGCAGAGG + Exonic
1007407275 6:41642314-41642336 GGTGAAGGAGGCCCCCCGTGTGG - Intronic
1011643185 6:89433574-89433596 GAAGAGGGAGGCGCCCCGGGGGG - Intronic
1013272845 6:108559546-108559568 GAGGGAGGAGGAGCCCAGCGGGG + Intergenic
1018425475 6:163676515-163676537 GAAGTAGGAGGAGCCCCAAGTGG - Intergenic
1019575015 7:1733421-1733443 GAGGCAGGAGGAGCCCTGGGCGG + Intronic
1019593613 7:1848083-1848105 GATGATGGAGGAGCTCCTGGGGG + Exonic
1019930503 7:4219821-4219843 TATGAAGGAGGAGCGGGGAGGGG - Intronic
1021943758 7:25705077-25705099 GATGAAGGAGGAGTGCAAAGTGG + Intergenic
1023843161 7:44107851-44107873 GCAGAAGGAGGAGGCCCGAGCGG + Exonic
1024591966 7:50894595-50894617 GAGGAAGGAGGAGCCACAAGAGG + Intergenic
1027686019 7:81279595-81279617 GAGGAAGGAGGAGCCCAAAGTGG - Intergenic
1029195369 7:98801986-98802008 GATGCAGGAGGAGCCCTGGATGG - Intergenic
1030506915 7:110436324-110436346 GAGGTAGGAGGAGCCCGAAGTGG - Intergenic
1033366897 7:140678744-140678766 GATGAAGGGGTAGCCCTGTGTGG + Intronic
1034924570 7:155110806-155110828 CATGGAGGAGGATCCCAGAGAGG - Intergenic
1036692901 8:10956039-10956061 GAAGAAGGCTGAGCCCTGAGAGG + Intronic
1036748124 8:11424445-11424467 GCTGAAGGAGGAGGCAAGAGGGG + Exonic
1039033669 8:33335937-33335959 GATGGAGGAGGAGGCAGGAGAGG + Intergenic
1039422356 8:37453746-37453768 GAGGAAGGAGGAGCCAGCAGTGG - Intergenic
1039527031 8:38226121-38226143 GATGCATGAGGAGCCCAAAGTGG + Intronic
1039896573 8:41720702-41720724 GATGAAGGAGGGGCACTGGGAGG + Intronic
1043502758 8:80873702-80873724 TGTGGAGGAGAAGCCCCGAGGGG - Intronic
1043599808 8:81923588-81923610 GATGCATGAGGAGCCCCAAGGGG - Intergenic
1044426562 8:92058093-92058115 GATCATGCAGGAGCCCAGAGGGG - Intronic
1048937039 8:139366023-139366045 GATCAAGGAGCAGCACCGTGAGG + Intergenic
1049218295 8:141417671-141417693 GAGGAAGGAGGGGTCCCGGGCGG + Intronic
1049246788 8:141567172-141567194 GATGGAAGGGGAGCCCTGAGGGG + Intergenic
1049386625 8:142345996-142346018 CCTGGAGGAGGAGCCCTGAGTGG - Intronic
1049912724 9:285171-285193 GATGATGGAGGAGACATGAGTGG - Intronic
1050053112 9:1623549-1623571 GAGGTAGGAGGAGCCCAAAGTGG - Intergenic
1050253759 9:3772772-3772794 GATGAAGTAGGAGGCCAGTGTGG - Intergenic
1053886289 9:42646817-42646839 GATGAAGGAGGAGTCCCCTGTGG + Intergenic
1054225309 9:62454266-62454288 GATGAAGGAGGAGTCCCCTGTGG + Intergenic
1054726108 9:68651800-68651822 GATAAAGGAGGAACTCTGAGAGG + Intergenic
1057014964 9:91643161-91643183 GCAGAAGAAGGAGCCCAGAGAGG + Intronic
1057518037 9:95738110-95738132 GATGAAGAGGCAGCCCCGGGGGG - Intergenic
1058526722 9:105866430-105866452 GATGAAGCAGCAGCCCAGAGGGG - Intergenic
1059248390 9:112867133-112867155 GAGGTAGGAGGAGTTCCGAGGGG - Intronic
1060419218 9:123455531-123455553 GAGGAAGGAGAAGCCTCCAGAGG - Intronic
1060725090 9:126001153-126001175 GATCACGGGGAAGCCCCGAGTGG + Intergenic
1061940104 9:133879204-133879226 GAGGAAGCAAGAGCCCCCAGAGG - Intronic
1062172561 9:135143514-135143536 GATGAAGGGAGAGACCAGAGTGG - Intergenic
1062392234 9:136338418-136338440 GATGAAGCTGGACCCCAGAGAGG + Intronic
1187663686 X:21579007-21579029 GCTGAAGGAGGAGATCCGATTGG + Intronic
1187977540 X:24718452-24718474 GAGGAAGGAGGAGGCCTGTGTGG + Intronic
1189145930 X:38654838-38654860 GATAAAGCAGGAGCCCCGTGGGG + Intronic
1191675264 X:63785951-63785973 CATGAAGGAGAAGCCTGGAGTGG - Intergenic
1193914597 X:87350309-87350331 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
1194277212 X:91900224-91900246 GAGGTAGGAGGAGCCCAGAGTGG + Intronic
1196315889 X:114222964-114222986 GTTGGCGGAGGAGCCCAGAGTGG - Intergenic
1198100141 X:133415697-133415719 GAGGAAGGAGGAGCCGGGTGGGG - Intergenic
1198782830 X:140256165-140256187 GAGGTAGGAGGAGCCCAAAGTGG + Intergenic
1199206617 X:145156585-145156607 GGTGAAGTAGGAACCCCTAGAGG + Intergenic
1200486392 Y:3773661-3773683 GATGCATGAGGAGCCCAAAGTGG + Intergenic
1200594555 Y:5122323-5122345 GAGGTAGGAGGAGCCCAGAGTGG + Intronic