ID: 1179031002

View in Genome Browser
Species Human (GRCh38)
Location 21:37719263-37719285
Sequence GCATGCATGCAGATGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179030998_1179031002 15 Left 1179030998 21:37719225-37719247 CCAGGTCTGAGCAGGGAGCGGCG 0: 1
1: 0
2: 2
3: 25
4: 203
Right 1179031002 21:37719263-37719285 GCATGCATGCAGATGTTGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179031002 Original CRISPR GCATGCATGCAGATGTTGCA GGG Intronic
902540536 1:17151091-17151113 GGATGCAGGCACATCTTGCATGG - Intergenic
903998015 1:27320074-27320096 GCATGGGTCCAGATGGTGCAGGG + Intergenic
904607615 1:31706644-31706666 GCCTGCATGCTGCTGCTGCATGG + Intergenic
905997540 1:42394359-42394381 ACATGCATGCACAGGTTGGAGGG + Intronic
906357339 1:45118025-45118047 GCAGGCAGGCAGAGCTTGCAGGG + Intronic
906684432 1:47754410-47754432 GCTTTCATACAGCTGTTGCAGGG - Intergenic
906975854 1:50572260-50572282 GCAAACATTCAGATGTTTCAGGG - Intronic
907031954 1:51181019-51181041 GGAGGCAGGCAGAGGTTGCAGGG + Intergenic
908545856 1:65161415-65161437 GCATGCATGCAGGTAGAGCATGG + Intronic
908828873 1:68159638-68159660 GAATGCAGGCAGATGTGGTATGG - Intronic
910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG + Intronic
911155994 1:94637318-94637340 GGATGCTTCCAGATGTGGCAGGG + Intergenic
913003658 1:114606992-114607014 CCTTGCCTGGAGATGTTGCAGGG + Intronic
913110812 1:115655512-115655534 TCATACAGGCAGATGTTGCGTGG + Intronic
913179077 1:116302074-116302096 GCATGCATCCAGAGGTTGGCTGG + Intergenic
913381751 1:118218469-118218491 TCATGCATGGAGGTGTTACAAGG + Intergenic
915313248 1:155015066-155015088 GCTTGCATGGAGATTCTGCAGGG + Exonic
918579389 1:186108237-186108259 TCATGCATGTAGTTGTTGGAAGG + Intronic
921531785 1:216291754-216291776 GCATTCATTCAGATTTGGCATGG - Intronic
1064111121 10:12539810-12539832 CCATGCATGCATTTGTTGCCAGG - Intronic
1076184326 10:128434596-128434618 GCATGCATGAAGATGTCTTAAGG + Intergenic
1078713326 11:13816101-13816123 GCATAGATGCAGATGGGGCACGG + Intergenic
1080900377 11:36484169-36484191 CCGTGCATGCTGATGGTGCAGGG + Intergenic
1081850067 11:46269566-46269588 CCATGCATGCTGATGTTTGAAGG + Intergenic
1085296865 11:75436297-75436319 GCATGTGTGCAGAGGTGGCAAGG - Intronic
1087849816 11:103015438-103015460 TCTTGCATGCATATATTGCATGG + Intergenic
1099748097 12:86733470-86733492 GAAAGCAAGCAGATGTTGAAAGG + Intronic
1100313823 12:93424560-93424582 GAAAGCATGCAGATATTGGAGGG + Intronic
1102528387 12:113528362-113528384 GAATGCATGCTTATTTTGCAAGG + Intergenic
1102588711 12:113941561-113941583 GGATGAATACAGATGATGCATGG - Intronic
1105743423 13:23353094-23353116 GGATGCTTGCAGAAGTTGAAAGG + Intronic
1109944795 13:69419924-69419946 GCATGCAAGCTGCTGTGGCACGG + Intergenic
1111020578 13:82443932-82443954 GCATGCATGTATATGTTGGAGGG + Intergenic
1112179362 13:97062358-97062380 GCCTGCATGCAGGGATTGCATGG + Intergenic
1120121792 14:80689213-80689235 GCAGGGAGGCAGAGGTTGCAGGG + Intronic
1124126983 15:26945218-26945240 GCATGCCTGCAGATGCACCATGG - Intronic
1126506224 15:49406946-49406968 CCCTGCAAGCAGATGTGGCAAGG + Intronic
1127953315 15:63831870-63831892 GCAGGCACCCTGATGTTGCATGG - Intronic
1129018299 15:72489374-72489396 GCATTTGTGCTGATGTTGCAGGG + Intronic
1129868624 15:78927030-78927052 GCATGCATGCAAGTGTGGGAGGG - Intronic
1131729645 15:95266371-95266393 GCTTGCATGCAGACGTCCCAGGG + Intergenic
1131732077 15:95292805-95292827 GCATGCAGGCAAGTGTTGGAAGG + Intergenic
1135828902 16:25755456-25755478 GCATGCATGGAGAGGTTTGAGGG + Intronic
1137758042 16:50918201-50918223 GTCTGCATGCTGATGGTGCAGGG + Intergenic
1140016667 16:71193707-71193729 GAATGCTTCCAGATGCTGCAGGG + Intronic
1140608322 16:76567587-76567609 GCATGTATTCACAGGTTGCAGGG + Intronic
1141729728 16:85813637-85813659 GCATGCACGGTGCTGTTGCAGGG - Intergenic
1142056330 16:87998651-87998673 GCATGCATGGAGATGTGTCTGGG - Intronic
1142276783 16:89122997-89123019 GCATGCAGGCAGACCCTGCAAGG + Intronic
1142607361 17:1089550-1089572 GCATGGAGGGAGACGTTGCAGGG - Intronic
1143004827 17:3823250-3823272 GCAGGGAGGCAGAGGTTGCAGGG + Intronic
1143112180 17:4558921-4558943 GCGTGCATGCAGCAGGTGCAGGG + Exonic
1144459519 17:15446914-15446936 GCATGAATGAATATGTTGAATGG - Intronic
1148925826 17:51084191-51084213 GAATGCAAGCAGATGATGTAAGG + Intronic
1149009629 17:51841887-51841909 GCATGCCTGGATATGATGCATGG - Intronic
1149602474 17:57902113-57902135 GCAGGGAGGCAGAGGTTGCAGGG + Intronic
1151477297 17:74351412-74351434 GCAACCCTGCAGAGGTTGCAGGG + Intronic
1153818677 18:8813326-8813348 CCATGCATCCTGATGCTGCAAGG - Intronic
1156197668 18:34793917-34793939 ACATGTGTGCAGCTGTTGCAGGG - Intronic
1157041539 18:44045467-44045489 GCAAGCATGCAGATGAGGCCTGG + Intergenic
1162634225 19:11954199-11954221 GAAAGAATGCAGATGTGGCATGG + Intronic
1163098061 19:15074926-15074948 TCAAGCATGCAGATGTGTCAGGG + Intergenic
1167229394 19:48272071-48272093 GCCCGCATGCAGCGGTTGCAGGG + Intronic
925035528 2:682457-682479 GCATGAATTCAGAGGTTGAAAGG - Intergenic
925507844 2:4588725-4588747 GCAAGAATGAAGATGTGGCATGG - Intergenic
928321863 2:30290351-30290373 GAATGCCTGCACTTGTTGCAGGG - Intronic
929311775 2:40434023-40434045 GCATGCAGGAAGAGGTTGCCAGG - Intronic
930855686 2:56015444-56015466 CCATGTGTGCAGATTTTGCAGGG + Intergenic
931668943 2:64629618-64629640 CCAGGCATGCAGAGGTTTCATGG + Intergenic
934550861 2:95260753-95260775 GCATTCTTGCAGATGAGGCAGGG - Intergenic
935236095 2:101139419-101139441 GGATGCAGGCAGATGTGGCGTGG - Intronic
936498065 2:113039908-113039930 GCATGCAGGCAGATCCTGGAGGG + Intronic
936598592 2:113873623-113873645 GCATTCATGTAGGTATTGCAAGG - Intergenic
938107682 2:128544531-128544553 GCGTGCATGCAGACGGCGCATGG + Intergenic
938395470 2:130944125-130944147 GCATGACTGCAGATTTTTCATGG - Intronic
938829782 2:135038946-135038968 GCATGGATGCAGAGGTGGCCAGG + Intronic
941870152 2:170375700-170375722 GCATGCATGCACATATTTGAAGG - Intronic
947022647 2:225698320-225698342 GCATGCATGCAGTGGTTTCATGG + Intergenic
948207723 2:236171437-236171459 GCTTGCATGCAGATGTATGAAGG + Intergenic
1169861490 20:10157701-10157723 GCATCCCTTCAGATGTTGCAGGG + Intergenic
1170357236 20:15506013-15506035 GCAAGCCTACAGATGTGGCAGGG + Intronic
1174852880 20:54013092-54013114 GCATACATGCATACGTTGTATGG + Intronic
1178576831 21:33800905-33800927 GCAGGGAGGCAGAGGTTGCAGGG - Intronic
1178576835 21:33800922-33800944 GCAGGGAGGCAGAGGTTGCAGGG - Intronic
1178692512 21:34761349-34761371 TCATGCATGCAGCTCCTGCAAGG + Intergenic
1179031002 21:37719263-37719285 GCATGCATGCAGATGTTGCAGGG + Intronic
1179363313 21:40733118-40733140 ACATGCATGCAGGTGCTGGAGGG + Intronic
1184244016 22:43226860-43226882 GCATGCCTGCAGAGGGGGCAGGG + Intronic
950187619 3:10954804-10954826 GCATGCATGCAGTGTGTGCATGG - Intergenic
950590241 3:13931798-13931820 CCATGCATGGAGGTGTGGCAGGG - Intergenic
950710319 3:14809384-14809406 CCATGCATGGAGGTGTGGCAGGG - Intergenic
951591494 3:24270590-24270612 GCATCCATGCAATTCTTGCAAGG + Intronic
953002599 3:38949369-38949391 GCCTGGATGCAGTTCTTGCAGGG - Intronic
953158279 3:40394761-40394783 GGATGCATGCAGATGTGGGAAGG + Intronic
954183205 3:48897926-48897948 GCATTAATGAAGGTGTTGCAAGG + Intronic
957232362 3:77536740-77536762 AAATGAATTCAGATGTTGCATGG - Intronic
958427637 3:93997682-93997704 GCATGTATGCAGATGGTCTATGG - Intronic
959588984 3:108054625-108054647 GCATGGAGTCAGATGTTTCAGGG - Intronic
959778374 3:110199109-110199131 CCATGCAAGCAGATGCTGCTGGG - Intergenic
960113329 3:113867366-113867388 CCCTGGATGCAGAAGTTGCAGGG - Intronic
962838972 3:139216457-139216479 GAAAGCAGGCAGATGTTGGAGGG - Intronic
963224326 3:142846272-142846294 ACCTGCAGGCAGAGGTTGCAGGG - Intronic
970799309 4:19952729-19952751 GCATGCACTCAGCTGCTGCAAGG - Intergenic
973337330 4:48969970-48969992 CCATGCATGTATGTGTTGCAGGG - Intergenic
974790697 4:66684395-66684417 GCATGCAAACAGATGTCTCAGGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
985052586 4:186007588-186007610 ACATGCATTCAGATGTTGATTGG - Intergenic
985707671 5:1410775-1410797 ACATGCATGCACGTGTAGCAGGG - Intronic
985788695 5:1913640-1913662 GCATGCCTGCAGAGGTTCCGGGG + Intergenic
985812523 5:2100245-2100267 GCATACATGCAGTTGTTGGCTGG + Intergenic
986647149 5:9928541-9928563 GCTTGCTTGCAGCTGTTGAATGG - Intergenic
987228723 5:15870255-15870277 GCAGGCATTCAGGGGTTGCATGG + Intronic
994258656 5:97631156-97631178 GCATGTATGGAGATGTGACATGG + Intergenic
994496406 5:100518289-100518311 GCAGGAATGCTGATGTTTCATGG - Intergenic
1003074257 6:2970156-2970178 GCACCCAAGCAGATGTTGTACGG - Intronic
1005285795 6:24325479-24325501 ACATGCTTGAAGATGTCGCAAGG + Intronic
1007253054 6:40509574-40509596 GCATGCATGCAGATATGCCAGGG + Intronic
1007253082 6:40509737-40509759 GCATGCATGCAGGTATGCCAGGG + Intronic
1009840854 6:69072956-69072978 GCATAGATCCAGATGTTCCATGG - Intronic
1010664521 6:78612923-78612945 GCCAGCAAGGAGATGTTGCATGG - Intergenic
1011087875 6:83562718-83562740 GCAAGCAGGCAGAAGTTCCATGG - Intronic
1019640397 7:2100547-2100569 GGAGGCCTGCAGATGGTGCAGGG - Intronic
1026085229 7:67257873-67257895 GCATGCACACAAATCTTGCAGGG - Intergenic
1026691941 7:72557021-72557043 GCATGCACACAAATCTTGCAGGG + Intergenic
1028403671 7:90452807-90452829 GCATGCATGCATTTGGTGAAGGG + Intronic
1028741215 7:94278052-94278074 GTATGGAAGCAGAAGTTGCAGGG + Intergenic
1029228483 7:99046837-99046859 GCATGTATGCCCTTGTTGCAGGG - Intronic
1031077529 7:117227124-117227146 GAATGAATGGAGATGTTACAAGG - Intronic
1035955167 8:4069565-4069587 GCATCCATGCAGATGTATCTTGG + Intronic
1038397306 8:27256849-27256871 GCATTCAAGCAGAAGTTGGATGG - Intronic
1041887063 8:62822436-62822458 ACATACATGCTGATTTTGCATGG + Intronic
1043689709 8:83135085-83135107 GCATGTATTCAAATGTTCCAGGG - Intergenic
1045294988 8:100864666-100864688 GTATGTATGCAGATGTAGAAAGG - Intergenic
1045546314 8:103131989-103132011 GAATGCATGCAGATATTCTAGGG - Intergenic
1047670957 8:127146568-127146590 GCATGAATCCAGATTTAGCATGG - Intergenic
1048822669 8:138394219-138394241 CCCTGCAGGCAGATTTTGCATGG - Intronic
1048951751 8:139502237-139502259 GCAGACATGCAGATGGTGTAGGG - Intergenic
1049400647 8:142425456-142425478 ACATGCAAGCAGATGGTGGATGG - Intergenic
1054763011 9:69020217-69020239 GCATGCACCCAAATGCTGCAGGG - Intergenic
1058075835 9:100649926-100649948 GCATGCATGCATGTGTAACATGG - Intergenic
1058627647 9:106951798-106951820 GGAAGCATCCAGATGTTCCATGG + Intronic
1059755625 9:117290863-117290885 GCCACCATGCAGTTGTTGCAAGG + Intronic
1060212355 9:121718291-121718313 GCGTTCAGGCAGATGGTGCAAGG + Intronic
1061000106 9:127898059-127898081 GGATTCAAGCAGATGTGGCAAGG + Intronic
1185633128 X:1531372-1531394 GCATGCAGGAAGATGGGGCAAGG - Intronic
1185764392 X:2713554-2713576 GCGTGCATGCATATGTCACAGGG - Intronic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1192155584 X:68744090-68744112 ACATGCATGCATAGGTTGTAGGG - Intergenic
1193586844 X:83333020-83333042 GCATGCATGCACATATGGGAAGG + Intergenic
1199676153 X:150190875-150190897 GCATCCATTCTGATGGTGCAGGG - Intergenic