ID: 1179032010

View in Genome Browser
Species Human (GRCh38)
Location 21:37729191-37729213
Sequence CAAGGTCAAAACACTGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179032006_1179032010 18 Left 1179032006 21:37729150-37729172 CCACAATGTGAATTTAAATTTAG 0: 1
1: 0
2: 1
3: 30
4: 310
Right 1179032010 21:37729191-37729213 CAAGGTCAAAACACTGATGTTGG 0: 1
1: 0
2: 1
3: 16
4: 194
1179032005_1179032010 19 Left 1179032005 21:37729149-37729171 CCCACAATGTGAATTTAAATTTA 0: 1
1: 0
2: 6
3: 73
4: 557
Right 1179032010 21:37729191-37729213 CAAGGTCAAAACACTGATGTTGG 0: 1
1: 0
2: 1
3: 16
4: 194
1179032004_1179032010 20 Left 1179032004 21:37729148-37729170 CCCCACAATGTGAATTTAAATTT 0: 1
1: 0
2: 1
3: 67
4: 454
Right 1179032010 21:37729191-37729213 CAAGGTCAAAACACTGATGTTGG 0: 1
1: 0
2: 1
3: 16
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179032010 Original CRISPR CAAGGTCAAAACACTGATGT TGG Intronic
900573870 1:3373489-3373511 CTAGGTCAAAGCAAGGATGTGGG - Intronic
903646586 1:24899818-24899840 CTAGGCAAACACACTGATGTAGG - Exonic
904130509 1:28272292-28272314 CCAGGTAAGAACACTGATGGCGG - Exonic
906375565 1:45293967-45293989 GAAGGTCAAAACAGAGGTGTGGG + Intronic
908727099 1:67188211-67188233 TAAGGTCAACACACTGAAGATGG - Intronic
911112181 1:94201170-94201192 AAGGGTCAAATCAATGATGTCGG + Intronic
912998712 1:114557692-114557714 TAAGGACAAAAAAGTGATGTAGG - Intergenic
913701942 1:121382694-121382716 CTAAGTCACAACACTGCTGTGGG - Exonic
914042499 1:144063163-144063185 CTAAGTCACAACACTGCTGTGGG - Intergenic
914135588 1:144897325-144897347 CTAAGTCACAACACTGCTGTGGG + Exonic
916157845 1:161874145-161874167 CAAAGTCAGAACACTGATCTTGG + Intronic
918720687 1:187848809-187848831 CAAGGTCAGAACACTTAGGGTGG + Intergenic
920063134 1:203242240-203242262 AAAAGTCAAAAAACTGATGCTGG - Intronic
920489365 1:206401414-206401436 CTAAGTCACAACACTGCTGTGGG - Exonic
1066793183 10:39088980-39089002 GAAGGTCAAAAAACTGTTTTTGG + Intergenic
1067674598 10:48361256-48361278 AAAGATAAAAACACTGATTTTGG - Intronic
1067934441 10:50597058-50597080 CAAGGTCAAAGCACTGAGCCAGG - Intronic
1069165334 10:65151041-65151063 CATGTGCAAAACAATGATGTTGG + Intergenic
1072338817 10:94425844-94425866 AAATGTCAAAACATTGATGAAGG - Intronic
1072756644 10:98025913-98025935 CAAAGTGAAAACCCTGAGGTGGG + Intronic
1075532135 10:123238599-123238621 CAAGGTGAAATCACTGAACTTGG - Intergenic
1077981650 11:7307104-7307126 TAAGGTCAAAAACCTAATGTGGG - Intronic
1078132762 11:8626312-8626334 CAGGTTCAAGACACTGATTTTGG - Intronic
1078427313 11:11262234-11262256 CAAAGGCAAATCACAGATGTGGG - Intergenic
1079035617 11:17016925-17016947 CTAGGTCAAGACATTGAGGTTGG - Intergenic
1080200186 11:29659819-29659841 CAAGATGAAAATACTAATGTAGG + Intergenic
1081466736 11:43326225-43326247 CAAGGTCAAGACACTTTTGCAGG - Intronic
1082257989 11:50053578-50053600 CAAGGCAAAAACAATGAAGTGGG + Intergenic
1082653918 11:55829281-55829303 CAGGGTCAAAACACCAATCTCGG - Intergenic
1082672443 11:56052125-56052147 CAAGTTCAAAATCCTGAGGTGGG - Intergenic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1085578672 11:77630675-77630697 AAAGCTCAAAATACTGATTTTGG - Intronic
1086221320 11:84447161-84447183 CAAGGTCACAATAATGATGGTGG - Intronic
1091019022 11:132082100-132082122 CAAGGTTAAAACACTTTTGTAGG + Intronic
1093498718 12:19785200-19785222 AAAAGTCAAAAAACAGATGTTGG - Intergenic
1094460236 12:30689478-30689500 CTATGGAAAAACACTGATGTTGG - Intronic
1096851215 12:54438869-54438891 CAAGGTCATACAGCTGATGTGGG + Intergenic
1098922014 12:76311426-76311448 CAAGGACAAAACACATATATAGG - Intergenic
1100313871 12:93425281-93425303 CTAGAGCAAAACACTGATTTAGG - Intronic
1101246932 12:102892129-102892151 CAAGGCCAGAACACTGGAGTGGG + Intronic
1103141517 12:118552932-118552954 CAACTTGAAAACACTGATTTGGG - Intergenic
1104290542 12:127462392-127462414 CAAGGTTAAAACCAAGATGTTGG + Intergenic
1104748657 12:131224764-131224786 CAAGGTCAAACCACAGGGGTGGG + Intergenic
1105432917 13:20353408-20353430 CAAGGTCACAAGTCTGAAGTAGG + Intergenic
1107194021 13:37625511-37625533 CAGAGTCAAAACTCTGATTTGGG + Intergenic
1107506023 13:41034188-41034210 CAAGGTCAAAAAAGAGATTTGGG + Intronic
1108669151 13:52665157-52665179 CAAGCTCTCAAAACTGATGTTGG - Intronic
1110533362 13:76622810-76622832 CAAGGAAAAAACAGTGCTGTAGG - Intergenic
1111367774 13:87272084-87272106 CAATTACAAAACACTGAAGTTGG - Intergenic
1115566667 14:34630298-34630320 CAAGGTCAAGGCACCGAAGTCGG + Intergenic
1116348665 14:43830109-43830131 AAAAGTCAAAAAACTGATCTTGG + Intergenic
1118965460 14:70579338-70579360 AAAAGTCAAAAAACAGATGTTGG - Intergenic
1121003654 14:90471928-90471950 CAAGGTCTACACACTGCTTTTGG + Intergenic
1122344348 14:101049345-101049367 CAAAGTCAAAACCCTGACATTGG - Intergenic
1202908896 14_GL000194v1_random:98892-98914 GAAGATCAAAACACAGATGAAGG + Intergenic
1123923735 15:25088931-25088953 CCATGTCAAAAAACAGATGTTGG - Intergenic
1127313897 15:57776825-57776847 CCAGGTCTGAACACTGCTGTAGG - Intronic
1127381787 15:58437001-58437023 CAAGTGCAAACCACTGAAGTTGG + Intronic
1127479061 15:59361769-59361791 CAAGTTCAAAATACTGAAGGGGG - Intronic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1129282002 15:74492754-74492776 CAAGATCAAAACACTGCTTTTGG - Intergenic
1129573797 15:76718887-76718909 AAAGGTCAAAAAACAAATGTTGG + Intronic
1133514105 16:6490856-6490878 AACTGTCAAAAGACTGATGTTGG + Intronic
1135230303 16:20700156-20700178 CAAGTTCAAAAAGCTGAGGTTGG - Intronic
1136023944 16:27458003-27458025 CAAGGTCAAGACACTTTGGTGGG + Intergenic
1138312041 16:56034061-56034083 GATGTTCAAAACACTGATGAAGG - Intergenic
1139107770 16:63848965-63848987 CGTGGTCAAAACACTGTTCTAGG + Intergenic
1143590043 17:7879364-7879386 CCAGGTTAAAACTCTGATGTAGG - Intronic
1147357879 17:39911779-39911801 CAAGCACAAAATACTGATGTGGG + Intronic
1148892619 17:50819114-50819136 AAAGGTCACAACACAGATGTAGG + Intergenic
1150700788 17:67445171-67445193 ACAGGGCAAAACACTGAAGTCGG - Intronic
1150742804 17:67793006-67793028 CAAGTTCAAGACACTTTTGTAGG - Intergenic
1152242176 17:79166429-79166451 CAAGATCAAAAGACTTAAGTAGG + Intronic
1154252061 18:12752890-12752912 CAACGTTAAAGCACTCATGTAGG - Intergenic
1154340346 18:13497664-13497686 CCAGGTCAAAACACATATGGGGG + Intronic
1155013953 18:21813605-21813627 AAAGGTAAAAGCACTCATGTAGG - Intronic
1156082704 18:33357397-33357419 CAAGGTCAGAACAATTAGGTGGG - Intronic
1156123678 18:33876999-33877021 AAAGATCAAAACACTAATCTTGG - Intronic
1156544646 18:37951908-37951930 CAAGGTAAGAACCCTGACGTGGG + Intergenic
1156821858 18:41382802-41382824 CAAGGTATAGACACAGATGTTGG - Intergenic
1157558295 18:48627875-48627897 CCAGGGCAAAACTCTGGTGTGGG + Intronic
1159056326 18:63468388-63468410 CAAGTTCAAGACACTTTTGTAGG - Intergenic
1159066739 18:63577002-63577024 CATAATTAAAACACTGATGTTGG - Intergenic
1160312469 18:77808696-77808718 CAAAGTCAAAAAACAAATGTGGG + Intergenic
1161918371 19:7247716-7247738 CAAGGTCACAAAACAGATATAGG + Intronic
1164211472 19:23101546-23101568 CAAAGTCAAATCACTAAGGTGGG - Intronic
1164360312 19:27500578-27500600 CAATGTGGAAACACTGTTGTTGG + Intergenic
1166206269 19:41271549-41271571 CAAGAGCAAACCACAGATGTAGG - Intronic
1167671910 19:50858429-50858451 CCAGGCAAAAACACTGTTGTGGG - Intronic
925197967 2:1942592-1942614 AAAGGGCAAAACAGTGTTGTTGG - Intronic
925198833 2:1949909-1949931 CAATGTTAAAACACTTATTTTGG + Intronic
925594947 2:5545822-5545844 CAACATCAAAACTCTGAGGTAGG + Intergenic
926184830 2:10681584-10681606 CAAGGTAAAAACATTTATATTGG - Intronic
927741216 2:25571424-25571446 CAAGGTGAAAACATTAATGTGGG - Intronic
928145785 2:28774222-28774244 CTAAGTCAAAAGACTAATGTGGG - Intronic
929542492 2:42833161-42833183 CATGGTCACAAAACTGACGTGGG + Intergenic
929585580 2:43112192-43112214 CAAGCTCAAGACACTCCTGTGGG + Intergenic
929619497 2:43340374-43340396 CAAAGTCAAAACACAAATATAGG + Intronic
930661089 2:54053746-54053768 AAAGCTCTAAACACTGCTGTAGG - Intronic
932636091 2:73389096-73389118 AAAAGTCAAAAAACAGATGTTGG - Intronic
939755123 2:146100697-146100719 ACAGGTCAGAAAACTGATGTGGG - Intergenic
939945733 2:148408316-148408338 GGAGGTTAAAACACTGAAGTTGG - Intronic
941893637 2:170607784-170607806 ACAGGTCAGAACACTAATGTAGG - Intronic
942131439 2:172884203-172884225 CAACTTGAAAACACTGCTGTAGG - Intronic
942183452 2:173402426-173402448 GAATGGCCAAACACTGATGTCGG + Intergenic
944869036 2:203891637-203891659 CAATGTCAAGACACTGGGGTAGG + Intergenic
945059490 2:205896351-205896373 CAAGGTGGAGACACTGGTGTAGG - Intergenic
1169553571 20:6726509-6726531 GGAGGTCAAAACACTGATACTGG - Intergenic
1170761789 20:19257501-19257523 CAATGTCAAAACACAAATCTCGG + Intronic
1171184576 20:23116160-23116182 CAAGGTAAAAACATTGAACTAGG - Intergenic
1173628090 20:44488706-44488728 CAAGGACACAACCCTGACGTGGG + Intronic
1174274216 20:49391888-49391910 CAAGGTCCAAACTCTTATGGAGG + Intronic
1179032010 21:37729191-37729213 CAAGGTCAAAACACTGATGTTGG + Intronic
1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG + Intronic
1179878243 21:44282295-44282317 CAAGGGCACAGCACAGATGTGGG + Intergenic
1182841424 22:33393573-33393595 CAGGGTCAAAAGTCTGATTTGGG - Intronic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184596620 22:45517793-45517815 AAAGGAGAAAACACGGATGTGGG + Intronic
951591179 3:24266673-24266695 CAAAGGCAACACACTGATGTTGG + Intronic
954720722 3:52560174-52560196 GAAGGTAAAAACACTGGAGTAGG - Intronic
957216435 3:77325907-77325929 CAAGGTGAAAGCACGGATCTTGG - Intronic
957617288 3:82547013-82547035 TAATGTCAAAACTCTGCTGTGGG + Intergenic
959861094 3:111215729-111215751 CAAGGGAAAAGGACTGATGTTGG - Intronic
959901212 3:111663698-111663720 AAAAGTCAAAAAACAGATGTTGG + Intronic
960634031 3:119765988-119766010 CAAGGTCAAAAAATAGATGCAGG + Exonic
960848127 3:122023251-122023273 CAAGGTCAAAACCTTGGTGGGGG - Intergenic
964193241 3:154031041-154031063 CCAGGGCAAAACACTGCTCTGGG - Intergenic
967858776 3:194136673-194136695 CCAGCTGAAAACACTGATTTTGG + Exonic
969099307 4:4756926-4756948 TAAGGTCAAAACACTGATGGTGG - Intergenic
969176053 4:5399877-5399899 CAAGGTCAAATCACAGAAGCAGG + Intronic
969364386 4:6685730-6685752 CAAGGTCAACACCCTGGGGTGGG - Intergenic
969954483 4:10874384-10874406 CAAGGTCCAATCACTGATATGGG + Intergenic
970447524 4:16136554-16136576 AAAGGTCAGAAGACTGAGGTTGG + Intergenic
971007802 4:22394640-22394662 AAAGGTCAAAAGAATGAGGTAGG + Intronic
971026423 4:22593009-22593031 CAAGTTAAAAACACAGCTGTTGG - Intergenic
971548838 4:27922990-27923012 GAGGATCAAAAAACTGATGTTGG + Intergenic
971595858 4:28527444-28527466 CAAGGTCAAATCCCTGAGGTTGG - Intergenic
971770159 4:30885410-30885432 TAAGGGCAAAACACTAATATTGG + Intronic
974204584 4:58684368-58684390 CAAGTTCAAGACACTTTTGTAGG - Intergenic
974446585 4:61992272-61992294 CAAGGTAAAAACACTGGTTAAGG - Intronic
976275781 4:83276535-83276557 GAAAGTCAAAAAACAGATGTTGG + Intronic
976894830 4:90096893-90096915 CAAGTTCCAGACACTGTTGTAGG + Intergenic
979644506 4:123052901-123052923 CAATGGCAAACCACTGGTGTAGG + Intronic
981886304 4:149677081-149677103 CAGTGTCAAAACAGTGATTTTGG - Intergenic
981926297 4:150143709-150143731 GAAAGTCAAAAAACAGATGTTGG - Intronic
983455398 4:167956454-167956476 CAACCTCAAAACAGTGATGTTGG + Intergenic
983811178 4:172064541-172064563 CTAGGTCAGAACACTGCTCTTGG - Intronic
986437642 5:7749875-7749897 CAAGGGAAAAACACTGCTGTGGG - Intronic
990104116 5:52235343-52235365 GAAGGTCAAAAATCTGAAGTGGG + Intergenic
990819354 5:59819987-59820009 CAAGGTCAAATGACTGTTGAAGG - Intronic
991100806 5:62790557-62790579 CAAGGGCAGAACACGGAGGTGGG + Intergenic
991189630 5:63854517-63854539 CAGGGTCAACACACTGATGGAGG - Intergenic
991640283 5:68745132-68745154 CAAGGTCAAGGCACTAATCTTGG + Intergenic
993175619 5:84481635-84481657 CAACAACAAAACACTGATTTGGG + Intergenic
994127513 5:96185008-96185030 AAAAGTCAAAAAACAGATGTTGG - Intergenic
995048630 5:107676089-107676111 CAAGGTTAGAACACTGATCAAGG - Intergenic
996328675 5:122306083-122306105 CAAGATCAATACTCTGATGAAGG + Intergenic
997034086 5:130166626-130166648 CATGGGCACAACACTGCTGTGGG - Intronic
998928400 5:147153435-147153457 CAAGTTCAAGACACTTTTGTAGG - Intergenic
998941845 5:147292129-147292151 CAAGGTCAAAAAACTTGTGAGGG + Intronic
1000651963 5:163829677-163829699 CAATGTCAAAACAATGAGGCTGG + Intergenic
1000801086 5:165727185-165727207 CTAGGACAAATCACTGCTGTAGG + Intergenic
1001118240 5:168957372-168957394 CAAGGTCAACACACTAAAATGGG - Intronic
1001294664 5:170490534-170490556 CAAAGTCAAAAAACTGACATTGG - Intronic
1002418474 5:179133124-179133146 CCAGGTCGAGACACTGCTGTAGG - Intronic
1004899795 6:20183514-20183536 CAGGATGAAAATACTGATGTTGG - Intronic
1011289640 6:85763364-85763386 AAAAGTCAAAAAACAGATGTTGG - Intergenic
1011989940 6:93502050-93502072 GAACCTCAATACACTGATGTTGG + Intergenic
1012669331 6:102021031-102021053 CATGGTCACAACACTCATATGGG + Intronic
1013218311 6:108052003-108052025 CAAAGTAATTACACTGATGTTGG + Intronic
1013726492 6:113103585-113103607 CAAAGTAAAAATACTGATATTGG - Intergenic
1014563523 6:122919323-122919345 GGAGGTCAAAAGTCTGATGTGGG - Intergenic
1014727332 6:124987531-124987553 CAAGGTCCAAAAAATGCTGTTGG + Intronic
1024419655 7:49149267-49149289 AAAAGTCAAAAAACAGATGTTGG + Intergenic
1028848437 7:95509353-95509375 CAAGCTCAAACAACGGATGTGGG - Intronic
1031685072 7:124723325-124723347 CAAGGCCAAGACACAGATTTTGG + Intergenic
1032590336 7:133186431-133186453 CAGTGTCAGAAAACTGATGTTGG + Intergenic
1032676078 7:134130783-134130805 CCTGTTCAAAACACTGCTGTTGG + Intronic
1032986230 7:137340609-137340631 CAAGGTCATGTCACTGCTGTGGG - Intronic
1034572005 7:151963834-151963856 AAATATCAAAACATTGATGTTGG - Intronic
1036089522 8:5650336-5650358 CAAGGGCACAGCACTGATGCTGG + Intergenic
1039189497 8:34956551-34956573 AAAGCACACAACACTGATGTGGG - Intergenic
1039841975 8:41300425-41300447 CAAGCTCAAAACACTGAAGAAGG + Intronic
1041934690 8:63322310-63322332 CAAGAGGAAAACACTGGTGTAGG + Intergenic
1042068655 8:64906362-64906384 CAATATCAGAACACAGATGTGGG - Intergenic
1043346960 8:79309532-79309554 AAAAGTCAAAACACAGATGTTGG - Intergenic
1044792308 8:95860276-95860298 CCAGATCAAAACTCTGATGATGG - Intergenic
1047063562 8:121254808-121254830 CAAGGTAAAAACACTAACGTAGG + Intergenic
1048180948 8:132193652-132193674 CACGGTGAAAACATTGATGCAGG + Intronic
1048253810 8:132889569-132889591 CAAGGTTAACACATTGATCTTGG + Intronic
1048888498 8:138928101-138928123 CAAGGTGAGAAAATTGATGTGGG + Intergenic
1050004762 9:1118595-1118617 CAAGGTCAAAATCCTGAAGAAGG + Intergenic
1052547460 9:29898559-29898581 CAAGGTCAAAACACCATTTTTGG + Intergenic
1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG + Intergenic
1059495962 9:114709650-114709672 CATGGCCAAAACACTGCTCTTGG + Intergenic
1059742903 9:117170403-117170425 CTAGGTGACAACACTGATGAAGG + Intronic
1061584588 9:131557714-131557736 CAGGGTCACAACACTAATGGTGG - Intergenic
1186401856 X:9267649-9267671 CAAGGTCTAAACACAGCAGTGGG - Intergenic
1190785099 X:53638915-53638937 CTAGGTCAACCCAGTGATGTGGG - Intronic
1193087221 X:77457599-77457621 TAAGGTCAAAACACTAATTGGGG + Intergenic
1193554369 X:82934138-82934160 AAAAGTCAAAAAACGGATGTTGG + Intergenic
1194247551 X:91534743-91534765 CAAGTTCAGATCACTGAGGTTGG + Intergenic
1194457066 X:94118132-94118154 AAACGACAAAACACTGATGAAGG + Intergenic
1196127506 X:112115141-112115163 CAGGGTCCAAAGACTGTTGTGGG - Intergenic
1197340259 X:125257175-125257197 CTAAGTCAGAACAGTGATGTGGG - Intergenic
1199607250 X:149586643-149586665 CAAGGTCAGAACCCTGAGGGAGG - Intronic
1199631873 X:149782724-149782746 CAAGGTCAGAACCCTGAGGGAGG + Intronic
1200566573 Y:4776276-4776298 CAAGTTCAGATCACTGAGGTTGG + Intergenic
1200801178 Y:7388302-7388324 CAAGGTCCAGAGACTGTTGTGGG - Intergenic