ID: 1179035141

View in Genome Browser
Species Human (GRCh38)
Location 21:37753028-37753050
Sequence GTGGGCTGGGCAGGGAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 1, 2: 4, 3: 60, 4: 545}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179035132_1179035141 4 Left 1179035132 21:37753001-37753023 CCAAGAGTAAGAAGTGAAGAGGG 0: 1
1: 0
2: 3
3: 27
4: 267
Right 1179035141 21:37753028-37753050 GTGGGCTGGGCAGGGAACACAGG 0: 1
1: 1
2: 4
3: 60
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179035141 Original CRISPR GTGGGCTGGGCAGGGAACAC AGG Intronic
900080472 1:853249-853271 GTGAGCTAGGCAGGGCACAGTGG - Intergenic
900145450 1:1157198-1157220 ATGGCCTGGGCGGGGAGCACTGG + Intergenic
900402856 1:2479709-2479731 GCGGGGTGGGGAGGGAGCACGGG - Intronic
900407470 1:2498902-2498924 GAGGCCTGGGCAGGGCACCCGGG - Intronic
900919691 1:5662453-5662475 GTGGGCAGGGCTGGCCACACGGG + Intergenic
900935867 1:5766136-5766158 GCGTGCTGGGCTGGGAACTCAGG + Intergenic
901212261 1:7533327-7533349 GAGGGCAGGGCAGGTAACCCTGG - Intronic
901336071 1:8450464-8450486 CTGGACTGGGCTGGGAATACAGG - Intronic
901743349 1:11356473-11356495 GGGGGGTTGGCAGGGAACACCGG - Intergenic
901790777 1:11652826-11652848 GTGGGTTGGGCAGGGAGGAGAGG - Intronic
901821744 1:11834765-11834787 GGGGGCAGGGCAGGGGACACGGG + Intronic
901922695 1:12548123-12548145 CTGGGCTGGGCAGGCAGCAGCGG + Intergenic
902239768 1:15080781-15080803 CTGGGCTGGGCTGAGAACAGAGG + Intronic
902271736 1:15309858-15309880 GTATGCTGGGCAGAGAGCACAGG + Intronic
902334362 1:15746668-15746690 GTGGGCTGGGCAGTGAGTCCTGG + Intronic
902347814 1:15831709-15831731 GTGGGCTGGGCTGGGTGCAGTGG - Intergenic
902636799 1:17740000-17740022 CAGGGCTGGGCAGGGGACAGCGG + Intergenic
902817416 1:18924255-18924277 GGTGGGTGGGCAGGGAATACAGG - Intronic
902916080 1:19640530-19640552 GTGGGCTGGACTGGGAAGACAGG + Intronic
902988032 1:20167435-20167457 GTGGGGTGTGAAGGGAACAGAGG - Intronic
903231851 1:21927064-21927086 GTGGGCTGGGAAGGGGCCAGAGG + Intronic
903468581 1:23568984-23569006 GGGCGCTGGGCAGGGAAGTCTGG + Intergenic
903538428 1:24082535-24082557 CTGGGCTGGGCAGGGAGCTGGGG - Intronic
903604859 1:24568082-24568104 CAGGGCTGGGCCTGGAACACGGG + Intronic
903793973 1:25914264-25914286 GTGGGCTGGGGAATGCACACAGG + Intergenic
904463517 1:30694304-30694326 GTGGGCTGGGCTTTGAACCCAGG + Intergenic
904593786 1:31630219-31630241 ATGGCCTGGTGAGGGAACACAGG + Exonic
905179695 1:36157870-36157892 GTAGGCTGGGCTGGAAACAAGGG + Intronic
905825083 1:41021007-41021029 GTGGGTTGGGGAGGGAAGACAGG - Exonic
905933648 1:41807012-41807034 GTGGGCTGGGCGGGGAGGAAGGG - Intronic
906240014 1:44237040-44237062 ATGGGCTGGTCAGGGGACTCAGG + Intronic
906567446 1:46811196-46811218 GTTGGCAGGGCAGGGAAGGCAGG - Intronic
906686778 1:47767971-47767993 GTGGGCAGGGGAGGGAACCCGGG + Intronic
907136189 1:52141927-52141949 GCGGGCTACGCAGGGAGCACGGG + Intergenic
907158418 1:52354725-52354747 TTGGACTGGGCAGGGAAGGCAGG + Intronic
908271234 1:62424595-62424617 GTTTGGTGGGCAGGGAACAAGGG + Intergenic
909606268 1:77511733-77511755 GTGGCCTGGGCAGGGAGAGCAGG + Intronic
910238416 1:85060136-85060158 GTGGGTTGGGCTGGGGACAGAGG + Intronic
911692164 1:100846133-100846155 GTGGACAGGGCATGGAACAAGGG - Intergenic
912544953 1:110444008-110444030 GTGGCCTGTGCTGGGAACACTGG + Intergenic
912947613 1:114097805-114097827 AAGGCCTGGGCAGGGACCACTGG - Exonic
913384277 1:118242306-118242328 GTGGGCTGGGCAGGGAGGGCTGG - Intergenic
914196727 1:145451645-145451667 CTGGGTTGTGCAGGGAACCCCGG - Intergenic
914901192 1:151712040-151712062 GGAGGCTGGGAAGGGGACACTGG - Intronic
915312701 1:155012261-155012283 GTGGGGTGGGCAGGGAAGGAGGG + Intronic
915603721 1:156938142-156938164 GTGGGAGGGGCAGGGAAGCCTGG - Intronic
916160298 1:161905206-161905228 GCAGGGTGGGAAGGGAACACAGG - Intronic
916458983 1:165001721-165001743 GTGGCCTGGGCAGGAAAGAGAGG - Intergenic
916553763 1:165875306-165875328 TCAGGCTGGGCAGGGCACACAGG - Intronic
916633209 1:166638700-166638722 TTGGGCTGGGGAAGGAACAAAGG + Intergenic
917863950 1:179175396-179175418 CTGGGCAGGGCAGGGAACAGAGG - Intronic
918045121 1:180936682-180936704 CTGGGCTGGGCAGGAACCAGCGG - Intronic
919793760 1:201308862-201308884 GGGGGCTGGGCAGGGGCCAGTGG + Intronic
919798008 1:201332800-201332822 GTGGGCAGGGAAGGGAAGCCGGG + Exonic
920238758 1:204528439-204528461 ATGGCCTGGTGAGGGAACACAGG + Intronic
920504105 1:206504648-206504670 GGGGACTGGGCTGGGAAAACTGG + Intergenic
922709451 1:227815996-227816018 GGGGGAGGGGCAGGGGACACAGG - Intronic
923288636 1:232522046-232522068 GTGGGCTGTGAAGGGAAGGCAGG - Intronic
923340236 1:233000557-233000579 GTGGGCTGGGCAAGGACCAGAGG + Intronic
924948131 1:248859309-248859331 GTGGGCTGGGGTTGGAGCACAGG - Intergenic
1063024904 10:2168250-2168272 CAGGGCTGGGCAGGGCACAGAGG - Intergenic
1063431358 10:5991697-5991719 GTGGCCTGGGCATGTGACACAGG - Intergenic
1067237125 10:44460351-44460373 GTTGACTGGGCACTGAACACTGG + Intergenic
1067516476 10:46950500-46950522 GAGGTCTGGGAAGGGGACACAGG + Intronic
1067645776 10:48101293-48101315 GAGGTCTGGGAAGGGGACACAGG - Intergenic
1067723516 10:48748797-48748819 GTGGGCTGGGAATGGGAGACAGG + Intronic
1069621807 10:69841864-69841886 GTGGCCTGGGCAGGGAGCTTCGG + Intronic
1069822306 10:71235463-71235485 GTGGGCTGGGATGGGGACAGAGG + Intronic
1069997126 10:72349291-72349313 GTGGGCTGGCCAGGGAAGTGAGG + Intronic
1070546267 10:77455410-77455432 ATGGGCTGGGCAGGGAGGGCAGG - Intronic
1072743521 10:97924335-97924357 CTGGGCTGGACAGGAAACACAGG + Intronic
1073185335 10:101612310-101612332 GTGTGCTGGGCAGGGAGGACAGG - Intronic
1073942024 10:108710471-108710493 GTGGACTGTGCAGGAAACACAGG - Intergenic
1074490764 10:113937595-113937617 GTGAGCTGGTTATGGAACACAGG + Intergenic
1075556204 10:123434414-123434436 GTGTGCTGGGCTGGGGACTCAGG + Intergenic
1075634336 10:124020034-124020056 GGAGGCTGGGCAGGGAGCTCTGG - Intronic
1076401966 10:130190584-130190606 GTGGCCGGGGCAGGGCCCACAGG + Intergenic
1076604564 10:131681163-131681185 GTGGGCTGGGCAGGGCATGCAGG - Intergenic
1077134550 11:991959-991981 GTGGGCTGGGCAGGTGCCTCCGG + Intronic
1077220545 11:1413641-1413663 GTGGGCAGTGCAGGGAGCCCAGG - Intronic
1077494633 11:2880937-2880959 CTGGACTGGGCTGGGAAGACAGG - Intergenic
1077755715 11:5025442-5025464 TTGGGCTGGGGAAGGAACAAAGG + Intergenic
1077982247 11:7311923-7311945 GTGGGCGGGGGAGGGAAGGCAGG - Intronic
1078860176 11:15239589-15239611 GAGCGCTGGGCATGTAACACTGG + Intronic
1079149361 11:17883962-17883984 GTGGGGTGGGAAACGAACACCGG + Intronic
1080845179 11:36020742-36020764 GTGGGCTGGCCAGGATACCCAGG + Intronic
1081872367 11:46389319-46389341 CTGGGCTGAGCCGGGACCACTGG + Intergenic
1081922240 11:46789507-46789529 CTGGGCTGGGCTGGGCACAGTGG + Intronic
1083339280 11:61948409-61948431 GTTGGTTGGGAAGGGAATACAGG + Intergenic
1083657624 11:64237342-64237364 GGGGTCGGGGCAGAGAACACAGG - Intronic
1084169894 11:67396049-67396071 CTGAGCTGGGCAGGGAGGACAGG - Intronic
1084189124 11:67491008-67491030 GTGGGCTTGGCAGGTAAGGCAGG - Exonic
1084273364 11:68040328-68040350 GTGGGCAGGGCAGGGGGCAGCGG - Intronic
1084938059 11:72597671-72597693 GAGGCCTGGCCTGGGAACACAGG + Intronic
1085270517 11:75267271-75267293 GTGGGGTGGGCAGGGGACTGGGG - Intronic
1086158621 11:83695831-83695853 ATGGTCTGGGCAGAGAGCACAGG + Intronic
1087063735 11:94008610-94008632 ATGAGCTGGACAGGGAACCCAGG - Intergenic
1088649560 11:111945486-111945508 GTGGGCTGGGCAGCTACCCCAGG + Intronic
1088716050 11:112550939-112550961 GTGGGGTGGGAAGAGATCACAGG - Intergenic
1088968912 11:114754313-114754335 CTGGGAGAGGCAGGGAACACAGG - Intergenic
1089012906 11:115145219-115145241 GTTAGTTTGGCAGGGAACACCGG + Intergenic
1089347800 11:117802263-117802285 GAGGCCTGGTCAGGGAAAACTGG - Intronic
1089745319 11:120612871-120612893 CTGAGCGGGGCAGGGAACACAGG + Intronic
1090666498 11:128918211-128918233 GAGGGCTGGGCAGGGAGGGCAGG + Exonic
1090977038 11:131687543-131687565 GTGAGGTGGACAGGGAAGACAGG - Intronic
1090985308 11:131761066-131761088 GTGGGCAGGGCAGGGGAAGCGGG + Intronic
1091029294 11:132170010-132170032 CTGGGATGGAGAGGGAACACAGG + Intronic
1091170877 11:133518761-133518783 GGGGGCTGGGCTGTGAACAGTGG + Intronic
1091170887 11:133518800-133518822 GGGGGCTGGGCTGTGAACAGTGG + Intronic
1091313931 11:134597505-134597527 GCGGGCTGGGCAGGGATTCCTGG + Intergenic
1091445074 12:540393-540415 TTAGGATGTGCAGGGAACACAGG + Intronic
1091668245 12:2434669-2434691 GTGGGCTGGCCAGTGACCCCAGG - Intronic
1091991694 12:4960864-4960886 GTGGGCTGGGGAGGGAACACCGG + Intergenic
1092193027 12:6533936-6533958 GGGGGCTGGGAAGGAACCACGGG + Exonic
1092354948 12:7787081-7787103 GAGGGATGGGCAGGGAAGATTGG - Intergenic
1092367653 12:7890409-7890431 AAGGGATGGGCAGGGAAGACTGG - Intronic
1094477735 12:30854050-30854072 GTGGGCTGGGCAGGGGTTCCAGG - Intergenic
1096384579 12:51186644-51186666 GTGGGCTTGGCAGAGAATTCTGG + Intergenic
1096918719 12:55061045-55061067 GTGTGTTGGGCAGGGAATGCAGG + Intergenic
1097187596 12:57204055-57204077 CTGGGCTGGGAATGGAAGACCGG - Intronic
1097967419 12:65595840-65595862 GTGGGCTCTGCAGGCACCACAGG - Intergenic
1099948787 12:89276699-89276721 GTGGGCAGAGCAGTGAACAAAGG + Intergenic
1099958006 12:89369997-89370019 TTCGGCTGGGCATGGCACACTGG + Intergenic
1101131568 12:101696671-101696693 GTGGGCTGGGTCTGGCACACAGG + Intergenic
1101883175 12:108639673-108639695 GGCGGCAGGGCAGGCAACACGGG + Intergenic
1102842795 12:116144066-116144088 GTGTGCTGTGTATGGAACACAGG - Intronic
1102950298 12:117026594-117026616 GTGGGCTGGGAGGGGTGCACAGG - Intronic
1102988478 12:117297733-117297755 GTGTGCTGGGCAGTGGACAGAGG + Intronic
1103362968 12:120364572-120364594 ATGGGCTGGGCTGGGAAGAGGGG - Intronic
1103645157 12:122385996-122386018 TTGGGCTCGGCCGGGAGCACTGG + Intronic
1103727850 12:123007633-123007655 GGGGCTTGGGCAGGGGACACAGG - Intronic
1104906879 12:132218257-132218279 GAGGCCTGGGCTGGGAACACAGG - Intronic
1105422301 13:20263986-20264008 GTGGTCTGGGCAGGGTGCTCTGG + Intergenic
1105702751 13:22945412-22945434 GAGGGCTGGCGAGTGAACACAGG - Intergenic
1105855389 13:24367215-24367237 GAGGGCTGGCGAGTGAACACAGG - Intergenic
1106017712 13:25884917-25884939 GTTGACTCTGCAGGGAACACAGG + Intronic
1107261472 13:38496809-38496831 GGGGTCTGGGAAGGGAACAGGGG - Intergenic
1108147639 13:47496276-47496298 ATGGGGTGGGGAGGGAACAAAGG + Intergenic
1108407727 13:50122483-50122505 GTGGTCTGAGGAGGGAACCCTGG - Intronic
1109781762 13:67119871-67119893 GTAGGCTGGGCTGGTAACACTGG + Intronic
1110812542 13:79826715-79826737 GTGGGGTGGGCAGGTAATAAAGG + Intergenic
1112148066 13:96723658-96723680 GTGGGCTGTGAATGCAACACAGG - Intronic
1112362827 13:98732462-98732484 TTGGGGGGGACAGGGAACACAGG + Intronic
1112816464 13:103279216-103279238 GTGGCTTGGGAAGGGAACAGGGG - Intergenic
1112974738 13:105303669-105303691 GTGAGCTGGGCATGGATCAGAGG + Intergenic
1113886019 13:113658692-113658714 GCTGGGTTGGCAGGGAACACAGG + Intergenic
1114472649 14:22974409-22974431 GTAGGCTAGGCTGGGAACAAGGG + Intronic
1114651988 14:24291076-24291098 GAGGAGTGGGCAGGGAACAGAGG + Intronic
1118825834 14:69380492-69380514 TTGGGGTGGGCTTGGAACACAGG - Exonic
1119379197 14:74218008-74218030 GAGGGCTGGGTAGGGAGCATAGG - Intergenic
1119511559 14:75215553-75215575 GCAGGGTGGGCAGGGAGCACAGG + Intergenic
1119518684 14:75269344-75269366 GAGGGCTGGGCTGGGCCCACAGG - Intergenic
1119769414 14:77211075-77211097 GTGGGCTGAGCCAGGAACCCAGG - Intronic
1121561868 14:94881905-94881927 TAGGGCTGGGCTGGGAACCCCGG + Intergenic
1121582430 14:95040879-95040901 GTTGGCAGGGCAGGGAAGCCAGG + Intergenic
1121754482 14:96391809-96391831 GTGGGCTGGGCGGGGCGCGCCGG - Intergenic
1121790477 14:96695806-96695828 GTGGGCTGTCCAGGGACTACAGG + Intergenic
1122740619 14:103869767-103869789 CTGGGCTGTGCAGGGACCAGGGG - Intergenic
1122938362 14:104970254-104970276 GCGGGCTGGGCAGGGATGTCAGG - Intronic
1123111086 14:105867122-105867144 GTGGCCAGGGCAGGGCCCACAGG + Intergenic
1123128677 14:105968399-105968421 GGGGGTGGGGCAGGGGACACAGG + Intergenic
1123206431 14:106718014-106718036 AGGGGCTGAGCAGGGAACTCAGG + Intergenic
1123211517 14:106765423-106765445 AGGGGCTGAGCAGGGAACTCAGG + Intergenic
1123728280 15:23125330-23125352 GTGGGCAGGGCAGGGGAGGCAGG + Intergenic
1124381779 15:29173195-29173217 ATGGGCGGGGCAGGGTGCACAGG + Intronic
1125432861 15:39614437-39614459 GTGGGCCAGGCTGGGAACATGGG - Intronic
1127381643 15:58435482-58435504 GTGGGGTGGGGAGGGAATAGGGG + Intronic
1127797519 15:62451367-62451389 GTTGGCTGGGCTGGGCACAGTGG + Intronic
1128694150 15:69747786-69747808 GCTGGCTGGGCAGGGCCCACGGG - Intergenic
1128754222 15:70170478-70170500 GCTGGCTGGGGAGGGGACACAGG - Intergenic
1129251086 15:74309300-74309322 GTGGAGTGAGCCGGGAACACAGG - Intronic
1129394058 15:75234756-75234778 GTGGGCTGGGCCTGGACCAGGGG - Intergenic
1129665200 15:77575743-77575765 GTGGGCAGGGCGGGGAACTCGGG - Intergenic
1129725320 15:77898659-77898681 GTTGGCTTGGCATGGGACACAGG + Intergenic
1129775235 15:78232467-78232489 GTGAGCTTTGCAGGGCACACAGG + Intronic
1129803867 15:78438263-78438285 GGAGGCCGGGCAGGGAAGACGGG - Exonic
1130762595 15:86835755-86835777 GAGACCTGGGCAGGGAACAAAGG + Intronic
1130796668 15:87217061-87217083 GTGGGAGGTGTAGGGAACACTGG - Intergenic
1130975840 15:88773489-88773511 GTGGGATGGGAAAGGAAGACAGG + Intergenic
1131016247 15:89059871-89059893 CTGGCCTGGGCAGGGGACAGTGG - Intergenic
1131228290 15:90642890-90642912 GGGGGCTGGGGAAGGAAGACAGG + Intronic
1132370533 15:101294954-101294976 CCGGGCTGCGCAGGGAACGCCGG - Intronic
1132656907 16:1045243-1045265 CAGGGCTGAGCAGGGAGCACAGG - Intergenic
1132669806 16:1097933-1097955 GTGGGGTGGGCAGGGAGCGCGGG + Intergenic
1132678692 16:1130980-1131002 GTGGGGTGGACAGGGCACAGTGG + Intergenic
1132858271 16:2057237-2057259 GTGTGCTTGGCAAGGGACACTGG - Intronic
1132861327 16:2073194-2073216 CCGGGGTGGACAGGGAACACTGG - Intronic
1132895906 16:2229302-2229324 GTGGGCTGGACCTGGAGCACAGG - Intronic
1132945654 16:2530316-2530338 ATGGGGTGAGCAGGGCACACTGG - Exonic
1132946160 16:2532419-2532441 GGGGGCTTGGCAGGGAGCGCTGG - Intergenic
1133009980 16:2905450-2905472 GTGGGCAGGGGAGGGACCAGTGG + Intergenic
1133332078 16:4981035-4981057 GTGGGCAGGGCAGATCACACAGG + Intronic
1134203301 16:12216699-12216721 GTGGGGTGGGGAGGGCACATGGG - Intronic
1134814325 16:17193532-17193554 GAGGGTTGTGCAGGGGACACAGG + Intronic
1136188611 16:28602235-28602257 GCCGGCTGTGCAGGGAGCACCGG + Intergenic
1136191081 16:28615229-28615251 GCCGGCTGTGCAGGGAGCACCGG + Intronic
1136508334 16:30720813-30720835 GTGGGCTGGGCTGAGAGCTCAGG - Exonic
1137268363 16:46886206-46886228 GTGGGCCGGGCAGAGAACACAGG + Intronic
1138442004 16:57040871-57040893 GTGGGCTGGGCAGGGGAGGTAGG - Intronic
1138507266 16:57484612-57484634 GAGGGGTGGGCAGGGGACCCAGG - Intronic
1139132049 16:64158403-64158425 TTGGGCTGTGGAGGGCACACTGG + Intergenic
1139514646 16:67446000-67446022 CTGAGCTGGGCACTGAACACGGG + Intronic
1139923178 16:70472195-70472217 GTGGGCTGGGCCTGGAACCCAGG + Intronic
1140456573 16:75109235-75109257 GCGGGCTGGGCAGGCAGCTCGGG + Exonic
1141141729 16:81500774-81500796 GTGGGCCGGGGAGGGCACAGTGG - Intronic
1141573865 16:84951709-84951731 GTGGGCGGGGCCGGGAACAATGG + Intergenic
1142031095 16:87838995-87839017 GCAGGCTGGGCAGGGGTCACTGG - Intronic
1142058542 16:88015460-88015482 GTGGCCAGAGCAGGGAACATAGG - Intronic
1142215086 16:88826117-88826139 CCAGGCTGGGCAGGGAACAGGGG + Intronic
1143552092 17:7636578-7636600 GTGGGGAAGGCAGGGGACACTGG - Intergenic
1143723261 17:8828484-8828506 GTGGGCTGGTGAAGGATCACAGG - Intronic
1143724898 17:8838021-8838043 GTGGGGAGGGGAGGGCACACAGG + Intronic
1143725992 17:8846902-8846924 GAGGACAGTGCAGGGAACACAGG - Intronic
1143782558 17:9236896-9236918 GAGGGTTGGGCAGGGCTCACTGG + Intronic
1144494174 17:15736434-15736456 ATGGGGTGGGCAGGGAACAGTGG + Intronic
1144639877 17:16931393-16931415 ATGGGGTGGTCAGGGAACAGCGG - Intronic
1144782925 17:17816913-17816935 GTGGGCAGGGCAGGGACCCCAGG - Intronic
1144784146 17:17822656-17822678 GTGGGCAGGGCTGGGAGCTCAGG - Intronic
1144906087 17:18640242-18640264 ATGGGGTGGGCAGGGAACAGTGG - Intronic
1144941970 17:18948211-18948233 GTGGGCTTGGCTGGGACCCCAGG + Intergenic
1144942025 17:18948520-18948542 GTGGGCTCGGCTGGGACCCCAGG - Intergenic
1144953036 17:19004233-19004255 GGGGGCGGGGCCGGGAACTCAGG + Intronic
1145975109 17:28979392-28979414 ATGGGCTAAGCAGAGAACACAGG - Intronic
1145993308 17:29091945-29091967 GTGGGCTGGGCAGGGGGAAGGGG + Intronic
1146401616 17:32504329-32504351 GTGGGCAGGGAAGGGAAGAATGG - Intronic
1146574100 17:33976842-33976864 GTGGGCAGGGGAGGGAAAAGTGG + Intronic
1148211160 17:45809535-45809557 CTGGGCTGGGCTGGGGGCACGGG - Intronic
1148430903 17:47642723-47642745 ATGTGCTAGGCAGGAAACACAGG + Intergenic
1148445193 17:47733362-47733384 CTGGGATGGGCAGGGAGCAGGGG - Exonic
1148849579 17:50548162-50548184 GTGGGTTGGGCTGGGAGCAGGGG + Intronic
1149309513 17:55380317-55380339 GTGGGCTGGGAAGGGACCTCAGG + Intergenic
1149654908 17:58305082-58305104 GCGGCCTGGACAGGGAACCCAGG - Exonic
1149684484 17:58527568-58527590 GAGCGCTGGGCAGTGAACCCTGG - Intronic
1150614239 17:66756504-66756526 GAGGGCTGGACATGGCACACTGG - Intronic
1150629411 17:66868513-66868535 GTGGGGTCAGCAGGGAAAACAGG + Intronic
1151306806 17:73267812-73267834 GTGGAGAGAGCAGGGAACACTGG - Intergenic
1151340991 17:73470950-73470972 CAGGGCTGGGAAGGTAACACTGG + Intronic
1151494776 17:74452914-74452936 CTTGTCTGGGCAGGAAACACTGG - Intergenic
1151554157 17:74838082-74838104 GTGGGATTTGCAGGGAACTCGGG + Exonic
1151875748 17:76867480-76867502 GTGGGCAGGGCAGGCAGCAAGGG + Intergenic
1151920445 17:77150718-77150740 GTTGGTTGGGCAGGGGGCACAGG + Intronic
1152225422 17:79090517-79090539 GGGGGCTGGGAAAGGAAGACTGG + Intronic
1152514441 17:80814980-80815002 GTGGTCTGAGCAGAGCACACAGG + Intronic
1152553227 17:81040185-81040207 GGTGGCTGGGAAGGCAACACAGG - Intronic
1152569499 17:81115483-81115505 GTGGGCTGGGCAGGGCAGGGCGG - Intronic
1152710425 17:81868402-81868424 GGGGGCTGGCCAGGGAGCAGCGG + Exonic
1153525353 18:5989886-5989908 CAGGGCTGGGCAGGCACCACTGG + Intronic
1153709703 18:7785045-7785067 GAGGGGTGGGAAGGGAGCACAGG + Intronic
1154326268 18:13393083-13393105 GTGGGGTGGGAAGGGCACGCCGG - Intronic
1156382705 18:36578528-36578550 TGGGGGTGGGCAGTGAACACAGG - Intronic
1157382552 18:47232579-47232601 GAGGCCTGTGCAGGGAACTCTGG - Intronic
1157447510 18:47756327-47756349 GTGGGCTGGCCAGAAAACAGAGG - Intergenic
1157504636 18:48217806-48217828 CTTGGGTGGCCAGGGAACACTGG + Intronic
1158395901 18:57078185-57078207 GTGGGCTGGGCAGGGGAGACTGG + Intergenic
1158579397 18:58668565-58668587 GTGGGCTGAGCATGGAATAAGGG + Intergenic
1159444335 18:68522047-68522069 CTGGTCTGTGCAGGGAACACAGG + Intergenic
1160048349 18:75408320-75408342 ATGGTCGGGGCAGGGTACACAGG + Intronic
1160200169 18:76789161-76789183 CGTGGCTGGGGAGGGAACACGGG - Intergenic
1160356644 18:78232815-78232837 GTCGGCTGGCGAGGGGACACAGG + Intergenic
1160810850 19:1012357-1012379 GGGGGCTGTGCAGGAAGCACTGG - Intronic
1160870578 19:1275994-1276016 GTGGGCGGTGCAGGGGCCACGGG + Intronic
1161038583 19:2098368-2098390 CTGGGCCTGGGAGGGAACACTGG + Intronic
1161321707 19:3644437-3644459 GTGGGCAGGACAGGGAACTCGGG - Intronic
1161616616 19:5274421-5274443 GTGGGCAGGGCATGGAATGCAGG - Intronic
1161636213 19:5390879-5390901 GGGGGGAGGGCAGGGAAGACAGG - Intergenic
1161638884 19:5407115-5407137 GTGGGTGGGGCTGGGAAAACCGG + Intergenic
1162112014 19:8404532-8404554 GTGGGGTGGGCTGGGGAGACGGG - Intronic
1162188085 19:8922727-8922749 GTGGGCGGGGCAGGGAAAGGTGG + Intronic
1163266578 19:16225934-16225956 ATCGGCTGAGCAGGGACCACAGG + Intronic
1163636057 19:18437669-18437691 GTCGGCTGGGGCGGGAACAACGG - Exonic
1163665976 19:18604253-18604275 CGGGGCTGGGCGGGGGACACCGG + Intronic
1164565097 19:29320154-29320176 GTGGGATGGGGATGGCACACTGG - Intergenic
1164571997 19:29381310-29381332 GTGTGCAGCACAGGGAACACTGG - Intergenic
1164642003 19:29832992-29833014 CTGGGCTGCGCAAGGCACACAGG - Intergenic
1164737493 19:30552686-30552708 TTAGGATGGGCAGGGCACACTGG - Intronic
1165423913 19:35735335-35735357 GTGGGCTGGGGACTGACCACTGG - Intronic
1165815681 19:38640611-38640633 CTGGGCTGGGGAGTGAACTCAGG - Intergenic
1166170370 19:41024180-41024202 GTGGGGAGGGCAGACAACACAGG - Intergenic
1166178690 19:41091970-41091992 GTGGGGTGGGCAGACGACACAGG + Intronic
1166257218 19:41615139-41615161 GGGGGCTGGGCGGTGAACAGAGG + Intronic
1166738116 19:45098025-45098047 GTCTGCAGGGCAGGGATCACTGG - Intronic
1166800842 19:45456064-45456086 GGGGGTTGGGCCGGGCACACAGG + Intronic
1166816352 19:45548503-45548525 TGGGGTGGGGCAGGGAACACTGG + Intronic
1167201163 19:48066523-48066545 GTGGCCTGGGAAGGGAACCCTGG - Intronic
1167271600 19:48509410-48509432 GTGGGCTGGGGAGGGGAGGCAGG - Intronic
1167526701 19:49988771-49988793 GTGAGCTGGGCCTGGCACACGGG - Intronic
1167528346 19:49999625-49999647 GTGGGCTGGGAGGGGAGCACAGG - Intronic
1168101137 19:54141740-54141762 GTGTGCAGGGCAGGGAACCCTGG - Exonic
1168143162 19:54403133-54403155 GTGGGTGGGGCAGGGTAAACAGG - Intergenic
1168163834 19:54533181-54533203 GTGGGCTTTGCAGTGAGCACTGG + Intronic
925776399 2:7340115-7340137 GTGGGCTGGGGAGGAGGCACTGG + Intergenic
925888000 2:8410208-8410230 GTGGGCTGGAGATGGAACAGAGG + Intergenic
926737654 2:16085931-16085953 GGGTCCTGGGCAGGGACCACTGG + Intergenic
926765465 2:16319598-16319620 GTGGGCTGGGCCGGCAGCACAGG - Intergenic
927365447 2:22290439-22290461 GTGGGATGGGTAGTGAGCACTGG + Intergenic
927493982 2:23540174-23540196 GGGGGCTGGGCAGGTACCAGGGG - Intronic
927929925 2:27037534-27037556 GTGGGGTGGGGAGGAAAGACAGG - Intronic
928449666 2:31367079-31367101 GTGGTCTGGGCAGGAAGCAATGG + Intronic
928511649 2:32009680-32009702 GCGGGGAGGGCAGGGAAGACGGG + Intronic
929935493 2:46291769-46291791 GAGATCTGGGCAGGGATCACAGG - Intergenic
930812809 2:55560489-55560511 GTGGCCTGGGCTGGGCACAGTGG + Intronic
933321305 2:80778887-80778909 ATGGGCAAGGCAGAGAACACTGG - Intergenic
934648490 2:96073140-96073162 GTGTGCTGGGCAGAGAAGAAGGG + Intergenic
934841724 2:97628164-97628186 GTGTGCTGGGCAGAGAAGAAGGG + Intergenic
935213406 2:100957111-100957133 GGGGGCAGGGGAGGGAAGACAGG + Intronic
935302544 2:101705379-101705401 GTGTGCTGGGCAGGGAACCCAGG - Intronic
936512843 2:113162348-113162370 GTGGGCAGGGCAGGGCACTGAGG - Intronic
937204664 2:120227728-120227750 GTGGGCTGAGCAGCGAGCACGGG + Intergenic
938098008 2:128475797-128475819 CTGGGCTGGGCTGGGCACCCTGG - Intergenic
938305946 2:130253983-130254005 ATGGGCTGGGCAAGGCACTCTGG + Intergenic
938339665 2:130527066-130527088 GAGGGGTGGGGAGGGGACACAGG + Intronic
938350171 2:130593684-130593706 GAGGGGTGGGGAGGGGACACAGG - Intronic
938448208 2:131393788-131393810 ATGGGCTGGGCAAGGCACTCTGG - Intergenic
938740458 2:134226832-134226854 AGGGGCTGGGCAGGTCACACAGG + Intronic
939908455 2:147949416-147949438 TAGGGCTGGGGAGGGAACAGGGG + Intronic
941251727 2:163173364-163173386 GGTGGCTGGGCAGGAAACATAGG + Intergenic
941420899 2:165281973-165281995 GTGGCCTGGGCAGGGAGCAGGGG - Intronic
942120663 2:172773600-172773622 GTGGGGTGGGGAGGGAAGTCTGG - Intronic
942639308 2:178044609-178044631 GGGGGCTGGGCAGGGGATTCAGG - Intronic
945804620 2:214475268-214475290 ATGGGCTGGGCAAGGAACAAAGG + Intronic
946229038 2:218280359-218280381 GTGGCGTGGGCTGGGCACACAGG - Intronic
946239466 2:218344987-218345009 GTGGGCTGGGCTGGGGGCGCTGG - Exonic
946328126 2:218995289-218995311 ATGGGCTGAGTATGGAACACTGG - Intergenic
946718251 2:222576383-222576405 AAGGGGGGGGCAGGGAACACTGG + Intronic
947533666 2:230927959-230927981 GAGAGCTGGTCAGGGAACAGGGG + Intronic
947840036 2:233201974-233201996 GTGGGGCGGGCGGGGAAGACTGG - Intronic
948275139 2:236702792-236702814 GTAGGGAGGGCGGGGAACACGGG - Intergenic
948816053 2:240510887-240510909 GAGGCCTGGGCAGTGAACACAGG - Intronic
948827186 2:240578411-240578433 GTGTGGGGGGCAGGGGACACAGG + Exonic
948863234 2:240762982-240763004 GGGGGCTGGGCAGGGAGGGCGGG + Intronic
948885074 2:240878322-240878344 GTGGGCTGGGGTGGGAGCAGGGG - Intronic
1168830966 20:845153-845175 CTGGCCTCGGCAGGGGACACGGG - Exonic
1169174889 20:3502465-3502487 GTGGGAGGGTCAGGAAACACCGG - Intronic
1169245023 20:4018292-4018314 GTGGGCTGGGGAGGCTCCACAGG + Intergenic
1169558126 20:6770072-6770094 GAGGACTGGGCGGGGAACTCGGG + Intronic
1170743179 20:19075605-19075627 CTGGGCTGGGGAGGGTACCCAGG - Intergenic
1171262852 20:23748514-23748536 GTGTGCTGGGCAGGGAGAAGGGG - Intronic
1171271979 20:23824718-23824740 GTGTGCTGGGCAGGGAGAAGGGG - Intronic
1171370755 20:24660827-24660849 CCTGGCTGGGCAGGGAACAAAGG - Intronic
1171504531 20:25623161-25623183 GTGGACTGGGGCTGGAACACGGG + Intronic
1171750577 20:29044670-29044692 GTGGGGTGGGGAGAGAACACAGG + Intergenic
1171905911 20:30899621-30899643 GTGGGGCGGGCGGGAAACACTGG - Intergenic
1172110197 20:32540104-32540126 CTGGGCTGGGCAGGGGAGGCTGG + Intronic
1172807058 20:37619645-37619667 GTGGTCTAGGCAGGGGACATAGG + Intergenic
1173056949 20:39623968-39623990 GTGGGCTGGGGAGGGGATATAGG - Intergenic
1173454423 20:43191111-43191133 GTTGGCATGGCAGAGAACACAGG + Intergenic
1173669395 20:44787508-44787530 CAGGGCTGGGACGGGAACACCGG + Intronic
1174298986 20:49568399-49568421 GTGGGCTGGGGAGTGATCAAGGG + Intergenic
1175238220 20:57526993-57527015 GTGGGCTGGACAGGGCAGAGTGG + Intergenic
1175420506 20:58829488-58829510 GAGGGCTGGGCAGGGATCTCTGG - Intergenic
1175726305 20:61320889-61320911 GTGGGCAGGGCGGGGTGCACAGG + Intronic
1175942802 20:62545736-62545758 GTGGGCAGGACAGGGGACTCTGG - Intergenic
1176091679 20:63321120-63321142 TTGGGGTGACCAGGGAACACTGG + Intronic
1176122393 20:63460080-63460102 CTGGGCTGGGATGGGGACACTGG - Intronic
1176213889 20:63939287-63939309 GTGGGCACGGCAGAGAGCACGGG + Intergenic
1176314630 21:5231245-5231267 ATGGGGTGGGGAGAGAACACAGG - Intergenic
1176413606 21:6462047-6462069 GTGGAGTGGGCAGGGAAGACAGG - Intergenic
1178880420 21:36445850-36445872 GTTGGCTGGGTATGGAAAACGGG - Intergenic
1178902994 21:36612749-36612771 GTTGTTTGGGCAGGGAACAGAGG - Intergenic
1178919696 21:36730463-36730485 GGGGGCTGGGCAGGGGACAGTGG + Intronic
1178933836 21:36843430-36843452 GTGGGGTGGGCGGGGAGGACAGG - Intronic
1179035141 21:37753028-37753050 GTGGGCTGGGCAGGGAACACAGG + Intronic
1179608912 21:42536347-42536369 ATGGGCTGGGCTGGCAGCACAGG - Intronic
1179689104 21:43070370-43070392 GTGGAGTGGGCAGGGAAGACAGG - Intronic
1180071391 21:45438408-45438430 CAGGGCTGGGCAGGGGACCCCGG + Intronic
1180083464 21:45497201-45497223 GTGGGCTGGGCGTGTAGCACTGG - Intronic
1180392421 22:12297202-12297224 GTGGGATGGGGAGAGAACACAGG - Intergenic
1180407325 22:12567560-12567582 GGGGGATGGGGAGAGAACACAGG + Intergenic
1180998303 22:19976366-19976388 GTGAGCAGGGCAGGGACCCCAGG - Intronic
1181013856 22:20057244-20057266 GTGGGCCAGGCAAGGACCACAGG - Intronic
1181314419 22:21962322-21962344 GGGTGCTGGGCTGGGCACACAGG + Intronic
1181403572 22:22666598-22666620 CTGGGCTGGGCAGGGCAGATTGG + Intergenic
1181405878 22:22685007-22685029 GTGGGCTGGGCAGGGCAGATTGG + Intergenic
1181408577 22:22702581-22702603 CTGGGCTGGGCAGGGCAGATTGG + Intergenic
1182072702 22:27474977-27474999 GAGGGCTGGGCAGGTAAAGCAGG - Intergenic
1182554733 22:31123065-31123087 GGGGCATGGGCAGGGAACCCAGG - Exonic
1183258089 22:36775994-36776016 AGGGGCTGGGCGGGGAGCACAGG - Exonic
1183268267 22:36844343-36844365 GATGGCTGAGGAGGGAACACTGG - Intergenic
1183306501 22:37085861-37085883 GGTGGCTGGGCCTGGAACACGGG - Intronic
1183307400 22:37089878-37089900 ATGGGCTGGGCAGGGGAGCCGGG + Intronic
1183409513 22:37646758-37646780 GTGGGCAGGGCAGGACACCCTGG - Intronic
1183585492 22:38750821-38750843 GAAGGCTGGGCAGGGAGCCCCGG - Intronic
1183988802 22:41584368-41584390 ATGGTCTGGCCAAGGAACACAGG + Exonic
1184015314 22:41781653-41781675 GTGGGCAAGGCAGGGCCCACAGG - Intronic
1184066667 22:42125443-42125465 ATGGGCTGGGCTGGGCACACAGG - Intergenic
1184069135 22:42137595-42137617 ATGGGCTGGGCTGGGCACACAGG - Intergenic
1184370143 22:44076854-44076876 GAGGGCTGGGGAGGGGGCACAGG - Intronic
1184647540 22:45904247-45904269 GGGAGCTGGCCTGGGAACACTGG - Intergenic
1184837836 22:47034539-47034561 GTGGGCTTGGCAGTGACCTCAGG - Intronic
1184899207 22:47433785-47433807 GAGGGTTGGGCCGGGGACACAGG + Intergenic
1185186869 22:49406516-49406538 GAGGGCCGTGCTGGGAACACTGG + Intergenic
1185323882 22:50216275-50216297 GTGGGGTTGGCTGGGAGCACCGG + Intronic
1185324305 22:50218141-50218163 GTGGGCTGAGCCGTGACCACAGG + Intronic
1185345979 22:50310979-50311001 GGGTGCTGGCCAGGGGACACAGG - Exonic
949946068 3:9191090-9191112 GTGGGATGGGCTGGGAACTGAGG - Intronic
950131404 3:10549363-10549385 CAGGGCTTGGCAGGGAGCACAGG + Intronic
950140796 3:10613781-10613803 GTGGGCTGGGTGGGGGATACAGG - Intronic
950719830 3:14875078-14875100 CTGGGGCAGGCAGGGAACACAGG - Intronic
951543705 3:23806267-23806289 GGGGGATGGGCAGGGACCCCGGG + Intronic
952280551 3:31919095-31919117 GTGGTCTGGGCAGGGCATTCTGG - Intronic
952763006 3:36931970-36931992 GAGGGTGGGGCAGAGAACACAGG + Intronic
952926644 3:38325406-38325428 GTGGGCAGTGCAGGGGACTCTGG + Intergenic
953158547 3:40396882-40396904 GTGGGCTGAGCAGGTCACAGTGG - Intronic
953914340 3:46909056-46909078 GTGGGCTGGGCAGGGGTGTCTGG - Intergenic
954314877 3:49795646-49795668 GTGGGCTGGGCACCGGAGACAGG + Exonic
954428923 3:50458912-50458934 GTGGGCTGGGCCAGAAACCCGGG - Intronic
954672871 3:52299865-52299887 GAGGGCAGGGTAGGGAGCACAGG + Intergenic
955221034 3:57023588-57023610 GTCCTCTGGGCTGGGAACACTGG - Intronic
955350585 3:58190389-58190411 CTGGCCTGGGCAAGGAACTCTGG - Intergenic
958587779 3:96113577-96113599 GTGGGCTAGGCACGGTAAACTGG - Intergenic
960047691 3:113212851-113212873 GTGGGGAGGGCAGGGAACCCAGG + Intronic
960943938 3:122953236-122953258 GAGGCCTGGGAAGGGAGCACAGG - Intronic
961494827 3:127284067-127284089 GCAGAGTGGGCAGGGAACACTGG + Intergenic
961633996 3:128321568-128321590 GTGGCCTGGGCAGGCAGCAGGGG - Intronic
961714193 3:128847563-128847585 GTGAGCTGGGCAGGGAGGAAGGG + Intergenic
961745239 3:129060389-129060411 GTGGGCTGGGCAGCTCCCACTGG - Intergenic
961765387 3:129206345-129206367 GTGAGGTGGGCAGGGCACAGTGG - Intergenic
962134992 3:132722875-132722897 GTGGGCGGGGCAGGGCAAACGGG + Intergenic
967445904 3:189566219-189566241 GTGGGCAGGGCAGTTAACAGGGG + Intergenic
968450698 4:674734-674756 GTGGCCTGGGCAGGGACCTGGGG + Intronic
968554652 4:1240770-1240792 GTGGGCTGTCCGGGGAACCCTGG - Intronic
968905226 4:3447741-3447763 GGGGGCAGGGCAGGGAGGACAGG + Intronic
969084112 4:4642396-4642418 GTGCGCTGGGGAGGGATCCCTGG + Intergenic
969188424 4:5497449-5497471 GTGGACTGGGCAGGAACCAGAGG - Intronic
969207434 4:5657300-5657322 GTGGCTTGGGGAGGGAACATGGG - Intronic
969294872 4:6263902-6263924 GTAGAGTGGGCAGGGAACTCAGG + Intergenic
969445957 4:7244897-7244919 GCGGGCTGGGCTGGGTACTCAGG - Intronic
969479724 4:7441480-7441502 GAGGGCTGGGCAGGGTGCAGGGG + Intronic
969832200 4:9806960-9806982 GTGGGCTGAGAAGGGGACTCAGG - Intronic
970178435 4:13362864-13362886 GTAGGCTGGGCAGAGATCACTGG - Intronic
970180210 4:13384060-13384082 GTGGGGTTGGCAGGGTTCACTGG - Intronic
971013731 4:22466158-22466180 GTGGGCAAGGCTGGGACCACGGG - Intronic
972453701 4:39231022-39231044 GTGGGCTGGGCCGGGGACGGTGG + Intronic
972716198 4:41648708-41648730 GAGGGCAGGGCAGGGAATACAGG + Intronic
973662371 4:53121283-53121305 CTGGGGTGGGCTGGGAGCACAGG + Intronic
974109640 4:57511401-57511423 TTGGGCTGGGGAGGGAGCAAAGG - Intergenic
975589371 4:75985205-75985227 GAGGGATGGCCAGGGAATACTGG - Intronic
976209479 4:82653093-82653115 GTGGCATGAGCAGGGATCACTGG - Intronic
978564274 4:110065337-110065359 TTGGGCTGGGCTGGGCACAATGG + Intronic
980142921 4:128943089-128943111 GTGGGCTTGTCAGTGAACAAAGG - Exonic
982051827 4:151509621-151509643 GTGGTCGGGGCAGGGAATAATGG + Intronic
984547873 4:181129022-181129044 GTGGGCTGTGTAGGGATCACAGG - Intergenic
985070182 4:186159819-186159841 GTGGGGGGAGCAGAGAACACGGG + Intronic
985688670 5:1295113-1295135 GGGGGCTGGGCCGGGGACCCGGG + Intergenic
986341191 5:6790778-6790800 GTGGGGTGGGGAGGGAGTACAGG + Intergenic
986772543 5:10987347-10987369 ATGGGCTGGGCATGGCACAGTGG + Intronic
987309197 5:16666606-16666628 TTTGGCTGGGCATGGCACACTGG + Exonic
987876214 5:23684901-23684923 GCAGGATGTGCAGGGAACACAGG + Intergenic
990124801 5:52501057-52501079 GGAGGCTGGGAGGGGAACACTGG + Intergenic
990517284 5:56542008-56542030 GTGGGGTGGGCAGGCAGCAATGG + Intronic
991458590 5:66832428-66832450 GTGGGAAGGGCAGGGGACAGGGG - Intronic
991492208 5:67194528-67194550 GTTTGGTGGGCAGGGTACACGGG - Intronic
991674061 5:69075004-69075026 GGGGGCTGGGCACGGTACCCCGG - Intergenic
992135189 5:73737377-73737399 GTGGGCTGGGGAGTGATGACGGG - Intronic
998060822 5:139117575-139117597 GGGTTCTGGGCAGGGAACTCAGG - Intronic
998205101 5:140152318-140152340 GTGGGCTGGCCAGAAATCACAGG + Intergenic
998627409 5:143861415-143861437 GTGTGCTCTGCAGGGAACACTGG + Intergenic
999283909 5:150382708-150382730 GTGAGCTGTGCTGGGACCACTGG + Intronic
999384680 5:151145868-151145890 GTGGTCTAGGCAGGGACAACTGG - Intronic
999690292 5:154140583-154140605 GAGGGCTGGGCCTGGAATACAGG - Intronic
1001327242 5:170738026-170738048 GCAGCCAGGGCAGGGAACACTGG - Intergenic
1001447599 5:171797823-171797845 GAGGGATGGGCAGAGGACACAGG - Intergenic
1001713888 5:173798989-173799011 GTGTGCCAGGCAGGGGACACAGG - Intergenic
1002279540 5:178122350-178122372 GGAGGCTGGGGTGGGAACACTGG + Exonic
1002419714 5:179139284-179139306 GCGGGCTGAGGAGGGAGCACGGG + Intronic
1002934368 6:1659160-1659182 GGAGGCTGGGCAGGGGACACTGG + Intronic
1003110607 6:3249479-3249501 GTGTGCTGGGCAGGGGAAATGGG - Intronic
1003138407 6:3451607-3451629 TTGGGCTGCGCAGGGAATGCTGG + Intronic
1003171568 6:3725229-3725251 GTGATCTGGGCAGGGAGGACGGG - Intronic
1003645330 6:7909969-7909991 GGGCGCTGGGCAGGGACCGCGGG + Intronic
1004614444 6:17276937-17276959 GTGGGCTGGGCAGAGGGCACCGG - Intergenic
1004895967 6:20148055-20148077 GTGGCTTGGGAAGGAAACACAGG + Intronic
1005496910 6:26395831-26395853 CTGGGGTGGGCAGAGCACACAGG + Intergenic
1005761080 6:28968921-28968943 GTTTGGTGGGCAGGGAACAAAGG - Intergenic
1005812654 6:29529105-29529127 GGGGTCAGGGCAGGGGACACAGG - Intergenic
1006122469 6:31815696-31815718 GGGGGCTGGAAACGGAACACTGG - Exonic
1006171628 6:32096573-32096595 GTGTGCTGGCCGGGGTACACTGG - Intronic
1006171666 6:32096759-32096781 GTGTGCTGGCCCGGGTACACAGG - Intronic
1007271086 6:40637552-40637574 GGTGTCTGGGCAGGGAAAACTGG + Intergenic
1007275814 6:40672807-40672829 GTGGGCAGGCCAGGAAAGACAGG + Intergenic
1007390716 6:41548134-41548156 GGGGGCTGGCCAGGGAAGCCGGG - Intronic
1010019144 6:71139404-71139426 TTGGGCTGGGGAAGGAACAAAGG + Intergenic
1011957094 6:93037135-93037157 CTGGGCTGAGCAGGGTACTCAGG - Intergenic
1012254802 6:97019391-97019413 GTGGACTCCACAGGGAACACAGG + Intronic
1014006393 6:116424172-116424194 GTGGGCCAGGCAGGGAAGCCAGG - Intronic
1014392002 6:120874324-120874346 GTGAGCAGGGCAGGGAAGAGCGG - Intergenic
1016038896 6:139411545-139411567 GTGGGCTGGGAAAGGCAGACGGG - Intergenic
1016889810 6:148994772-148994794 GTGAGCAGGGCAAGGAAAACGGG - Intronic
1017648033 6:156556846-156556868 CTGGGCTGGGCTGGATACACAGG - Intergenic
1017724771 6:157269311-157269333 GCGGGCTGGCCAGGGACCTCAGG - Intergenic
1017757074 6:157538838-157538860 GTGGGCTGGACAGGCAGCGCTGG + Intronic
1017762843 6:157584339-157584361 TTGGGCTGGGGAAGGAACAAAGG - Intronic
1017936988 6:159014516-159014538 ATGGACTGGGGAAGGAACACTGG + Intergenic
1018786440 6:167111845-167111867 GAGAGCTGGGCTGGGAGCACAGG + Intergenic
1018903275 6:168061737-168061759 CTGGGCTAGGCTGGGCACACTGG - Intronic
1019600490 7:1880865-1880887 GTGGCCTGGGCAGGGAGCAGCGG - Intronic
1019992679 7:4703118-4703140 CTGGGCTGGACTGGGAAGACTGG + Intronic
1020116361 7:5478542-5478564 GTGGGGTGAGCTGGGAGCACAGG + Intronic
1020438352 7:8189785-8189807 GGGGGCTGGGCAGGGGGCCCAGG + Intronic
1020956765 7:14748619-14748641 GTGGACTGGGCAGAGCATACAGG + Intronic
1021861673 7:24912100-24912122 GTGTGAAGGGGAGGGAACACAGG - Intronic
1022206916 7:28173697-28173719 GTGAGCTGGGCAAGGGACAATGG + Intronic
1022221617 7:28319623-28319645 GTGGGCTGGGCTGTGAGCATGGG - Intronic
1022314537 7:29233157-29233179 ATGACCTGGGCAGGAAACACAGG + Intronic
1022465849 7:30652899-30652921 GATGGCTGGGGAGGGGACACAGG + Intronic
1023534087 7:41189822-41189844 GTGGGGTGGGCAGGGAAAGAAGG - Intergenic
1023904668 7:44513677-44513699 GAGAGGTGGGCAGGGGACACAGG + Intronic
1023975536 7:45027138-45027160 GGGGCTTGGGCAGGGCACACCGG - Intronic
1024243471 7:47452938-47452960 TGGGCCTGGGCAGGGACCACCGG + Intronic
1025255286 7:57380797-57380819 GTGTGCAGGGCAGGGAAGACAGG - Intergenic
1025975806 7:66368755-66368777 GTGGGCTGGAGAGGGTGCACAGG - Intronic
1026909956 7:74085668-74085690 GTGGGGTGGGCAGGGCAAGCTGG + Intronic
1027774024 7:82443334-82443356 GCGGGCCGGGCAGGGAGCGCCGG - Intronic
1028783877 7:94769691-94769713 TTGGACAGGGCAGGGAAAACTGG + Intergenic
1029501581 7:100933948-100933970 ATGGGCTGGGCAGGGCTCCCTGG - Intergenic
1030664540 7:112260762-112260784 GTGGGCTAGGCGGAGAGCACAGG + Intronic
1031123433 7:117747032-117747054 GTGTGCTGGGCAGGGTGCAGGGG - Intronic
1031253152 7:119413620-119413642 GTGGGCTTGGCAGGCCCCACAGG - Intergenic
1032729426 7:134623380-134623402 GTGTGGAGGGCGGGGAACACAGG + Intergenic
1032855687 7:135832065-135832087 GTGAGGTTGGCAGGGAGCACAGG + Intergenic
1033035415 7:137871642-137871664 CTCATCTGGGCAGGGAACACTGG - Intergenic
1033042182 7:137928653-137928675 GTGTGCTGGGCTGGGACCCCTGG + Intronic
1034047755 7:147947700-147947722 TGGGGCTTGGGAGGGAACACTGG + Intronic
1034257237 7:149731339-149731361 GTGGGCTGGGTGTGGACCACAGG + Intronic
1034258900 7:149741879-149741901 GTGGGCCAGGCAGGGACCACAGG + Intergenic
1034274164 7:149816828-149816850 GAGGGGTGGGCGGGGAATACAGG - Intergenic
1034350640 7:150412690-150412712 GTGGGCTGCGCAGGCAGCAAGGG - Intergenic
1034431348 7:151042821-151042843 GATGGCTGGGCTGGGGACACTGG - Intronic
1034460498 7:151195533-151195555 CTGGGCAGGGGAGGGCACACAGG - Intronic
1035234578 7:157487964-157487986 GAGAGCCGGGGAGGGAACACGGG + Intergenic
1035236711 7:157501817-157501839 GTGGGCGGGGCATTGAAGACAGG + Intergenic
1035421681 7:158734499-158734521 GTAGGCTGGGCTGGGGGCACTGG + Intronic
1035525046 8:305651-305673 GTGAGCTAGGCAGGGCACAGTGG + Intergenic
1035728045 8:1836645-1836667 GTGGGCTGTGTAGGGAGCACAGG + Intronic
1036967698 8:13319293-13319315 GAGGGCGGGGCAGGGAACGGAGG - Intronic
1037127656 8:15370199-15370221 GAGGGTTGGGAAAGGAACACAGG - Intergenic
1037930604 8:22878042-22878064 GTGGGGAGGGCTGGGGACACAGG - Intronic
1038419965 8:27427676-27427698 GGAGGCTGAGCAGGTAACACTGG + Intronic
1038952691 8:32433133-32433155 GTGGGCTGGGTAGGACATACTGG + Intronic
1039445034 8:37624214-37624236 GTGGGCTGAGCAGGGAAGGGGGG + Intergenic
1039793165 8:40891511-40891533 GTGGGCCAGGCAGGGAGCCCAGG - Intronic
1040521636 8:48181386-48181408 GTGGTATGGCCAAGGAACACAGG + Intergenic
1041271129 8:56110698-56110720 GGGGACAGGGCAGGGAATACTGG - Intergenic
1042174563 8:66026597-66026619 GGGGGCTGGGCTGGGATGACAGG - Intronic
1042227525 8:66525548-66525570 GTGGGAGGGGCAGGGCACAGGGG + Intergenic
1045344990 8:101285798-101285820 GGAGGGTGGGCAGGGAACGCTGG + Intergenic
1047420969 8:124707937-124707959 GTGGCCTGGGCAGGGAGCACTGG + Intronic
1047434796 8:124827296-124827318 GTGGGCTGGGCCGGGCACAGTGG + Intergenic
1047779289 8:128098434-128098456 GTGGGGTGGGGAGGGGACAAGGG - Intergenic
1048055882 8:130864527-130864549 GGGGGTTGGGCAGGGGACACGGG - Intronic
1048196797 8:132338116-132338138 GTGTGCTGGGCAGAGTATACTGG + Intronic
1049032962 8:140050709-140050731 GGGGGCTGGGGAGGGAAGAAGGG + Intronic
1049058747 8:140259269-140259291 GTGGGATGGGAAGGCATCACAGG - Intronic
1049153800 8:141055061-141055083 GTGGTCTTGGCAGGGCACTCAGG - Intergenic
1049221015 8:141428951-141428973 GTGGGGTGGGGAGAGAACCCGGG - Intronic
1049240588 8:141535668-141535690 ACGGGCTGGGCCGGGAACCCTGG - Intergenic
1049478582 8:142808246-142808268 GTGGGCTGGGGAGAGATCCCCGG + Intergenic
1049664243 8:143835944-143835966 GTAGGCTGGGCAGGGGACTTGGG - Intronic
1049864295 8:144923920-144923942 GTGGACTGTGCAGGGGCCACAGG - Intergenic
1050829415 9:9991646-9991668 TTGGGCTGGGCCGGGCACAGTGG - Intronic
1051414885 9:16829002-16829024 GTGGGCTGGGCAGAGCAGAAGGG + Intronic
1052792237 9:32886389-32886411 GGGGGCAGGGTAGGGAACATGGG + Intergenic
1053369855 9:37551568-37551590 GTGGGGTGACCAGGGAACAGAGG + Intronic
1053412639 9:37925532-37925554 TAGGCCTGGGCAGGGGACACTGG - Intronic
1053721661 9:40952358-40952380 GGGGGGTGGGGAGAGAACACAGG + Intergenic
1055294806 9:74823257-74823279 GTAAGCTGGGGAGGGAGCACAGG - Intronic
1055441288 9:76338922-76338944 GTGGGTTGGGCAGGCAACAGGGG - Intronic
1055595213 9:77858731-77858753 GTGGGCTGGGCATGGAATTCTGG - Intronic
1056321783 9:85442073-85442095 GTGGGTGGGGAAGGGAACATAGG + Intergenic
1056485710 9:87055087-87055109 GTGGGAGGGGCAGGAAATACAGG + Intergenic
1057230738 9:93319938-93319960 GTGGACCGGGCAGGAGACACTGG - Intronic
1057411422 9:94819451-94819473 GAGGGCTGGCCTGTGAACACAGG - Intronic
1057509205 9:95663651-95663673 GGGAGCTGCACAGGGAACACAGG + Intergenic
1057564201 9:96153736-96153758 GTGGGGTGGTCAGGGAATAAAGG + Intergenic
1057882112 9:98800211-98800233 CTGGGCTGGGCTGGGCACAGTGG - Intergenic
1058604161 9:106702820-106702842 GATGGATGAGCAGGGAACACAGG - Intergenic
1060036112 9:120257110-120257132 GTGGGTGGGGCAGGGGACACTGG - Intergenic
1060494929 9:124111591-124111613 GTGGGCTCGGCAGTGAGCCCAGG - Intergenic
1060546719 9:124466261-124466283 GGGGGATGGGGAGGGAACAGGGG - Exonic
1060873896 9:127066132-127066154 CTGGGCATGGCAGGGAACATGGG + Intronic
1061089219 9:128417499-128417521 GGGGAGTGGGCAGGGGACACAGG + Intronic
1061785916 9:133028391-133028413 GAGGGCAGGTCAGGGACCACCGG + Intergenic
1062177889 9:135174427-135174449 CTGGGCTGAGGAGAGAACACAGG + Intergenic
1062214686 9:135382878-135382900 CTGGGCTGGGCAGTGAACGGTGG - Intergenic
1062253602 9:135610604-135610626 CTGGGAGGGGCAGGGCACACTGG + Intergenic
1062396907 9:136356237-136356259 GTGGGCTGGGCTGGGCTCAGAGG + Intronic
1062613809 9:137387132-137387154 GAGGGCCAGGCAGGGAACAGAGG - Intronic
1062623123 9:137431473-137431495 CTGGGCTGGGCCAGGACCACGGG - Intronic
1062698005 9:137885189-137885211 CTGGGTTGTGCAGGGAACCCCGG + Intronic
1203453493 Un_GL000219v1:143635-143657 GGGGGGTGGGGAGAGAACACAGG - Intergenic
1185464221 X:345738-345760 GCGGGCGGGGCAGGGAAGGCTGG + Intronic
1185747541 X:2584432-2584454 CTGGGCTGGGCTGGGGGCACGGG + Intergenic
1187560953 X:20403182-20403204 GTGCCCAGGGCAGGGAAAACAGG + Intergenic
1188205913 X:27358335-27358357 GTAGGCTGGGAAGGGACCTCAGG + Intergenic
1190634903 X:52424078-52424100 ATGGGCTAGTCAGGGAATACAGG - Intergenic
1190654351 X:52598052-52598074 ATGGGCTAGTCAGGGCACACAGG + Intergenic
1190879594 X:54483230-54483252 GTGGGAGGGGCAGGGAAGGCTGG - Intronic
1191641802 X:63434420-63434442 GTGGGCAGGGCTGGGAACCAGGG + Intergenic
1192310895 X:70013239-70013261 ATGGGCTGGGGAAGGAACAAAGG + Intronic
1194866512 X:99075360-99075382 CTGGACTGGGCAGGAGACACTGG - Intergenic
1195203368 X:102571350-102571372 GTGGTCTGGGTATGGAACCCAGG + Intergenic
1195241801 X:102959950-102959972 TTGGGCTGGGGAAGGAACAAAGG - Intergenic
1195404716 X:104500315-104500337 GTGGGGTGGGGAGGGAAGAGAGG - Intergenic
1195504523 X:105642129-105642151 GGGGGCTGTGCAGGGAATATGGG - Intronic
1195749304 X:108148320-108148342 GTGGGCTGGGAAAGGCAGACCGG - Intronic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1198106635 X:133468244-133468266 GTGGACTAGGCAGGCCACACAGG + Intergenic
1198278310 X:135118030-135118052 GTAGGCGGGGGAGGGGACACAGG + Intergenic
1198292652 X:135254486-135254508 GTAGGCGGGGGAGGGGACACAGG - Intronic
1199761490 X:150907630-150907652 TGGGGCTGGGGAGGGCACACTGG + Intergenic
1200840504 Y:7776648-7776670 GTTGGGTGGGCAGGTCACACAGG + Intergenic