ID: 1179035672

View in Genome Browser
Species Human (GRCh38)
Location 21:37756999-37757021
Sequence ACTCCAGGCTCGAATCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179035672 Original CRISPR ACTCCAGGCTCGAATCTTTG AGG (reversed) Intronic
903187228 1:21635509-21635531 AGTCCAGGCAGGTATCTTTGGGG - Intronic
904834632 1:33327347-33327369 AGTCCAGGCTCTCATCATTGAGG - Intronic
906267973 1:44449105-44449127 ACTCCATGCTCCTAACTTTGAGG - Intronic
907602992 1:55788709-55788731 ACTCCTGGCTCGAATGCCTGGGG + Intergenic
920278543 1:204826602-204826624 TCTGCAGGCTGGATTCTTTGAGG + Intergenic
920424783 1:205866404-205866426 ACTCCTGGCTCGAATACCTGGGG + Intergenic
1071561053 10:86647081-86647103 AATCCAGGCTCCAATCTTACAGG - Intergenic
1071951702 10:90710371-90710393 ACTCCAGCCTGCAATCTGTGAGG - Intergenic
1080890785 11:36407469-36407491 ACTCCAGGCACCACTCTTTGAGG - Intronic
1083153621 11:60809360-60809382 ACTCCAGGCTCCAGTATTTGAGG + Intergenic
1087143632 11:94790643-94790665 ACTTCAGGGTGGAATTTTTGTGG - Intronic
1090194688 11:124804688-124804710 ACTGGAGGCTGGAATCTTTCTGG - Intergenic
1092061207 12:5551973-5551995 CCTCCAGGATCTCATCTTTGTGG + Intronic
1096409042 12:51364305-51364327 CCTCCTGGCTCGAATCGCTGAGG - Exonic
1100556925 12:95704002-95704024 ACTGCAGCCTCGAATTTTGGAGG + Intronic
1101222629 12:102657155-102657177 ACTCAAGGCTAGCATCTTTTTGG - Intergenic
1104632375 12:130414214-130414236 GCTCCCGGCCCGGATCTTTGTGG - Exonic
1108417091 13:50208950-50208972 ACTCCAGGCTCAAGGCTTAGGGG + Intronic
1108686749 13:52826455-52826477 ACACCAGGCTCGAATTCTTGTGG + Intergenic
1112189566 13:97163223-97163245 TCTCCAGGCTATAATATTTGTGG + Intergenic
1112693808 13:101925427-101925449 TCTGCAGGCTCTAATCTCTGGGG + Intronic
1117288630 14:54311086-54311108 ATTCCAGGCTGCAATCTATGAGG + Intergenic
1117344354 14:54818122-54818144 GCCCCAGGCTCTAATCTTTGTGG + Intergenic
1121429070 14:93874112-93874134 AGTCCAGGCTGGAATCTTAAAGG - Intergenic
1121622349 14:95359295-95359317 ACTCTAAGCTAGAATCTGTGGGG - Intergenic
1136141962 16:28293596-28293618 CCTCCAGGCTCGCAGCTTTTGGG - Intronic
1160604982 18:80043533-80043555 ACTCCAGGCTCCTGTCTCTGGGG + Intronic
1163612588 19:18309031-18309053 ACTCCAGGCAGGGAGCTTTGGGG - Intronic
1164644966 19:29852090-29852112 ACCCCAGGGTCAAATCTGTGTGG - Intergenic
930747661 2:54901386-54901408 ACTACAGGCTAGAATCATTTTGG + Intronic
935080176 2:99785207-99785229 ACTCCAGGTTCTAATCTATGTGG + Intronic
942779048 2:179619114-179619136 ATTCCATGCTCAAATTTTTGTGG - Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173859529 20:46273805-46273827 ACTCAAGGCTGGAATGTGTGAGG + Intronic
1179035630 21:37756718-37756740 ACTCCGGGCTTGAATCTGTGAGG - Intronic
1179035641 21:37756786-37756808 ACTCCGGGCTGGAATCTGTGAGG - Intronic
1179035660 21:37756931-37756953 ACTCTGGGCTGGAATCTGTGAGG - Intronic
1179035672 21:37756999-37757021 ACTCCAGGCTCGAATCTTTGAGG - Intronic
1179035690 21:37757144-37757166 ACTCCAAGCTGGATTCTGTGAGG - Intronic
1179035747 21:37757584-37757606 ACTCCGGGCTGGAATCTGTGAGG - Intronic
1179035759 21:37757653-37757675 TCTCCAGGCTGGAATCTGTGAGG - Intronic
1182129495 22:27840572-27840594 ACGCCTGGCTAGAATCTCTGTGG + Intergenic
1184349110 22:43931912-43931934 ACTCCAGGCAAGAATCTTGATGG + Intronic
1184807215 22:46802930-46802952 ACCCCAGGCTCTAAGCTATGGGG - Intronic
949498793 3:4658301-4658323 ACACCAGGCCTGATTCTTTGGGG - Intronic
949917319 3:8975177-8975199 ACTCCAGGCTGGGATTTGTGGGG - Intergenic
950184617 3:10937530-10937552 ACTCCAGGCTGGGATCTGGGGGG - Intronic
953038528 3:39234443-39234465 ACTCCAGGCTTCAGTCTGTGTGG + Intergenic
956721849 3:72124934-72124956 ACTCCTGGCTAAAATCTTTCAGG + Intergenic
956898857 3:73692915-73692937 ACCCCAGCCTCCCATCTTTGGGG - Intergenic
969453381 4:7287389-7287411 ATTCCTGGCTCGAACCTTTCTGG - Intronic
970430005 4:15980474-15980496 ACTTCCGGCTCTAATTTTTGCGG - Exonic
985800092 5:2000321-2000343 ACTCTAGGCTCGAATGTTGATGG + Intergenic
992684848 5:79189236-79189258 ACTGCAGCCTCGAATCTTGCAGG - Intronic
993622849 5:90188416-90188438 ACTCCTGGCTCGAATGCCTGGGG + Intergenic
995031207 5:107483493-107483515 TATCCAGGCTCTATTCTTTGAGG - Intronic
998231583 5:140364357-140364379 AGTCCAGGCTGTAATCTCTGTGG - Exonic
999918280 5:156287820-156287842 ACTGCAGGCTCAAATTTCTGGGG - Intronic
1000082922 5:157864458-157864480 ACTCCAGGCTCGCCTGTTTCAGG - Intergenic
1006773455 6:36573132-36573154 ACTGCAGCCTCGAACCCTTGGGG - Intergenic
1007284946 6:40740969-40740991 CCTCCAGGGTGGAACCTTTGTGG + Intergenic
1013811307 6:114047948-114047970 GCTCCTGGCTCTGATCTTTGGGG + Intergenic
1015993296 6:138971067-138971089 ACTCCAGAATCAAATCTTAGAGG + Intronic
1016736859 6:147488823-147488845 ACACAGGGCTGGAATCTTTGGGG - Intergenic
1019376324 7:694443-694465 ACTCCAGGCTAGTCTCTTTGGGG - Intronic
1021984008 7:26081724-26081746 ACTCCAGGCACTCATCTCTGTGG - Intergenic
1022048953 7:26646416-26646438 ATACCAGGCTGGAATCCTTGAGG + Exonic
1022166384 7:27767356-27767378 ACTCCAGTCTCAGTTCTTTGAGG - Intronic
1023282956 7:38590528-38590550 ACTCCCGGCTCGAATGCCTGGGG + Intronic
1028714271 7:93946679-93946701 ACTCCAGGCTTCACTCTTAGAGG + Intergenic
1031471976 7:122177046-122177068 ACTCCCGGCTCGAATGCCTGGGG - Intergenic
1032425820 7:131821347-131821369 ACTCCTGGCTCGAATGCCTGGGG + Intergenic
1041741720 8:61164008-61164030 ACTCCCGGCTCGAATGCGTGGGG + Intronic
1045472321 8:102523563-102523585 ACTCTAGCCTCCAATTTTTGGGG + Intergenic
1047659901 8:127021887-127021909 ACTACAAGCAAGAATCTTTGGGG + Intergenic
1055199221 9:73638116-73638138 ATTCCAGACTCTATTCTTTGGGG + Intergenic
1060330369 9:122663080-122663102 AAGCCAGGCTTTAATCTTTGAGG - Intergenic
1200216047 X:154368704-154368726 ACTCCAAGCTTGAGTCTTCGAGG - Intronic