ID: 1179039571

View in Genome Browser
Species Human (GRCh38)
Location 21:37790408-37790430
Sequence TATTGCTGCCTGGCAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179039571 Original CRISPR TATTGCTGCCTGGCAAAAAG AGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
904810000 1:33157268-33157290 TCTTCCTGCCTGGGAAACAGAGG + Intronic
905213994 1:36393895-36393917 CATTGCGGCCTGTCACAAAGAGG + Exonic
906073815 1:43036723-43036745 CATTGTTGCCTGGGAAAATGAGG - Intergenic
907291103 1:53413572-53413594 TACAGCTCCCTGGCAAAAACAGG + Intergenic
907879821 1:58537518-58537540 TATTGTTGCCTGGTAGAAATTGG - Intronic
909190377 1:72542316-72542338 CAATGCAGCCTGGCCAAAAGAGG - Intergenic
910077520 1:83298562-83298584 TATTGCTGCCTGGCACCATAGGG + Intergenic
910216752 1:84851136-84851158 TATAAATGCCTGGCACAAAGTGG + Intronic
912242391 1:107925053-107925075 TATTGCTGCATGGGACAATGTGG + Intronic
913085660 1:115434449-115434471 TATTGCTAACTTGCAAAGAGTGG + Intergenic
915907823 1:159891868-159891890 TCATGCTGGCTGGCAAAAGGGGG - Intronic
917235244 1:172884733-172884755 TCTTTCTGCCTAGCAAGAAGGGG - Intergenic
918375622 1:183906342-183906364 TATATCTGCCTGGCAGATAGAGG + Intronic
918643693 1:186876629-186876651 TTTTAGTGCCTGCCAAAAAGTGG - Intronic
918725859 1:187922711-187922733 TACTGCTGCCTGGCAAAAACTGG - Intergenic
919905649 1:202076626-202076648 GAATGGTGCCTGGCACAAAGTGG - Intergenic
922224244 1:223631507-223631529 CATTGCTGCTTTGCAAGAAGAGG - Intronic
923210250 1:231797522-231797544 TATTCCTGCATGGAAGAAAGAGG + Intronic
923354398 1:233139994-233140016 AGTTGCTGCCTGGAAAAAAATGG - Intronic
923729802 1:236539279-236539301 TATTTCTGCATGGCAACAACTGG - Intronic
923896607 1:238276912-238276934 TATAGCTGATTGGCATAAAGTGG - Intergenic
924747801 1:246853904-246853926 TTTTCCTGTTTGGCAAAAAGAGG + Intronic
1064973483 10:21089599-21089621 TACTGGTACCTGGCAAAAAGTGG + Intronic
1068543197 10:58319214-58319236 TACAGCTTCCTGGGAAAAAGTGG - Intergenic
1069184456 10:65405628-65405650 TATTACTGCCTGGCAATATGGGG - Intergenic
1071251546 10:83824480-83824502 AATTGCAGCCTGGGAAAAATAGG + Intergenic
1073846795 10:107566480-107566502 TATTGCTGCAAAGAAAAAAGTGG - Intergenic
1074070525 10:110063864-110063886 TATGGCTGCCTTGCAGAGAGAGG - Intronic
1074492296 10:113949167-113949189 TCTTGCAGCCTGGGAAAAATGGG - Intergenic
1074765128 10:116694837-116694859 TTTTGCCGCCTGGAACAAAGGGG + Intronic
1078935498 11:15945841-15945863 CATTGCTGCCTGGCACACAGTGG - Intergenic
1079154755 11:17935433-17935455 TATTCCAGCCTGGGAAACAGAGG + Intronic
1081193852 11:40137373-40137395 TGTTGCTGGCTGGAGAAAAGGGG - Intronic
1083207247 11:61160105-61160127 TATTGCTACCTGCAAAACAGCGG + Intronic
1087706244 11:101495885-101495907 TATTGCTGACTGTGAGAAAGAGG - Intronic
1088426575 11:109711351-109711373 TCTTTCTGGCTGGCAATAAGTGG + Intergenic
1088724861 11:112625125-112625147 TATTGATGCTGGGCAAAGAGGGG + Intergenic
1088725023 11:112626905-112626927 TATTGATGCTGGGCAAAGAGGGG - Intergenic
1089669768 11:120045777-120045799 TATCCCTGCCTAGCAAAATGAGG + Intergenic
1091204710 11:133812157-133812179 CATTGCTGCAAGGCAATAAGAGG + Intergenic
1091258793 11:134217176-134217198 TCTTGGTGCCTTACAAAAAGAGG + Intronic
1092020896 12:5201454-5201476 TTTTGCTTCCTGGTAAACAGAGG - Intergenic
1093088302 12:14891394-14891416 TATTGGTGACTGGCAGAAACAGG + Intronic
1093186946 12:16030889-16030911 TAAGGCTGCCTGGGAGAAAGTGG - Intronic
1093292802 12:17349514-17349536 TAGCAGTGCCTGGCAAAAAGTGG - Intergenic
1095290502 12:40474242-40474264 TTTTGCTGCCTGTCAGAAGGCGG + Intronic
1096001207 12:48132092-48132114 TAATGGTGCCTGCCATAAAGTGG + Intronic
1098190274 12:67940751-67940773 TGTTACTGACTGGCACAAAGTGG - Intergenic
1099095882 12:78373720-78373742 TTTTGCTTCCTGCCATAAAGTGG - Intergenic
1099403336 12:82227554-82227576 TATTTCTACCTTGAAAAAAGAGG + Intronic
1099868809 12:88320323-88320345 TATTGTTGCCTAGGAAACAGTGG + Intergenic
1101124157 12:101613974-101613996 TCTTGCTTTCTGGGAAAAAGGGG + Intronic
1102254556 12:111407987-111408009 ACCTGCTGCCTGGCAAAGAGAGG + Intronic
1102457600 12:113080345-113080367 TCTGGCTGCCTTACAAAAAGAGG + Intronic
1102996221 12:117352692-117352714 TATTTCTTCCAGGAAAAAAGAGG + Intronic
1103549365 12:121725614-121725636 TATTGCTGACTAGCAATAAAAGG + Intronic
1105646234 13:22320873-22320895 TATTGCTTCAGGGCTAAAAGGGG + Intergenic
1109508484 13:63337290-63337312 CATTACTGCCTGGCAACAAAGGG - Intergenic
1110057737 13:70997692-70997714 TATTGCTCCCAGGCAAAAAACGG - Intergenic
1110141382 13:72133707-72133729 TATTGATGCCTGTCAAAAGTAGG - Intergenic
1111128150 13:83939096-83939118 TATTTCTACCAGGCTAAAAGAGG + Intergenic
1111469962 13:88667394-88667416 GAGTGCTGCCTGTTAAAAAGTGG - Intergenic
1115884982 14:37961217-37961239 TTTTGCTGCCTGGGAATAAGGGG + Intronic
1116144720 14:41049753-41049775 CATTCCTACCTGGTAAAAAGAGG - Intergenic
1118648743 14:67867662-67867684 TATTGCTGCCTGAATAAAACTGG + Intronic
1120530606 14:85626416-85626438 TGATGCTGCCTGGCCAAATGAGG + Exonic
1122063926 14:99158756-99158778 TAGAGCAGCATGGCAAAAAGGGG - Intergenic
1123467502 15:20527842-20527864 AACTGCTCCCTGGCAGAAAGAGG - Intergenic
1123650612 15:22473200-22473222 AACTGCTCCCTGGCAGAAAGAGG + Intergenic
1123741020 15:23282042-23282064 AACTGCTCCCTGGCAGAAAGAGG + Intergenic
1123745978 15:23320516-23320538 AACTGCTCCCTGGCAGAAAGAGG - Intergenic
1124278249 15:28343833-28343855 AACTGCTCCCTGGCAGAAAGAGG - Intergenic
1124304453 15:28567775-28567797 AACTGCTCCCTGGCAGAAAGAGG + Intergenic
1126186203 15:45832556-45832578 TATTGCTTCCTGGCACAGGGAGG + Intergenic
1129800361 15:78409299-78409321 TGTTACTGCCTGGCACAAACTGG + Intergenic
1131538156 15:93254445-93254467 TATTGCTGCTTTGCAAAGTGAGG + Intergenic
1133897047 16:9939636-9939658 TATTGCTGGCAGGGAAAACGAGG + Intronic
1135386843 16:22049769-22049791 TTTTGCTGCATGGTAATAAGTGG + Intronic
1137948154 16:52755787-52755809 TATTCCTCCATGGCAAAAACTGG + Intergenic
1138226721 16:55302359-55302381 TATTGCTGCCTGCAGAAACGAGG - Intergenic
1139387917 16:66586127-66586149 TGGTGCTGCCTTGCAAAGAGGGG + Intronic
1139695986 16:68675309-68675331 TGTTGCAGCCTAGCAAAAATGGG + Intronic
1139870603 16:70105806-70105828 TATTTCTCCATGTCAAAAAGTGG + Intergenic
1139930339 16:70521198-70521220 TATAGCTGCCTGGGCACAAGTGG - Intronic
1140384844 16:74526753-74526775 TATTTCTCCATGTCAAAAAGTGG - Intronic
1143667974 17:8375359-8375381 CATTGCTGCCTGGCAATAACTGG + Intronic
1143974882 17:10822342-10822364 GATTGCTGCCTGGGAGAAAATGG - Intergenic
1144803030 17:17944198-17944220 TCATGGTGCCTGGCACAAAGTGG + Intronic
1145002763 17:19317184-19317206 TAGTGCTGCTTGGAAAAAACTGG - Intronic
1146029376 17:29351781-29351803 TATTTCAGCCTGGACAAAAGAGG - Intergenic
1146626458 17:34438934-34438956 TGATGCTGACTGGCTAAAAGAGG - Intergenic
1147603263 17:41758862-41758884 GATGGTTGCCTGGCAAAAAAAGG + Exonic
1147808321 17:43148254-43148276 TACTCCAGCCTGGCAACAAGAGG + Intergenic
1149159562 17:53674933-53674955 TATTGCTTAATGGCAAAATGTGG - Intergenic
1153542830 18:6174479-6174501 TATTGCTGGATGGCAATAATAGG + Intronic
1154044207 18:10889069-10889091 TATTGATTCTTGGTAAAAAGAGG + Intronic
1163457579 19:17417048-17417070 TAAAGTTGCCTGGAAAAAAGTGG - Intronic
1164144274 19:22501338-22501360 TTTTTTTGCCTGGCAAAAAAAGG - Intronic
1166045777 19:40229955-40229977 TATTGCTAAGTGGCAAAATGGGG - Intergenic
925758569 2:7160363-7160385 TAGAGCTGCCTTGCAAGAAGTGG - Intergenic
928165570 2:28969333-28969355 TGTAGCTGCCTGGCAGAATGTGG + Intronic
930344912 2:50168048-50168070 TATTGCTGCATTGCAAACAGAGG - Intronic
932248121 2:70214962-70214984 TAAAGCTGCCTGGAAAAAAAAGG + Intronic
933862462 2:86483599-86483621 TATTCCTGCTTGGCAATAACAGG + Intronic
933988834 2:87617928-87617950 TATTGTTGACTGGCTAACAGAGG - Intergenic
936030104 2:109063762-109063784 TAGGGCAGCCTGGCCAAAAGGGG + Intergenic
936305010 2:111332895-111332917 TATTGTTGACTGGCTAACAGAGG + Intergenic
936654345 2:114467359-114467381 TGTTTCTGCCTGGCAATAATTGG - Intronic
936977661 2:118235603-118235625 TTTTGCTGCTTGGGGAAAAGTGG - Intergenic
942083394 2:172422776-172422798 TATTTCTGGCTGGCAAAATATGG + Intergenic
943978429 2:194513175-194513197 TATTGCTGCAATGGAAAAAGTGG + Intergenic
945551962 2:211231517-211231539 CATTGCCACCTGACAAAAAGTGG - Intergenic
945825551 2:214716710-214716732 CATTCCTGCCTGGCTAAAACAGG + Intergenic
946118629 2:217489151-217489173 TATGGCTGCTTGGCAAAAGATGG + Intronic
947100994 2:226621116-226621138 TCTTGGTGCCTGGCAAGAGGTGG - Intergenic
948320356 2:237063994-237064016 GACTGCTGCTTGGCAAACAGTGG + Intergenic
1170953984 20:20961807-20961829 TATTGCCTACTGGGAAAAAGGGG + Intergenic
1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG + Intergenic
1177413116 21:20756901-20756923 TAATGTTGCCTGTTAAAAAGTGG - Intergenic
1177674885 21:24284311-24284333 TATTGCTTCTTTGCAAAGAGAGG - Intergenic
1179039571 21:37790408-37790430 TATTGCTGCCTGGCAAAAAGAGG - Intronic
950861641 3:16152581-16152603 TTTTCCTGCGTGGCAAAAATTGG + Intergenic
952643714 3:35630095-35630117 TCATGCTGCCTGACAAAAATAGG - Intergenic
954550656 3:51478827-51478849 TATTGCTGACTGGCAGAAACTGG - Intronic
956136297 3:66102500-66102522 TATTGCTGTTTGCCAAATAGTGG + Intergenic
956370578 3:68555199-68555221 CATTGCTTACTGGCAAAAACAGG + Intergenic
957835129 3:85577453-85577475 TCTTGCTGCATGGCAGAAGGAGG - Intronic
958123040 3:89318030-89318052 TATTGATGCCTGTCAAATAACGG - Intronic
959499867 3:107093643-107093665 ACTGGCTGCCTGGCTAAAAGTGG - Intergenic
959979192 3:112496107-112496129 TGTTCCTGCCTGCCTAAAAGTGG + Intronic
960168314 3:114429054-114429076 TATTGCTGGGTAGTAAAAAGAGG + Intronic
963005058 3:140719260-140719282 TATTCCTGCCTGCCATTAAGAGG - Intergenic
963319286 3:143795693-143795715 TACTGCAGCCTGGGCAAAAGAGG + Intronic
964298352 3:155259136-155259158 TACTGCAGCCTGGGAAACAGAGG + Intergenic
968240800 3:197083087-197083109 GATTGCTGCATTGCTAAAAGAGG + Intronic
970611018 4:17725345-17725367 CAGTGCTGCCTGGGAAAAAGAGG + Intronic
974344479 4:60661651-60661673 TTTTTCTACATGGCAAAAAGGGG - Intergenic
974559802 4:63502614-63502636 TATTCCTTCCTGGAAATAAGTGG - Intergenic
975582106 4:75916164-75916186 TTTTGCAGCATGGCACAAAGGGG + Intronic
978557260 4:109993959-109993981 TAGGGCTGACAGGCAAAAAGTGG - Intronic
978694422 4:111559812-111559834 TATTACTGCGTGGAAAACAGAGG + Intergenic
979838044 4:125398412-125398434 AAATGCTGCCTGACAAACAGAGG - Intronic
980178684 4:129377797-129377819 TATTGCTACATGTCAAAAAATGG + Intergenic
982560623 4:156924870-156924892 TTTTGCTGCCCAGCAAAAAGAGG - Intronic
985065732 4:186119326-186119348 TATTTCTACCTCTCAAAAAGGGG - Intronic
985099907 4:186448611-186448633 TCTGGCTGCCTGGGAAAAACAGG - Intronic
985389324 4:189478658-189478680 TCAGGCTGCCTGGAAAAAAGAGG + Intergenic
987391541 5:17380824-17380846 GCTTCCTGCCTGGCAAAAATGGG + Intergenic
993150759 5:84159131-84159153 TATTGCAGAGTGGCAAAAAGTGG - Intronic
995348942 5:111153024-111153046 TGTTCCTGCCTGGCAATAATTGG - Intergenic
995547183 5:113244907-113244929 TATTGCTGCCTGAACAACAGTGG - Intronic
996823026 5:127651654-127651676 TAGTCCTGCCTGGCACATAGTGG - Intronic
998063915 5:139141028-139141050 TATTGCTGCCTTCTAAAATGCGG - Intronic
1000280552 5:159778114-159778136 TATTTCTGCCTGGCAGCAGGAGG - Intergenic
1000447860 5:161346333-161346355 TAATGTTCCCTGGCGAAAAGTGG + Intronic
1001140997 5:169143902-169143924 CATGGCTCCATGGCAAAAAGTGG + Intronic
1002104861 5:176874998-176875020 CATGGCTGCCTTGCAAGAAGTGG + Intronic
1002790077 6:430782-430804 TCTTGGTGCCTGGCACACAGAGG + Intergenic
1002920843 6:1572067-1572089 GATTTTTGCCTGGCAGAAAGTGG - Intergenic
1004206683 6:13598037-13598059 CATTGCTGCCTTCTAAAAAGTGG + Intronic
1005882666 6:30072788-30072810 GATTGCTGACTTACAAAAAGAGG + Intronic
1010574539 6:77514678-77514700 TCTTGCCCCCAGGCAAAAAGGGG - Intergenic
1011251464 6:85376499-85376521 TATTTCTGCATGGCAAAAACTGG + Intergenic
1011603400 6:89080572-89080594 TGCTGCAGCCTGGCACAAAGAGG - Intergenic
1015119276 6:129683763-129683785 TATCTCTGCCTTGCACAAAGTGG + Intronic
1015403549 6:132813491-132813513 TATTGCTTCCTGGAAGAAAATGG + Intergenic
1016270722 6:142286880-142286902 TTATGCAGCCTGGCAAAAATAGG - Intergenic
1016578653 6:145601788-145601810 TATACCTGATTGGCAAAAAGAGG - Intronic
1017076150 6:150620710-150620732 GATTGATGCCTGGCACAAAACGG - Intronic
1018220771 6:161576549-161576571 TAATAGTGCCTGGCACAAAGTGG - Intronic
1021539530 7:21742051-21742073 TATTGTTGCCTGGATCAAAGTGG - Exonic
1022077113 7:26982827-26982849 TAATGTTGCCTGGAAAAAGGTGG - Intronic
1023796607 7:43798610-43798632 TCTTGCTTTCTGGCACAAAGTGG + Intronic
1023918422 7:44607554-44607576 TAGTGCTGCCTTACAAAAAAAGG - Intronic
1027295295 7:76763767-76763789 TATTGCTGCCTGGCACCATAGGG + Intergenic
1031321578 7:120335812-120335834 TATTGCTGCCAGGGAAGAAAAGG - Intronic
1034344181 7:150375962-150375984 TATTAATGCCTGGTAAAAAGAGG - Intronic
1038043234 8:23744520-23744542 TATGGCTGCTTGACAAAAAATGG + Intergenic
1038760120 8:30378253-30378275 TATTGCTGGCTGGAGAAAAGGGG - Intergenic
1038954378 8:32451367-32451389 TATTGCCTCCTGGCAAAACAGGG + Intronic
1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG + Intronic
1042790597 8:72601069-72601091 TATTGCTACCTGTAAAAAAAAGG + Intronic
1043380815 8:79700255-79700277 TCTAGCTGCCTGGAAAACAGAGG + Intergenic
1044039255 8:87345874-87345896 TATTTCTACCTTGCATAAAGAGG + Intronic
1044158199 8:88877157-88877179 TATTGCTTCCTGGGAAGAAGTGG - Intergenic
1044415520 8:91935023-91935045 TGTTGCTTCCTGGCAAATAATGG + Intergenic
1044665710 8:94632497-94632519 CATTCCAGCCTGGCAACAAGAGG + Intergenic
1044738991 8:95306275-95306297 AATTGGTGCCTGGTAGAAAGGGG - Intergenic
1050269631 9:3928638-3928660 TATTGCTTTCTGGCAAAATTAGG - Intronic
1050766570 9:9141930-9141952 TATTGCTCTCTGGTAGAAAGGGG - Intronic
1051912286 9:22167247-22167269 TACTCCAGCCTGGAAAAAAGAGG + Intergenic
1052012303 9:23424862-23424884 TATTGCTGACTGGCAGGCAGTGG - Intergenic
1052245731 9:26331705-26331727 TAGTGCTGGCTGACAGAAAGTGG - Intergenic
1055355847 9:75436241-75436263 TCTTGCTCCCGGGCAAAGAGAGG + Intergenic
1056048789 9:82746446-82746468 TCCAGCTGCCTGGCAACAAGAGG + Intergenic
1057304316 9:93903521-93903543 TAAGGCTGCGTGGCAAAATGAGG + Intergenic
1057950504 9:99365877-99365899 TATTCCTGACTGGGAGAAAGAGG + Intergenic
1058102944 9:100937296-100937318 TATTGCTGCTTATCTAAAAGCGG - Intergenic
1059085249 9:111294414-111294436 AATTGCTCCCAGGGAAAAAGTGG - Intergenic
1060733596 9:126052638-126052660 TATTGGGGCCTGGGAAGAAGGGG - Intergenic
1187200057 X:17126218-17126240 GGTTGCTGCCTGGCCAGAAGGGG - Intronic
1187900200 X:24021124-24021146 TATTGCTGCTGGTCCAAAAGTGG - Intronic
1188182099 X:27068563-27068585 TTTTGCTGCAAGACAAAAAGAGG - Intergenic
1190089204 X:47422861-47422883 TATTCCTACTTGCCAAAAAGTGG + Intergenic
1190533036 X:51399403-51399425 TTTTGCTGGCTGTCAACAAGGGG - Intergenic
1193269787 X:79515661-79515683 TAATGGTTCCTGGCAAAAGGGGG - Intergenic
1194427701 X:93760301-93760323 CATTGTTGCCTAGCAAAAAGAGG + Intergenic
1194753811 X:97713806-97713828 TAGTGCAGCCTGGCAGAAAGAGG + Intergenic
1194942386 X:100026980-100027002 TATTGCAGCCTGGTCAAAAGAGG + Intergenic
1196017230 X:110952860-110952882 TTTTGCTGCCTTGAAAAAAGTGG + Intronic
1196045190 X:111249483-111249505 TATGTCTGGCTGGCAAAAGGAGG - Intronic
1197196440 X:123706638-123706660 TGTTCCTGTCTGGCAAAAATGGG + Intronic
1200226194 X:154419235-154419257 TGATGCTGCCTGGCACATAGGGG + Intronic