ID: 1179039620

View in Genome Browser
Species Human (GRCh38)
Location 21:37790850-37790872
Sequence CAAACACCAGTATGATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179039620_1179039627 23 Left 1179039620 21:37790850-37790872 CCAAAGGATCATACTGGTGTTTG 0: 1
1: 0
2: 1
3: 3
4: 100
Right 1179039627 21:37790896-37790918 AAGTTTAATACCTCATCCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 139
1179039620_1179039626 22 Left 1179039620 21:37790850-37790872 CCAAAGGATCATACTGGTGTTTG 0: 1
1: 0
2: 1
3: 3
4: 100
Right 1179039626 21:37790895-37790917 AAAGTTTAATACCTCATCCAAGG 0: 1
1: 1
2: 0
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179039620 Original CRISPR CAAACACCAGTATGATCCTT TGG (reversed) Intronic
901715057 1:11146748-11146770 AATACACCTGTATGATCCCTCGG - Exonic
904904323 1:33883711-33883733 CAAAGACCCATATGATCCCTGGG + Intronic
914986181 1:152459049-152459071 CTAACAGCAGTATGAATCTTGGG + Intergenic
916200962 1:162271288-162271310 CACCCCCCAGCATGATCCTTGGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
923175990 1:231465869-231465891 CAAACCCCAATAAGATTCTTAGG + Intergenic
924101397 1:240606475-240606497 CAAACACCACTGTAATCATTAGG + Intronic
1065251193 10:23816225-23816247 CAAACATTACTTTGATCCTTAGG + Intronic
1066312558 10:34211904-34211926 CAAATACCAGAAAGAGCCTTGGG - Intronic
1072528900 10:96299772-96299794 CAAACACTATTTTTATCCTTAGG - Intergenic
1083003023 11:59314338-59314360 CAAACACCTGCATGAACATTTGG - Intergenic
1089923160 11:122229789-122229811 CAAACAACAGTCTGACCCCTCGG + Intergenic
1089986682 11:122820744-122820766 CAAATATCAGTATGACCCTTGGG - Intergenic
1090533047 11:127611162-127611184 CAAATCCCTGGATGATCCTTGGG - Intergenic
1093082030 12:14823315-14823337 TAAACAGCAGTAACATCCTTGGG + Exonic
1095581013 12:43798560-43798582 CATACCCCAATATGATCCTCTGG + Exonic
1095724105 12:45433435-45433457 CCAACCCCAGTATGATCCAAGGG - Intronic
1098808308 12:75050330-75050352 TATAGACCAGTATGTTCCTTAGG - Intronic
1102067717 12:109991960-109991982 AAAACACCAGTGGGAGCCTTGGG + Intronic
1103217674 12:119214958-119214980 CAAACACCATTTTGACCCTTTGG - Intronic
1103808800 12:123596617-123596639 CAAACAGCAGAGTGGTCCTTTGG + Exonic
1107064463 13:36197585-36197607 CAAAAGCCAGTATCATCTTTGGG + Intronic
1116448928 14:45043000-45043022 TCAAAACCAGTATGATTCTTAGG - Intronic
1132814687 16:1820178-1820200 CAGACACCTGGATGATCCTGTGG + Intronic
1135062505 16:19282886-19282908 CAAACACAAGTATGGTCAATGGG - Intergenic
1135810585 16:25583261-25583283 CAAACACCAGTCAGAGGCTTGGG + Intergenic
1136931851 16:34425316-34425338 GAAAAACTAGTATGATTCTTTGG + Intergenic
1136972721 16:34986499-34986521 GAAAAACTAGTATGATTCTTTGG - Intergenic
1137272291 16:46909872-46909894 CAAAGACCACTGTGATCCTAAGG + Exonic
1138991892 16:62400209-62400231 CACACACCAGCATGATCTTTAGG - Intergenic
1141308222 16:82887396-82887418 CAAACACCAGCATGCCCCTGTGG + Intronic
1150902283 17:69293818-69293840 CACACACCAGTATGATTGTAGGG - Intronic
1160762967 19:795097-795119 CAAGCACCAGTCTAACCCTTCGG - Intergenic
1165013726 19:32866201-32866223 CACACACCAGTGGGATCCCTGGG + Intronic
925372916 2:3360875-3360897 CAATCACCAGGATGACCCTCAGG + Intronic
925388184 2:3477934-3477956 AAAACACCTGTATACTCCTTGGG - Intronic
926418346 2:12673111-12673133 CACACACCAGGAAAATCCTTAGG - Intergenic
927236224 2:20877758-20877780 CAAAAAGCAGTATGGTACTTTGG - Intergenic
927298214 2:21479569-21479591 CTGCCACCAGGATGATCCTTGGG + Intergenic
933112190 2:78416881-78416903 CAAACAACAGCATCAACCTTTGG - Intergenic
933533161 2:83535955-83535977 AAAACAGCCATATGATCCTTTGG - Intergenic
938663331 2:133509371-133509393 CACACACTAGAATCATCCTTGGG + Intronic
939599953 2:144176392-144176414 CAAAAGCCAGTATCATACTTGGG + Intronic
941220741 2:162777115-162777137 CAAACAGCAGAATAATCCTAGGG - Intronic
942544847 2:177052988-177053010 CAAGCCCCAGTATGACCGTTTGG - Intergenic
944357938 2:198814797-198814819 CAAAGACCAAAATGATCCTCTGG - Intergenic
946479292 2:220038492-220038514 CAAATTCCTGTATCATCCTTAGG - Intergenic
946978230 2:225177015-225177037 CAAATAGCAGTATGATCTTCTGG - Intergenic
1172430491 20:34887186-34887208 CAAACAGGTGTATGACCCTTAGG - Intronic
1172892772 20:38278607-38278629 GAAACATCAGAATGATCCATGGG + Intronic
1175488330 20:59361690-59361712 CAAACACCATTCTGATTCTCTGG + Intergenic
1178407657 21:32337620-32337642 CAAACACCAGTATTATTCAGAGG - Intronic
1179039620 21:37790850-37790872 CAAACACCAGTATGATCCTTTGG - Intronic
1179245741 21:39632750-39632772 CTACCACCAGAATGATCCTAGGG - Intronic
1181993840 22:26859296-26859318 CAAAGACCAGAATGATTCTAAGG - Intergenic
950786041 3:15436778-15436800 CAAACACCGGTATGAGCCAGTGG - Intronic
952710909 3:36431282-36431304 AAAACACCAGTGTGGTCCCTGGG + Intronic
952757072 3:36879215-36879237 AAACAACCAGAATGATCCTTAGG + Intronic
953294452 3:41699718-41699740 CAAACAACAGTATGTTCCTTGGG + Intronic
955106446 3:55903133-55903155 CAAATACCTGTATCATGCTTTGG + Intronic
955604268 3:60683395-60683417 CAACCACCAGTCTGATCAGTCGG + Intronic
957262055 3:77914651-77914673 CAAATTCCAGTTTGATCATTTGG + Intergenic
957452542 3:80398500-80398522 CTAACACCAGTAGGATTATTAGG + Intergenic
959855962 3:111159257-111159279 CAAACACCAATATTGTCCTGAGG + Intronic
960316959 3:116190055-116190077 CAGACACCACTATGAGCCTCAGG + Intronic
960586854 3:119328024-119328046 AAAACAACTCTATGATCCTTGGG - Intronic
963262156 3:143203886-143203908 CAAACAACAGTATCTACCTTTGG - Intergenic
966064946 3:175808666-175808688 CAGGCACCTGTGTGATCCTTTGG - Intergenic
971095811 4:23400714-23400736 CAAACAACTGCCTGATCCTTTGG - Intergenic
973056835 4:45670621-45670643 AAAATACCATTATGATGCTTTGG + Intergenic
974012546 4:56620190-56620212 CAAGCCCCAGTCTGATTCTTGGG - Intergenic
977501252 4:97841141-97841163 TAAACACAAGTATGAACTTTAGG + Intronic
979883405 4:125991659-125991681 CAAACACAAGGATGAGACTTAGG - Intergenic
989294219 5:39805300-39805322 CAAAAACCATTATTTTCCTTTGG + Intergenic
990754140 5:59049596-59049618 AATACACCAGTATGATGTTTGGG + Intronic
993670475 5:90754821-90754843 CCAAGCCCAGAATGATCCTTGGG + Intronic
994150956 5:96447026-96447048 CATGCACCAGAATGATCATTTGG - Intergenic
994737979 5:103580793-103580815 CAAACACCATTATAATTCCTAGG + Intergenic
996442406 5:123506875-123506897 TAAATACCAGTATGACCCCTAGG - Intergenic
1004261442 6:14111108-14111130 CACACACCAATAATATCCTTGGG + Intergenic
1007497872 6:42273709-42273731 CATCCAACAGTATTATCCTTTGG + Intronic
1008111364 6:47498644-47498666 CAAAAAACAGTAAGATACTTTGG + Intronic
1008421596 6:51306834-51306856 CAAAAACCAGTAGGAACATTTGG + Intergenic
1009473384 6:64056641-64056663 CAAACAGGAGAATGTTCCTTTGG + Intronic
1014014996 6:116519527-116519549 CAAACATTAGTATGACCATTGGG - Exonic
1014252997 6:119133876-119133898 CAAACTCAAGTTTGATCTTTGGG + Intronic
1017733301 6:157337715-157337737 CCAAGAACAATATGATCCTTTGG + Intergenic
1018221401 6:161583845-161583867 CTGACACCAATATGATCATTAGG - Intronic
1018365992 6:163120447-163120469 CAAACTCTAATAGGATCCTTTGG - Intronic
1020822679 7:12989611-12989633 CAAACCCAAGGATGATCCCTAGG + Intergenic
1020944672 7:14587681-14587703 CAACCACCACTCTGATCATTTGG + Intronic
1020997569 7:15282184-15282206 CAAAAGCTAGTATGATCTTTTGG - Intronic
1037015276 8:13897589-13897611 TAAACACCACTAAGATCCATAGG + Intergenic
1042668974 8:71239730-71239752 CAAGCACCTGTGAGATCCTTTGG + Intronic
1042806133 8:72772826-72772848 CAAACACAAGTATGACCTGTGGG + Intronic
1049106931 8:140619854-140619876 GAAACACCGGTATGATCCCATGG + Intronic
1052210658 9:25899231-25899253 CAAGCAGCATTTTGATCCTTTGG - Intergenic
1056250611 9:84744391-84744413 CAAGCATCAGTATGAAACTTGGG - Intronic
1060381883 9:123183087-123183109 TAATCACCAGTATGATTATTTGG - Intronic
1187553174 X:20326322-20326344 CACTCACCATTATGATCCCTGGG - Intergenic
1187929540 X:24281258-24281280 CAAAGACCAGTATGGTCAATTGG + Intergenic
1190506515 X:51132105-51132127 CAAACTCCTGAATGATCTTTGGG - Intergenic
1196556985 X:117099987-117100009 CAAACACACGTCTAATCCTTGGG - Intergenic
1197027964 X:121778329-121778351 CAGAAACCACTATAATCCTTGGG + Intergenic
1198965281 X:142221868-142221890 CAAACACCAAAATGACCCATGGG + Intergenic