ID: 1179042260

View in Genome Browser
Species Human (GRCh38)
Location 21:37814596-37814618
Sequence AGCCATAAAAAGAATGAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 2, 1: 5, 2: 10, 3: 48, 4: 438}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179042260 Original CRISPR AGCCATAAAAAGAATGAGAT CGG Intronic
900672955 1:3867194-3867216 GGCCTTAAAAAGAAGGAAATTGG - Intronic
902520650 1:17013863-17013885 AGCAATAAAAAGAATGAAGGGGG - Intergenic
902842460 1:19083891-19083913 AGCCAGGAAAAAAAAGAGATTGG - Intronic
904322998 1:29708742-29708764 AGCTAGAAAAAGACTGAGCTGGG - Intergenic
904421045 1:30392539-30392561 AGCAATCAAAAGACAGAGATTGG + Intergenic
906079625 1:43076215-43076237 AGCCATAAAAAGAATGAAATTGG - Intergenic
906083777 1:43112401-43112423 TGCCATTAAAAGAGTGAGCTAGG - Intergenic
906605970 1:47172114-47172136 ATCTATAAAAAGAGTGAAATGGG - Intergenic
906692825 1:47804070-47804092 AGCCATGAACAAAATGAGAGGGG - Intronic
907263988 1:53244055-53244077 TGGCAAAAAGAGAATGAGATCGG - Intergenic
907758313 1:57332785-57332807 TTCCATAAAATGAATGAAATTGG - Intronic
908287882 1:62628494-62628516 CCACATAAAAAGAATGAAATTGG + Intronic
908393695 1:63706041-63706063 AGTCATAAAGAGAATGAAGTTGG + Intergenic
908749880 1:67411021-67411043 AGTCATAAAAACAATCAAATAGG - Exonic
910200950 1:84697963-84697985 AGTAATAATAATAATGAGATTGG + Intergenic
911210936 1:95137367-95137389 ATCCCTAAAAAGAAGGGGATGGG - Intronic
911301628 1:96181681-96181703 ATCAATAAAAAGAATTATATGGG + Intergenic
911479716 1:98422798-98422820 GGCAATAATAAGAATGAAATGGG - Intergenic
911995386 1:104759100-104759122 TGCCATAAAATGAATGAAACTGG - Intergenic
912195122 1:107388854-107388876 AGACAGAAAAAGAATGTGAGAGG + Intronic
912198682 1:107430339-107430361 AGCCTTAAAAAAAGTGAGAGGGG - Intronic
912647759 1:111411218-111411240 AGCCATAAAAAAAACAAGATCGG + Intergenic
912722841 1:112034594-112034616 AGTGATGAAAAGACTGAGATAGG + Intergenic
913312529 1:117515715-117515737 AGCCATAAAAAGACAAATATGGG + Intronic
914499013 1:148227499-148227521 AGCCCTTTAAAGAATGAGGTAGG + Intergenic
914666644 1:149838255-149838277 AGACATGAGAAGACTGAGATGGG + Intergenic
914669123 1:149855541-149855563 AGACATGAGAAGACTGAGATGGG - Intronic
914994148 1:152526634-152526656 TGCCATGAAAAAAATAAGATGGG + Intronic
916001521 1:160621069-160621091 AACTTTAGAAAGAATGAGATAGG - Intronic
917107229 1:171504702-171504724 AGCTTTGAAAAGAATGAAATTGG - Intronic
917917458 1:179717419-179717441 AGCATCAAAAAGAATAAGATAGG - Intergenic
918445609 1:184614008-184614030 AGAAATAAAAATAAAGAGATGGG + Intronic
920147659 1:203875955-203875977 AGCCTTAAAAAGAAAGAAAGAGG - Intergenic
920351770 1:205342741-205342763 AGGCGTGAAAAGAATGAAATGGG + Intronic
921837844 1:219795942-219795964 AGCCTTGAAAAGAAAGAGGTGGG + Intronic
921940490 1:220833753-220833775 AGCCATAAAAGAAATGTGACAGG - Intergenic
923476775 1:234341347-234341369 CCCCATAAAAAGAAAGAGACTGG + Intergenic
923574668 1:235147255-235147277 AAACAAAAAAACAATGAGATGGG + Intronic
923708391 1:236364854-236364876 AGAAATAAAAAGCATCAGATTGG - Intronic
923903318 1:238354199-238354221 AGCCACAAAAAGAATAAAATAGG - Intergenic
924356897 1:243188149-243188171 AGCCATTACAACAATGAAATAGG - Intronic
924523455 1:244825824-244825846 TGTCATAAAAAAAATAAGATGGG + Intergenic
1063698328 10:8359372-8359394 AAACATAAAAAGTAAGAGATGGG - Intergenic
1064456866 10:15495891-15495913 AGCATTAAAAAAAATGAGAGAGG + Intergenic
1064489321 10:15834152-15834174 AGCCATAAAAAGCTTGAGGAGGG + Intronic
1064838028 10:19556567-19556589 AGCCATGAAAAGACAGAGAGGGG - Intronic
1065181000 10:23125458-23125480 AGACATGAAAAGAATAAGAAGGG - Intergenic
1065590611 10:27258303-27258325 AGCCATTTAAAAAAAGAGATGGG + Intergenic
1065745547 10:28837925-28837947 AGACAAAGAAAGAATGAGACAGG + Intergenic
1066984542 10:42453754-42453776 AGGTATAAAGAGAATGAGATGGG + Intergenic
1068073663 10:52227164-52227186 AACCTTAAAAATAATGTGATGGG - Intronic
1068549194 10:58386645-58386667 AGCCAGAAAAAGGAGGAGCTAGG - Intronic
1068745796 10:60529336-60529358 AGGCATAAACACAATGAGAGTGG + Intronic
1069324862 10:67220930-67220952 AGCAACAAACAAAATGAGATTGG + Intronic
1069481560 10:68787316-68787338 AGCTATAAAAAGAATGAGGCAGG - Intronic
1070191272 10:74113995-74114017 AGAAAAAAAAAGAATGAGACAGG - Intronic
1070760573 10:79021710-79021732 TGGCATCAAAAAAATGAGATCGG + Intergenic
1071534214 10:86414317-86414339 AGCCATAAAAGGAAAGTGAGGGG - Intergenic
1072147815 10:92658249-92658271 AGCCAGAAAAAAAATTAGCTGGG - Intergenic
1072444744 10:95489237-95489259 AGAGAGAAAAAGAAGGAGATTGG - Intronic
1073122122 10:101128670-101128692 AGCCATAAAAAGGAAAAGAAGGG - Intronic
1074119480 10:110482894-110482916 AGCTATAAAAAGAATGTGAGAGG - Intergenic
1074274781 10:111990843-111990865 AGGCTTAAAAAGCATGAGAGGGG + Intergenic
1075364325 10:121870654-121870676 TGTCATAAAAAGAAAGAGAAAGG - Intronic
1078968944 11:16383279-16383301 AGCAATAAGAAGAAAGAGAAAGG + Intronic
1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG + Intronic
1080927396 11:36772042-36772064 AGCAATAAAAAAAAAGAGAAAGG - Intergenic
1080974098 11:37314786-37314808 AGCAATATTAAGAATGAGAAGGG - Intergenic
1083806009 11:65074372-65074394 AGCCTTAAAAAGGAGGAAATTGG - Intronic
1083868727 11:65473503-65473525 AACAATAAAAAGAGTGAGGTAGG + Intergenic
1085755995 11:79201805-79201827 TCCCATAAAACAAATGAGATTGG - Intronic
1085873370 11:80376913-80376935 AGCCATATAAAAAATGATCTAGG - Intergenic
1085891873 11:80589221-80589243 AATCATAAAAAGAATAAAATAGG + Intergenic
1086247472 11:84770950-84770972 AGCCATAAAAAGAATGAAATCGG - Intronic
1086494612 11:87389258-87389280 AGCCATAAAAAAGATGAGATTGG + Intergenic
1086646969 11:89234620-89234642 AGACACAAAAATATTGAGATTGG - Intronic
1087488737 11:98793871-98793893 AACCACAAAAAGAATAAGAGAGG + Intergenic
1089763094 11:120742930-120742952 AGCCATAAAAAGAATGAGATTGG + Intronic
1089993920 11:122886746-122886768 AGCCAAAAAAAGAATTAAGTGGG - Intronic
1090526342 11:127542625-127542647 AACCATAATTAGAATCAGATTGG - Intergenic
1092061887 12:5557827-5557849 AGCAAGGAAAAGAATGAGATGGG - Intronic
1092179823 12:6438337-6438359 AAACATAAAAAGGATGAGATTGG - Intergenic
1092467970 12:8751408-8751430 GGCAATAAAAAGAATAAGAAAGG + Intronic
1093366894 12:18313270-18313292 AGGCAAAAAAAGAAAGAGAAAGG + Intronic
1095202515 12:39400644-39400666 AGCCATAAAAAGAAAGGGAAGGG + Intronic
1096729986 12:53601666-53601688 AGCCGTAAATAGAATCAGAAGGG - Intronic
1097724358 12:63058028-63058050 AACAATAAAAAGAAGAAGATAGG - Intergenic
1098734835 12:74087081-74087103 AGCCTTAAAAGGAAGGAAATTGG - Intergenic
1100064882 12:90630600-90630622 ATCCTTAAAAAAAATAAGATTGG - Intergenic
1100485328 12:95019681-95019703 AGACATAAAAAAAAATAGATTGG - Intergenic
1101379596 12:104203171-104203193 AGCAATAAAAGGAAAAAGATGGG - Intergenic
1101977117 12:109369246-109369268 AGCCATGAAAAGAATGAGCCAGG - Intronic
1103085459 12:118059717-118059739 AGCTATAAAAAGATTCACATAGG + Intronic
1103416602 12:120745899-120745921 AACCATGAAAACTATGAGATGGG - Intergenic
1105667111 13:22572421-22572443 ATCCTTAAAAATAATGAAATGGG + Intergenic
1106924259 13:34596918-34596940 ATGCATAAAAAGAATCAAATGGG + Intergenic
1107705483 13:43099128-43099150 AGCATTAAAAAGAATAAAATAGG - Intronic
1109043135 13:57368699-57368721 AACCATAAAAGGCATGAGAATGG + Intergenic
1109084062 13:57947622-57947644 ACCAATAAAAATAATGAAATGGG - Intergenic
1109426581 13:62172240-62172262 AGCCATGACAAGAATGAAATCGG + Intergenic
1109788502 13:67215156-67215178 AGTCAGAAAAAGAATTAAATAGG + Intronic
1110049402 13:70875422-70875444 GGAGATAAAAAGAATTAGATGGG + Intergenic
1110075155 13:71231015-71231037 TACCATAAAATGAATGAGTTTGG - Intergenic
1110475209 13:75906105-75906127 AGCCAGAAAAAGAACAAGAGGGG + Intergenic
1110504846 13:76273008-76273030 AGCAATGAAAAAAATGATATAGG + Intergenic
1110509757 13:76335372-76335394 AGGCATTACAAGAATGAGAATGG - Intergenic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112390077 13:98975079-98975101 AGCCATTAAAATAATGGCATAGG + Intronic
1112731024 13:102362296-102362318 AGCCAGAAAAAGGATAAAATAGG - Intronic
1112843670 13:103611142-103611164 AGCCATAAAAACAATGAATAAGG - Intergenic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1113204838 13:107905382-107905404 CCACATAAAAAGAGTGAGATGGG + Intergenic
1114443363 14:22768713-22768735 AGCCATCAAAGGAAGAAGATAGG - Intronic
1114584170 14:23794750-23794772 ACCCATGTAAAGAATGGGATTGG - Intergenic
1114766022 14:25371468-25371490 AGACAGAAGAAAAATGAGATTGG + Intergenic
1114778030 14:25508077-25508099 ATCCAAAAAAAGAATAAGGTTGG - Intergenic
1115394161 14:32888890-32888912 ACCCACAAAAAGAATGAAAATGG + Intergenic
1115930970 14:38494109-38494131 GGCCATAAAAAGAATAAATTCGG - Intergenic
1116968956 14:51044789-51044811 AGTAAAAAAATGAATGAGATGGG + Intronic
1117585156 14:57194043-57194065 TGCCTTAAAATGATTGAGATGGG - Intergenic
1117619469 14:57569735-57569757 AGCCAAAGAAAGATTGATATAGG + Intronic
1118118311 14:62806608-62806630 ACCCAGATAAAGAATGGGATTGG + Intronic
1119355684 14:74004461-74004483 AACCACAGAAATAATGAGATAGG - Intronic
1119901221 14:78261645-78261667 AGCAATAAAATGCATGAGTTGGG - Intronic
1120777293 14:88451824-88451846 AGAAATAAAAAAAATGATATAGG - Intronic
1121708989 14:96022965-96022987 AGACAGAAAAAGTATGACATGGG + Intergenic
1121750531 14:96351044-96351066 TGCCAAAAAAAGTATAAGATGGG - Intronic
1123223377 14:106877419-106877441 AGCCCTAAAAAGCATGGGCTGGG - Intergenic
1124943738 15:34243392-34243414 AGCTATAAGAGGAAAGAGATGGG + Intronic
1125072297 15:35569774-35569796 AGCAATAAACAGAATGAAAAGGG - Intergenic
1125441283 15:39706914-39706936 GCCTATCAAAAGAATGAGATAGG - Intronic
1125786262 15:42320966-42320988 AGCCACAAAAACAAAGAGAATGG - Intronic
1126288357 15:47042564-47042586 AGCCTTAAAAAGAAAGAAGTTGG - Intergenic
1126300315 15:47187344-47187366 AGACATAAAAATCTTGAGATTGG - Intronic
1126387306 15:48107325-48107347 ACCCATAACTAGAAAGAGATTGG - Intergenic
1126728257 15:51655088-51655110 AGCCTTAAAAAACATCAGATGGG - Intergenic
1129414223 15:75366342-75366364 AACCATAAAAATAATGGGCTGGG - Intronic
1130702506 15:86199183-86199205 ACCTTTATAAAGAATGAGATAGG - Intronic
1130744992 15:86642331-86642353 AACCATAAAAAGAAAAAGACAGG - Intronic
1131434277 15:92410880-92410902 AGCTGGAAAAAGAATGACATTGG + Intronic
1131760791 15:95620431-95620453 AGCCATAAAAAGAAAGAAGATGG - Intergenic
1131830290 15:96350374-96350396 AAAAATAAAAAGAATGAGAAGGG + Intergenic
1132018952 15:98343949-98343971 AGCCATAAAATGAAACACATGGG - Intergenic
1132387121 15:101408514-101408536 AGCCATAGGAAGGAGGAGATGGG - Intronic
1134331497 16:13255259-13255281 AGACAGAAAGAGAATGAGAGAGG - Intergenic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135587747 16:23683828-23683850 AGCCATAAGCAGAATGTGAAGGG - Intronic
1136870369 16:33802114-33802136 AGCAATAAAAAGACTGATATTGG + Intergenic
1137341293 16:47608869-47608891 AGTAATAAAAAGTATCAGATTGG - Intronic
1138137001 16:54531922-54531944 AGGCATAAAAAGAAAGAAAATGG - Intergenic
1138405977 16:56794626-56794648 TGTCATTAAAAGAATGGGATAGG + Intronic
1138646353 16:58428126-58428148 AGCCATAAAAAGATGGAGGTAGG - Intergenic
1139648621 16:68350112-68350134 AGCCTTCAAAAGAACGAAATGGG - Intronic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140063513 16:71590928-71590950 AGAGTGAAAAAGAATGAGATGGG + Intergenic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1140799995 16:78478252-78478274 AGCTATAAAAAGAATGGAATAGG - Intronic
1140968889 16:79993913-79993935 AGTCATGAGAAGACTGAGATGGG + Intergenic
1141113363 16:81288421-81288443 AAAAATAAAAAGAATGAGCTAGG - Intronic
1141386717 16:83628142-83628164 AGGCATAAACAGGATAAGATGGG - Intronic
1142255739 16:89012987-89013009 AGTCACATAAAGAATGAGATGGG - Intergenic
1203101803 16_KI270728v1_random:1313936-1313958 AGCAATAAAAAGACTGATATTGG - Intergenic
1143279648 17:5743406-5743428 AGACATAAAAAGAATGTAAGAGG + Intergenic
1144418733 17:15075853-15075875 ACCCATATAAAGAATGAGAAAGG - Intergenic
1144545224 17:16188722-16188744 AGCCTCAAAAAGAATCAAATAGG + Intronic
1145248709 17:21285719-21285741 AGCCAGGACAAGAATAAGATGGG - Intronic
1145922608 17:28621743-28621765 AGCCAGAAAAACAATGAGAAAGG + Intronic
1146528424 17:33586564-33586586 AGCCAAAAGAAGAATGACAAGGG - Intronic
1146994088 17:37302670-37302692 AGCATTAAAAAGAATAAAATAGG - Intronic
1148636384 17:49152264-49152286 AGCTATGAAAAGGCTGAGATGGG + Intronic
1148929327 17:51115347-51115369 AACCATAAAAAAAATTAGTTGGG - Intronic
1148958454 17:51372938-51372960 ATCCATATAAAGAATGAGTCTGG - Intergenic
1149864120 17:60140976-60140998 ATCCATAAAAAGAAAGAGAAAGG + Intergenic
1150078257 17:62212775-62212797 AGCCATAAAAAAAGGCAGATTGG - Intergenic
1150414566 17:64976242-64976264 AGCAATAAAAAGAAAGAGAATGG - Intergenic
1150743151 17:67795807-67795829 AGCGATAAAAGGAAGGAGCTTGG + Intergenic
1150797062 17:68247360-68247382 AGCAAGAAAAAGAAAGAGAATGG + Intergenic
1203166445 17_GL000205v2_random:101331-101353 AGCCTAAAAAATAATGAAATTGG + Intergenic
1155644444 18:28060616-28060638 AACCATAAACAAAATGGGATAGG + Intronic
1155690522 18:28616367-28616389 AGTCATAAAAATAATAAGATTGG - Intergenic
1155769184 18:29674686-29674708 AGGCAAAAAGAAAATGAGATTGG - Intergenic
1156140627 18:34105738-34105760 TGACATAAAATGAATGAAATAGG - Intronic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1156926118 18:42582098-42582120 AACCATTTAGAGAATGAGATAGG + Intergenic
1157470890 18:47987589-47987611 AGCCATAAGGAACATGAGATGGG + Intergenic
1157649831 18:49317271-49317293 AACCATAAAGAGAATGATAGTGG + Intronic
1157670446 18:49524098-49524120 AGACATAAAAACAATTATATGGG + Intergenic
1157938824 18:51903248-51903270 AGCCATAAAATGACAGAGACAGG - Intergenic
1158421274 18:57296894-57296916 AGCCATATAAACAATGTGCTGGG + Intergenic
1158739017 18:60117722-60117744 AGAGATAAGAAGAATAAGATTGG + Intergenic
1158887751 18:61844943-61844965 AGGAATAAAATGAATGAAATAGG - Intronic
1158946982 18:62455602-62455624 ACCCATAACAGGAAGGAGATGGG - Intergenic
1159513466 18:69427193-69427215 AGCCATAAAGAGAGAGAGAGAGG - Intronic
1161716543 19:5879366-5879388 AGCCTTACAAAAAATGAGCTGGG + Intronic
1162267532 19:9588165-9588187 AGCCATAAAAAAAATGCAAGAGG - Intergenic
1163395683 19:17059323-17059345 AGCCATGTAAAAAATGAGACAGG - Intronic
1163882016 19:19932443-19932465 AGCCGCAAAAAGACAGAGATTGG - Intronic
1164029316 19:21387109-21387131 AACCATAAAAAGAATCATATTGG + Intergenic
1164402586 19:27911868-27911890 AGCCAGAAAGAGAAAGAGCTGGG + Intergenic
1164917949 19:32066934-32066956 AGTCATTAAAAGAATGAGATAGG + Intergenic
1165979987 19:39712961-39712983 AGGCATAAAAATAATATGATGGG - Intergenic
1168622754 19:57892328-57892350 ACCCAGATAAAGAATGAGATTGG + Intronic
925128979 2:1481252-1481274 AGACAAGAAAAGAATGAGAAAGG + Intronic
927926073 2:27014658-27014680 AGCCATAAGAAGAAGGTGATTGG + Intronic
927934417 2:27068094-27068116 AGCTATATAAAGAAAGGGATGGG + Intronic
928209700 2:29314390-29314412 AGCAATAAAAGGAATCAGGTTGG - Intronic
928444850 2:31324662-31324684 ACTCATATAAAGAATGAGGTGGG + Intergenic
928678044 2:33669525-33669547 AACCATAAAAAGAATGCAAGAGG - Intergenic
930080412 2:47442006-47442028 AGCCATAAAAAGGAATGGATTGG - Intronic
930921835 2:56765269-56765291 AGGCATAAAAAGAATGGATTAGG - Intergenic
931356507 2:61541685-61541707 AAAAATAAAAATAATGAGATAGG + Intergenic
933382619 2:81568901-81568923 AACCATAAAAATAATTAGCTGGG + Intergenic
933406405 2:81865555-81865577 AAACATAAAAAGAATGATAAAGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
935874670 2:107493837-107493859 AGCCATTTAAAGAAAGAGCTTGG + Intergenic
936234213 2:110729786-110729808 AGACATTATAAGAAAGAGATGGG - Intergenic
936344617 2:111665807-111665829 AGGCATATTAAGGATGAGATGGG - Intergenic
937497284 2:122434442-122434464 AGCCATGAACAGAGGGAGATGGG - Intergenic
937604784 2:123786019-123786041 AGCCAAAAAAAGAAAGAAAGAGG - Intergenic
937687626 2:124715777-124715799 TGCTATAGAAAGAAGGAGATTGG + Intronic
939857200 2:147373600-147373622 ACCTATAAAAAGAAAGAGATTGG + Intergenic
940843355 2:158610908-158610930 AGTGTTAAAAAGAATGAGCTTGG - Intronic
941327650 2:164136691-164136713 AACCATAAAAACAATTAGAAAGG + Intergenic
942288824 2:174449542-174449564 AGCCATAAAAAGAATGAAATAGG + Intronic
943186472 2:184613578-184613600 ATTAATAAAAAGAAAGAGATGGG + Intronic
943215301 2:185026046-185026068 TGCCCTAAAAAAATTGAGATGGG - Intergenic
943422489 2:187684445-187684467 CACAATAAAATGAATGAGATAGG + Intergenic
944521067 2:200567211-200567233 AGGCATTAAAAGAATAAGAGAGG - Intronic
945559216 2:211317440-211317462 AACAAAAAAAAGAAGGAGATGGG - Intergenic
945811616 2:214556316-214556338 AGCCAGAAAAACAATCAGTTTGG - Intronic
945964666 2:216173755-216173777 AGTTATAAAAAGGATGAGTTCGG + Intronic
946362965 2:219230031-219230053 AGCCCACAAAAGAATGAAATAGG - Intronic
946595550 2:221302096-221302118 ATTCATAAAAATAATCAGATGGG - Intergenic
947058695 2:226137062-226137084 AGCCATCAAGAGAGTGAGAAAGG + Intergenic
947458348 2:230279078-230279100 AGCAACAAAAAGAATAAAATAGG + Intronic
947468452 2:230376486-230376508 AGCAACAAAAAGAATAAAATGGG + Intronic
947560851 2:231150043-231150065 AGCCATAAAAAAAATTATATAGG + Intronic
948155785 2:235779778-235779800 AGGCATAAAGTGAATGTGATAGG + Intronic
948383994 2:237570406-237570428 ACCCATCAGAAGAATGGGATGGG + Intergenic
1168744960 20:231377-231399 AGCAACAAAAAGAATAACATAGG + Intergenic
1169040571 20:2491679-2491701 AGCCATAAACAGTATGTGAACGG - Intronic
1170327093 20:15168684-15168706 AGCCATAAAAAGAATGAGCCAGG + Intronic
1171439758 20:25150499-25150521 AGCCATGAATAGAAAGAGATGGG + Intergenic
1172318936 20:33981021-33981043 AGACATAAAACAAATGAGCTTGG - Intergenic
1172858559 20:38028213-38028235 ATCAATTAAAAGATTGAGATTGG + Intronic
1173013120 20:39200396-39200418 AGACATAATAAAAATGAGAGTGG + Intergenic
1173027820 20:39325677-39325699 AGCCAGATAAAGAAGGTGATTGG + Intergenic
1173045046 20:39501734-39501756 AGCCACATAAAAAGTGAGATGGG + Intergenic
1174109786 20:48190746-48190768 AGCCTTACATAGAAAGAGATTGG - Intergenic
1174183246 20:48688086-48688108 AGCCAAAAAAAAAATGGGGTGGG + Intronic
1174250593 20:49216715-49216737 GGAGATAAAAAGAATGACATGGG + Intergenic
1174668351 20:52282245-52282267 GGCCATTAAAAGCTTGAGATAGG + Intergenic
1175573527 20:60042174-60042196 AGCCATAAAATGAGGGAAATGGG - Intergenic
1175582005 20:60107170-60107192 AAACTTAAAAAGAATGAGGTTGG - Intergenic
1176405310 21:6357765-6357787 AGCCTAAAAAATAATGAAATTGG - Intergenic
1176431847 21:6631338-6631360 AGCCTAAAAAATAATGAAATTGG + Intergenic
1177387535 21:20427276-20427298 AGCAACCAAAAGAATGAGAAGGG - Intergenic
1177496346 21:21896633-21896655 AGCCATTAAAAGAATGAAATAGG - Intergenic
1177592744 21:23192938-23192960 AGACAAAGACAGAATGAGATGGG - Intergenic
1178716842 21:34972728-34972750 AACTCTACAAAGAATGAGATTGG + Intronic
1179042260 21:37814596-37814618 AGCCATAAAAAGAATGAGATCGG + Intronic
1181684280 22:24517583-24517605 AGCCAATAAAAGCCTGAGATAGG - Intronic
1181816770 22:25443890-25443912 AGTCATAAAAACAATAAAATAGG + Intergenic
1182046529 22:27278558-27278580 AGCGATATGAAGAAAGAGATAGG - Intergenic
1183269430 22:36851412-36851434 AGCCATAAAATCATAGAGATGGG + Intergenic
1184914018 22:47554827-47554849 AGCCACTTAAAGAATGATATGGG - Intergenic
1185090263 22:48763647-48763669 AGACATAAAAGGAATAATATAGG + Intronic
949127732 3:466535-466557 AGCCATTATAAGAATGAAATAGG - Intergenic
949384720 3:3488480-3488502 AGAAGTAAAAAAAATGAGATGGG + Intergenic
949729274 3:7089263-7089285 AGTCATAAAATCAATGAGAAAGG + Intronic
949809120 3:7987128-7987150 ATCTATAAAAAGCATGGGATGGG + Intergenic
949927580 3:9054079-9054101 AGCCAAGAAATGAATGAGCTTGG - Intronic
950092148 3:10303653-10303675 ACCCATAAACAGAAGAAGATTGG - Intronic
950246545 3:11424941-11424963 ATCCATTAAAAGAATGAGGCAGG - Intronic
951416353 3:22427481-22427503 ACCAATAAAAGGAATGAGAAAGG + Intergenic
951616064 3:24545889-24545911 ACCCACAAAAGGAGTGAGATTGG + Intergenic
952064227 3:29548269-29548291 AGCAATAAAAAAAATTAGCTGGG + Intronic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
952432891 3:33242620-33242642 ACCAATAACAAGAATGAGAAAGG + Intergenic
952786540 3:37161040-37161062 AGCCATAAAAACAAATATATTGG + Intronic
952810535 3:37398578-37398600 GGTCACTAAAAGAATGAGATGGG - Intronic
953424990 3:42788379-42788401 AACCATAGAAAGAATTAAATGGG + Intronic
953976822 3:47388059-47388081 AGCTATTAAAGGAATGAGAGGGG - Intronic
954120310 3:48494592-48494614 AGCCTTAAAAAGAAGGAAATTGG - Intronic
955270936 3:57498697-57498719 AGCAATAAAAGGAATAAGTTAGG + Intronic
955906471 3:63813102-63813124 AGCCATTAAAAGAAGAAGGTTGG - Intergenic
956223973 3:66935422-66935444 ACCAATAAAAGGAATGAAATTGG + Intergenic
956226609 3:66966694-66966716 TACCATAAAATGAATGAGCTTGG + Intergenic
957991223 3:87630235-87630257 AGCCCTAAAAGGGATGAGGTTGG - Intergenic
958051176 3:88348830-88348852 AGCAATAGAAACATTGAGATGGG - Intergenic
958196751 3:90250972-90250994 AGCTAGAACAAGAATAAGATAGG - Intergenic
958420181 3:93920844-93920866 AGCTAGAACAAGAATAAGATAGG - Intronic
958483305 3:94672843-94672865 AGCCATTACAAGAATAACATTGG - Intergenic
958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG + Intronic
959114070 3:102155494-102155516 AGCTTTAAAAAGAATGAGATTGG + Intronic
959155783 3:102664462-102664484 AGCCATTATGAAAATGAGATAGG - Intergenic
959877378 3:111400722-111400744 GGCAATGAAAAAAATGAGATGGG + Intronic
959956990 3:112251054-112251076 AGTCATAAAAAGAACAAGATTGG + Intronic
960243122 3:115369237-115369259 AGCCTGAAAATGAAAGAGATTGG + Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960984572 3:123267201-123267223 AGCAATGAAAAGACAGAGATTGG - Intronic
961593590 3:127998926-127998948 AGCCATTTTAAGGATGAGATGGG - Intergenic
962791319 3:138814176-138814198 AGTCATAGAAAGATTGAGTTGGG + Intronic
963524716 3:146403627-146403649 AGTCATAAAAATAATGAGACAGG - Intronic
964306397 3:155345327-155345349 AACCATAAAAAGAAGGAAATTGG - Intergenic
964813290 3:160689771-160689793 AGCCAAACAAAGAATGAGAAAGG + Intergenic
965288460 3:166846068-166846090 AGCCATGAAAAGGATGAGATTGG - Intergenic
965588740 3:170342775-170342797 ACCCAGATAAAGAATGGGATCGG - Intergenic
965668619 3:171122749-171122771 GGCTATAAAAAGGATGTGATTGG - Intronic
966382052 3:179354244-179354266 AGCCATAAATAGAAAGGGGTAGG + Intronic
966566611 3:181389704-181389726 AGCAATAAAAAGAGTAAAATAGG - Intergenic
967796052 3:193599909-193599931 AGACATAGAAACAGTGAGATTGG + Intronic
968298243 3:197593686-197593708 AGGCCTAAAAAGAATGTGTTTGG + Intergenic
968344283 3:197987568-197987590 AGCCAGAAAAAAAATGACTTAGG + Intronic
969491623 4:7502440-7502462 AGCCATCAAAAGGTGGAGATGGG + Intronic
971219994 4:24696203-24696225 AAAAATTAAAAGAATGAGATAGG + Intergenic
971401095 4:26275924-26275946 AGCCATAAAAACTATGATTTGGG - Intronic
971461518 4:26903805-26903827 AACAAAAAAAAGAATCAGATGGG - Intronic
971887210 4:32466130-32466152 AGCCATTAAAATAATAAGGTAGG - Intergenic
971903921 4:32700888-32700910 AGACATAAAAATACTAAGATAGG + Intergenic
972176467 4:36412752-36412774 AGAAAAAAAAAGAATGACATTGG + Intergenic
973082616 4:46012887-46012909 ACCCATAAAAACAAAGAGAGGGG - Intergenic
973835642 4:54806620-54806642 AGCCATGAAATGAATTAGATGGG - Intergenic
973917582 4:55651491-55651513 TGACATAATAAGAATGAGAATGG - Intergenic
973999055 4:56492220-56492242 ATGCATAAAAAGGATGAAATAGG - Intronic
974083983 4:57239959-57239981 TGCCATAAAAACAATGAGCATGG - Intergenic
974370304 4:61008206-61008228 AGGCATAAAAAGAAGCATATAGG - Intergenic
974614078 4:64258839-64258861 AGGCATATAAAGAATCACATTGG + Intergenic
974925494 4:68292855-68292877 CCCCATCAAAAGAATGAAATTGG + Intergenic
974957029 4:68654462-68654484 TGCAAAAAAAAGAATAAGATTGG + Intronic
975278775 4:72535800-72535822 AGACAGCAAAAGAATGAGGTTGG + Intronic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
977674538 4:99732997-99733019 ACCCAGATAAAGAATGGGATTGG - Intergenic
978044502 4:104109575-104109597 AACAATAAAAAGAATAAAATAGG + Intergenic
978998710 4:115189317-115189339 AGCCATAGAAAGAAAAAGAAAGG - Intergenic
979347423 4:119605023-119605045 AGTCATAAAATGAATTAGAGGGG - Intronic
980199630 4:129639094-129639116 AGCAATAAAAAGAATTATAAAGG - Intergenic
980675558 4:136074797-136074819 AGCCACAGAAAGACTGAGTTAGG - Intergenic
981651892 4:147069744-147069766 TGGCAGAAAAACAATGAGATTGG - Intergenic
981715396 4:147746906-147746928 AACCAGAAAAAGAATGTGGTGGG - Intronic
982447747 4:155513550-155513572 AGACTTAAAAAAAATGAGAATGG + Intergenic
983169253 4:164517331-164517353 TGCCACAAAGAGAATGAAATAGG - Intergenic
985669344 5:1198984-1199006 AGACAGAAAAAGAGAGAGATGGG - Intergenic
987166369 5:15202350-15202372 ACCCAAGTAAAGAATGAGATTGG - Intergenic
987187502 5:15439870-15439892 AGCTATAAAAATAACTAGATAGG - Intergenic
987577529 5:19750552-19750574 AGACATCAAATGAAAGAGATTGG + Intronic
987723372 5:21665742-21665764 AGCCTTCATCAGAATGAGATGGG + Intergenic
988465823 5:31490706-31490728 AGCAAGAAAAGGAATCAGATTGG + Intronic
988842005 5:35092504-35092526 AGCCATAAAAAGAAAAAAAAAGG - Intronic
990311629 5:54544785-54544807 AACTATAAAAACATTGAGATTGG - Intronic
991339936 5:65597704-65597726 AGCCATTAAAAGAAAAAGGTTGG - Intronic
991361957 5:65830202-65830224 AGCCATTAGAAGAATGATGTGGG + Intronic
991665661 5:68997352-68997374 AGCCATAAAAGAAAAAAGATGGG + Intergenic
991953346 5:71968274-71968296 ACCCAAAAAAAGAATCAGATTGG - Intergenic
992298338 5:75350415-75350437 AATCTTAAAAATAATGAGATTGG - Intronic
992315664 5:75551274-75551296 AGCAATAAAAATAAAAAGATAGG + Intronic
993603869 5:89962792-89962814 AGCCATAAGAAAAAAGAAATAGG + Intergenic
994034515 5:95183691-95183713 CGCCAAAAAAAGTATGAGAATGG + Intronic
994657850 5:102615893-102615915 GACCATACAAAGATTGAGATTGG + Intergenic
995045026 5:107635982-107636004 AGTCATAAAAAGGATAAGAAAGG - Intronic
995745460 5:115397889-115397911 AGTCATAAAAATAAGGTGATGGG - Intergenic
995819332 5:116210080-116210102 AGTTATAAAAAGAATAAGTTTGG - Intronic
997255316 5:132423860-132423882 AGCCAGAAAAGGGATGATATAGG - Intronic
997287105 5:132687957-132687979 AGCCTGAAAAGGAAAGAGATGGG - Intergenic
998017833 5:138746628-138746650 AGACATATAAAGTTTGAGATGGG + Intronic
998629165 5:143879326-143879348 ACCCATAAACATAAAGAGATTGG - Intergenic
998743907 5:145235129-145235151 AGCAATAACAAGAAAGAGAATGG - Intergenic
999421212 5:151445795-151445817 AGAAATAAAAAGAATCATATGGG - Intronic
1000061022 5:157655343-157655365 ACCCAGATAAAGAATGGGATTGG + Intronic
1000437161 5:161226400-161226422 AGCATTAAAAAGAATGAGGGTGG + Intergenic
1000823234 5:166011387-166011409 CTCTATAAAATGAATGAGATAGG - Intergenic
1000946875 5:167433487-167433509 AGCAATAAAAAGCATAAGAGGGG - Intronic
1001835852 5:174831825-174831847 AGCCATAAGGAGAAAGACATAGG + Intergenic
1002455233 5:179342510-179342532 CTCCATAAAAAGAATGACAGTGG + Intronic
1003417488 6:5925091-5925113 TGTGATAAAAAGAATGAGCTTGG - Intergenic
1003450124 6:6223040-6223062 AGCCAGAAACAGAATGAGAGTGG - Intronic
1005318407 6:24627390-24627412 AGCCATGGAAAGAATGAATTGGG + Intronic
1005678773 6:28183814-28183836 AGCCAGAATAAGAATTACATTGG + Intergenic
1006235738 6:32629998-32630020 GCCATTAAAAAGAATGAGATCGG - Intronic
1007019462 6:38504845-38504867 AGCCTTCAAAAGAATGAATTAGG + Intronic
1008686735 6:53933537-53933559 AGCACTAAAAATAATGAAATTGG - Intronic
1008831150 6:55764271-55764293 AGCCATAAAAAGAATGAAATTGG + Intronic
1009627290 6:66151462-66151484 AGCCATAATAAAATTGAAATTGG - Intergenic
1009802519 6:68557813-68557835 AGCAAAAAAAAGACTCAGATTGG + Intergenic
1009854267 6:69240691-69240713 AGAGATAAAAGGGATGAGATGGG + Intronic
1010132828 6:72515003-72515025 AGCAATTAAAAGATGGAGATTGG - Intergenic
1010143404 6:72637972-72637994 AGGAATAAACAAAATGAGATGGG + Intronic
1010180293 6:73078904-73078926 TGCCGTAATAAGAATGACATGGG + Intronic
1010526643 6:76907758-76907780 AACCATAAAGAGAAAGAGAGAGG - Intergenic
1010602024 6:77840746-77840768 ATCTATAAAAAGAAATAGATGGG - Intronic
1010719392 6:79264710-79264732 ATACATAAAAAGAATAAGCTTGG - Intergenic
1012355410 6:98308047-98308069 CACAATAAAAAGAATGAGATCGG - Intergenic
1012382138 6:98632742-98632764 TGTTATAAAAAGAATGAGTTGGG + Intergenic
1012452050 6:99362985-99363007 AACCAGAAGAATAATGAGATTGG + Intergenic
1013443070 6:110191002-110191024 AGTCATGAAAAGGATAAGATAGG + Intronic
1013784025 6:113759268-113759290 AGAAATTAAAAGAATGAGATGGG + Intergenic
1014051327 6:116958881-116958903 AGCAATAAAGAAAATGAAATGGG + Intergenic
1014217099 6:118762747-118762769 AGCCATAAAAAGAATGAAATTGG - Intergenic
1014488880 6:122037149-122037171 AGGAGTAATAAGAATGAGATGGG - Intergenic
1014537010 6:122626478-122626500 AGTCATAAGAAGAATGATTTTGG + Intronic
1014720055 6:124905723-124905745 ACCCATTAAAAGATAGAGATTGG + Intergenic
1015287025 6:131497493-131497515 ACCCATAAAAAGAGCAAGATGGG - Intergenic
1015919854 6:138255748-138255770 AGCCATCAAAATAATGAAAGAGG + Exonic
1016441752 6:144091731-144091753 AAACAAAAAAAGAATGAAATGGG - Intergenic
1016633891 6:146265725-146265747 AGCCATAAGGAGAATGAATTTGG - Intronic
1017223204 6:151990437-151990459 AGCCACAGAAGGAAGGAGATTGG - Intronic
1018282918 6:162207070-162207092 AGCCTTAAAAAGATGGGGATCGG + Intronic
1018674912 6:166211720-166211742 AGCAACAAAAAGAATAAAATAGG + Intergenic
1018778325 6:167039427-167039449 AGCCATAAAAAGGAACAAATAGG - Intronic
1019130561 6:169870039-169870061 AGCCATAAAAATAAAAAGAGTGG - Intergenic
1019939208 7:4275955-4275977 AAAAAAAAAAAGAATGAGATGGG + Intergenic
1020422560 7:8025699-8025721 AGCCATAAAAAGAAGAAAATGGG + Intronic
1020576390 7:9935301-9935323 AGCAATAAAAAGACAGAAATGGG - Intergenic
1020747875 7:12100694-12100716 AGCCACAAAAAGAATAAAATAGG - Intergenic
1021428195 7:20528070-20528092 TACCATGAAAAGAATGAAATTGG + Intergenic
1022559233 7:31332243-31332265 AGCCAGAAAGAGAAGGAAATAGG + Intergenic
1024369321 7:48561926-48561948 AGCCTGCAAAAGAATGAAATTGG - Intronic
1024486769 7:49928331-49928353 AGGCATAGAAGGAATAAGATTGG - Intronic
1025118495 7:56278830-56278852 AGCCACAAAAAGGCTGAGCTAGG + Intergenic
1026174819 7:67987300-67987322 ACCATTAAAAAGAATAAGATTGG - Intergenic
1030894319 7:115038518-115038540 AGTCATAGAAAGTATGAAATGGG + Intergenic
1031780369 7:125953981-125954003 AGCCATAAAAAGGATGAAATCGG - Intergenic
1033064554 7:138141750-138141772 AACCAAAAAAAGAATGAAATAGG - Intergenic
1033799805 7:144887326-144887348 AGCACTAATATGAATGAGATGGG - Intergenic
1034152456 7:148927699-148927721 AGCCCTAAAAATAATTAGGTAGG - Intergenic
1034653472 7:152711049-152711071 AAAAAAAAAAAGAATGAGATGGG - Intergenic
1036064348 8:5362263-5362285 ATCAATATAAAGAATGAGATCGG + Intergenic
1038202856 8:25431181-25431203 AACAACAAAAGGAATGAGATGGG + Intronic
1038429421 8:27487808-27487830 AGCAGTGAGAAGAATGAGATTGG - Intergenic
1038432832 8:27513666-27513688 ACACAGAAAAAAAATGAGATGGG + Intronic
1038465011 8:27753849-27753871 AAACATAAATAGTATGAGATGGG + Intronic
1039105373 8:33983942-33983964 AGCTTCAAAAAGACTGAGATTGG - Intergenic
1040067649 8:43161124-43161146 AGCCAGAAAAAGCAGGACATGGG + Intronic
1040457619 8:47614520-47614542 AGCCATAAAAGGAACAAGATCGG - Intronic
1040957323 8:52992782-52992804 AGCCATAAAAGGAAGGGGAGGGG - Intergenic
1041157379 8:55002592-55002614 AGACATAAGATGAATGAGATCGG - Intergenic
1041199305 8:55435477-55435499 AGCTATAAAAAGGGTGAAATTGG - Intronic
1041300504 8:56406685-56406707 ATACATAGAAAGAAAGAGATAGG - Intergenic
1041482590 8:58339506-58339528 AGCCATAAAAAGGAACAGGTTGG + Intergenic
1041827034 8:62107578-62107600 AGCCATAAGAAGAAGGAAACTGG + Intergenic
1042448704 8:68920119-68920141 ACCCATAATAAGAATGACAGGGG + Intergenic
1042474776 8:69234869-69234891 AGAGATAAAAAGCATGAAATGGG + Intergenic
1043309005 8:78834891-78834913 AGCCATAAAAAAAAGCAGGTTGG - Intergenic
1043784729 8:84384559-84384581 AGCTATGAAATGAAAGAGATAGG - Intronic
1043986378 8:86697296-86697318 ATCCATAAATAAAATAAGATAGG - Intronic
1044067582 8:87718207-87718229 AGCAATAAAAGGAAAAAGATTGG + Intergenic
1044258010 8:90088611-90088633 AGCCTTAAAAAAAATGAGGTGGG - Intronic
1045076271 8:98572672-98572694 AGCACTTAAAAGAACGAGATAGG - Intronic
1045871371 8:106931106-106931128 AGACATCAAAAAAAGGAGATAGG - Intergenic
1046657940 8:116915803-116915825 AACCATAAAACGAATTAAATTGG - Intergenic
1046658070 8:116918255-116918277 AGCCATAAAATAAATTACATGGG + Intergenic
1046868177 8:119174367-119174389 AGCCAGAAAGAGAGAGAGATTGG + Intronic
1047041413 8:121000648-121000670 CACAATAAATAGAATGAGATGGG - Intergenic
1047895155 8:129358410-129358432 CCCCATAAACAGAATGAGAATGG - Intergenic
1048602556 8:135933461-135933483 AGGGATAAAGAGAATGAGTTTGG + Intergenic
1048647087 8:136433919-136433941 AGTCATAAAAAGAATGAGACTGG + Intergenic
1050291365 9:4158827-4158849 AGACATAAAATAGATGAGATGGG + Intronic
1051187664 9:14477431-14477453 AACCATCCAAATAATGAGATTGG + Intergenic
1051577727 9:18636323-18636345 AGGCAAAAAAAGATTGAGATTGG - Intronic
1051654577 9:19366649-19366671 AATAATAAAAAGAATGAAATTGG + Intronic
1052001961 9:23294846-23294868 ATAAATAAAAAGCATGAGATAGG + Intergenic
1052072374 9:24097510-24097532 AGTTATGAAAAAAATGAGATAGG - Intergenic
1053600667 9:39605562-39605584 TGCCATAAAAAGACAGAGAGAGG + Intergenic
1054252862 9:62736867-62736889 TGCCATAAAAAGACAGAGAGAGG - Intergenic
1054566979 9:66771366-66771388 TGCCATAAAAAGACAGAGAGAGG - Intergenic
1055603852 9:77947947-77947969 ATCCATAAAAAGAAGAAAATAGG + Intronic
1056468181 9:86879343-86879365 AGCCAAATAAAGAAAGTGATTGG + Intergenic
1056733108 9:89182606-89182628 AGCAATAAAGAGAGTGAGAGGGG - Intergenic
1057021547 9:91701725-91701747 AGCCATAAAAATAAGGAACTAGG - Intronic
1057752384 9:97803375-97803397 AGGGATAAAAAGGAAGAGATGGG + Intergenic
1059186045 9:112272055-112272077 AAAAATAAAAAGAGTGAGATGGG - Intronic
1203439692 Un_GL000195v1:177370-177392 AGCCTAAAAAATAATGAAATTGG - Intergenic
1185937130 X:4270229-4270251 AGCATTAAAAAAAATGTGATTGG + Intergenic
1186014940 X:5180809-5180831 AGCCATAAAATGAAGAAGTTGGG - Intergenic
1186312529 X:8336130-8336152 AGCCAGAAAAAGAGAGACATAGG - Intergenic
1186321724 X:8434664-8434686 AGCCAGAAAAATAATGAAATGGG + Intergenic
1186561576 X:10618952-10618974 AGACATTAAAAGTATGAGGTTGG + Intronic
1186850024 X:13570518-13570540 TGCCATAGCAAGAATGAGAATGG - Intronic
1187000084 X:15167670-15167692 AGCCATAAAAAGAACTTGACTGG - Intergenic
1188051183 X:25488830-25488852 AGTCATAAAATGAATGTCATGGG - Intergenic
1189265035 X:39708708-39708730 AACCAAAAAAAGAAAGACATTGG + Intergenic
1190825996 X:54018613-54018635 AAAAAAAAAAAGAATGAGATAGG - Intronic
1191642549 X:63442947-63442969 AGCCCTCAAAATAATTAGATAGG + Intergenic
1192705437 X:73524868-73524890 AGCAATAAAAACACTGTGATAGG + Intergenic
1192760626 X:74092438-74092460 AGCCATGAAAAAAATGAAAGCGG + Intergenic
1193843475 X:86438525-86438547 ACCCATAAAAAGAATGAGTTCGG - Intronic
1194866611 X:99076815-99076837 AGCCATACAATGAGTGAGGTTGG - Intergenic
1194915960 X:99709015-99709037 GCCAATAAGAAGAATGAGATTGG - Intergenic
1195773879 X:108381927-108381949 AGTCATAAAGAGAGAGAGATAGG - Intronic
1196468833 X:116002312-116002334 AGCCATACAAAAAATGATAAAGG - Intergenic
1196530437 X:116780288-116780310 ATCCATAAAGCAAATGAGATAGG - Intergenic
1196727474 X:118909159-118909181 AGCCGTAAAAAGAACAAGACTGG - Intergenic
1197152797 X:123238364-123238386 AACAGGAAAAAGAATGAGATGGG + Intronic
1197899565 X:131355545-131355567 AGCCAGAAAAAGACTGAGAAAGG - Intronic
1198201864 X:134429507-134429529 TGCCATAAAAATATGGAGATGGG + Intergenic
1198442431 X:136675886-136675908 AGCCATTGCAAGAATGAGTTTGG - Intronic
1199179257 X:144834341-144834363 AGAAATAAAAAGAATGGGCTGGG + Intergenic
1199275325 X:145935020-145935042 AGCAAGAAAAAGAATTAGATTGG + Intergenic
1199858771 X:151781064-151781086 AGCAAGAAAATAAATGAGATTGG - Intergenic
1199901962 X:152183859-152183881 AGCAATAAAGAGAATGATTTTGG - Intronic
1200380002 X:155826226-155826248 AATAATAAAAAGAGTGAGATTGG + Intergenic
1200844867 Y:7821637-7821659 AGCCATATCACGTATGAGATAGG + Intergenic
1201741296 Y:17326507-17326529 AGAAAGAAAAAGAATGAGAAAGG + Intergenic