ID: 1179044566

View in Genome Browser
Species Human (GRCh38)
Location 21:37832754-37832776
Sequence GCTCCCAGTGGAGCCCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 645}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179044566_1179044574 7 Left 1179044566 21:37832754-37832776 CCAGTGGGGGCTCCACTGGGAGC 0: 1
1: 0
2: 1
3: 49
4: 645
Right 1179044574 21:37832784-37832806 TCGGTGGGAAGAGAGAACAAAGG 0: 1
1: 0
2: 1
3: 21
4: 255
1179044566_1179044572 -8 Left 1179044566 21:37832754-37832776 CCAGTGGGGGCTCCACTGGGAGC 0: 1
1: 0
2: 1
3: 49
4: 645
Right 1179044572 21:37832769-37832791 CTGGGAGCCTGGAGGTCGGTGGG 0: 1
1: 0
2: 1
3: 38
4: 354
1179044566_1179044571 -9 Left 1179044566 21:37832754-37832776 CCAGTGGGGGCTCCACTGGGAGC 0: 1
1: 0
2: 1
3: 49
4: 645
Right 1179044571 21:37832768-37832790 ACTGGGAGCCTGGAGGTCGGTGG 0: 1
1: 0
2: 1
3: 30
4: 371
1179044566_1179044575 28 Left 1179044566 21:37832754-37832776 CCAGTGGGGGCTCCACTGGGAGC 0: 1
1: 0
2: 1
3: 49
4: 645
Right 1179044575 21:37832805-37832827 GGTATTTCTCTCCCTCTTCTTGG 0: 1
1: 0
2: 4
3: 43
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179044566 Original CRISPR GCTCCCAGTGGAGCCCCCAC TGG (reversed) Intronic
900113193 1:1018247-1018269 TCACCCAGTGGATCCCGCACTGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900378936 1:2374101-2374123 GCCCCCAGAGGAGGCCCAACTGG + Intronic
900400948 1:2472653-2472675 TCTCCCTCTGAAGCCCCCACAGG - Intronic
900512600 1:3067697-3067719 GGTCTCAGTGGAGCCGCCACAGG + Intergenic
900987636 1:6082480-6082502 ACTCCCCGTGGAGCCACCAGGGG + Intronic
901414342 1:9106390-9106412 GCTCCGAGTGGAGGACTCACTGG - Intronic
901523549 1:9804448-9804470 GCTCCCAGGGAGGCCCTCACAGG - Intronic
902032539 1:13433782-13433804 TCACCCAGTGGATCCCACACCGG + Intergenic
902033524 1:13439672-13439694 TCACCCAGTGGATCCCCTACCGG - Intergenic
902043200 1:13507113-13507135 GCTGCCTGGAGAGCCCCCACAGG - Intronic
902288086 1:15419458-15419480 GCTCTCAGTCCAGCCTCCACTGG + Intronic
904238812 1:29131079-29131101 TCACCCAGTGGATCCCACACCGG + Intergenic
907980132 1:59472510-59472532 TCACCCAGTGGATCCCGCACCGG - Intronic
909318465 1:74253272-74253294 TCACCCAGTGGATCCCGCACAGG + Intronic
911259519 1:95669563-95669585 TCACCCAGTGGATCCCACACCGG + Intergenic
911982833 1:104587139-104587161 CATCCCAGAGGAGCACCCACTGG - Intergenic
912819295 1:112854449-112854471 TCACCCAGTGGATCCCGCACGGG + Intergenic
913160987 1:116146489-116146511 TCACCCAGTGGATCCCGCACTGG + Intergenic
913469079 1:119171930-119171952 TCACCCAGTGGATCCCGCACCGG - Intergenic
915264778 1:154709055-154709077 GCTCTCAGGGGAGCACCCTCAGG - Intronic
915640010 1:157217470-157217492 GCTCCCATGGGTTCCCCCACAGG - Intergenic
915666026 1:157446218-157446240 TCACCCAGTGGATCTCCCACGGG + Intergenic
916026353 1:160836841-160836863 GCTCCCAGTAGAACCCAAACTGG - Intronic
916910031 1:169337009-169337031 TCACCCAGTGGATCCCGCACCGG + Intronic
916960364 1:169882536-169882558 TCACCCAGTGGATCCCGCACTGG - Intronic
917348788 1:174056344-174056366 TCACCCAGTGGATCCCGCACTGG + Intergenic
917445333 1:175102235-175102257 TCACCCAGTGGATCCCGCACTGG + Intronic
917932906 1:179836832-179836854 TCACCCAGTAGAGCCCCCACCGG + Intergenic
917964081 1:180167603-180167625 GAGCCCAGTGCAACCCCCACTGG + Intronic
918059091 1:181046254-181046276 TCACCCAGTGGATCCCCCACTGG - Intronic
918311684 1:183289693-183289715 GGGGCCAGTGGGGCCCCCACAGG + Intronic
918709023 1:187704045-187704067 TCACCCAGTGGATCCCGCACCGG - Intergenic
918720913 1:187850627-187850649 TCACCCAGTGGATCCCGCACAGG - Intergenic
918790049 1:188813444-188813466 TCACCCAGTGGATCCCGCACTGG - Intergenic
919237095 1:194859425-194859447 TCACCCAGTGGATCCCGCACCGG - Intergenic
919260926 1:195192277-195192299 ACTCCCAGTGGAAACCCTACAGG + Intergenic
920731291 1:208488373-208488395 TCACCCAGTGGATCCCACACTGG + Intergenic
920756764 1:208740103-208740125 TCACCCAGTGGATCCCGCACCGG - Intergenic
921094325 1:211874199-211874221 TCACCCAGTGGATCCCGCACAGG + Intergenic
921353730 1:214264442-214264464 GCTCCCAGGAGACCCACCACAGG + Intergenic
922485503 1:225970191-225970213 TCACCCAGTGGATCCCGCACTGG - Intergenic
922855873 1:228774129-228774151 TCACCCAGTGGATCCCGCACCGG - Intergenic
923157162 1:231289438-231289460 TCACCCAGTGGATCCCGCACAGG + Intergenic
923172526 1:231430754-231430776 TCACCCAGTGGATCCCGCACTGG + Intergenic
923193377 1:231641884-231641906 TCACCCAGTGGATCCCGCACCGG + Intronic
923324733 1:232871379-232871401 TCACCCAGTGGATCCCGCACCGG + Intergenic
923391183 1:233515469-233515491 GCTCCCAGAGGCGCTCCCAGAGG + Intergenic
923929999 1:238684567-238684589 TCACCCAGTGGATCCCCCACAGG + Intergenic
924117604 1:240762913-240762935 TCACCCAGTGGATCCCGCACCGG - Intergenic
924219159 1:241855516-241855538 TCACCCAGTGGATCCCGCACGGG + Intronic
1063087401 10:2832185-2832207 GCTCCCTCTGAAGCCCCCATGGG + Intergenic
1063300310 10:4844850-4844872 TCACCCAGTGGATCCCGCACGGG + Intronic
1063318643 10:5032454-5032476 TCACCCAGTGGATCCCGCACCGG + Intronic
1063949861 10:11212324-11212346 GCTCCCTGTGAGGCCCCCCCGGG + Intronic
1065743199 10:28815609-28815631 TCACCCAGTGGATCCCGCACAGG + Intergenic
1065752098 10:28896755-28896777 TCACCCAGTGGATCCCGCACCGG + Intergenic
1065895964 10:30163237-30163259 TCACCCAGTGGATCCCGCACAGG - Intergenic
1065981493 10:30902746-30902768 TCACCCAGTGGATCTCCCACCGG + Intronic
1066296176 10:34055940-34055962 TCACCCAGTGGATCCCGCACGGG - Intergenic
1066660958 10:37737754-37737776 TCACCCAGTGGATCCCGCACGGG - Intergenic
1067299148 10:44993501-44993523 GCTCCAAGATGAGCACCCACAGG + Exonic
1067497431 10:46773473-46773495 CCGCCCAGTGGAGCCAGCACAGG + Intergenic
1067597221 10:47566942-47566964 CCGCCCAGTGGAGCCAGCACAGG - Intergenic
1069766227 10:70862086-70862108 TCACCCAGTGGATCCCGCACCGG - Intronic
1070140570 10:73734552-73734574 CCGCCCAGTGGAGCCAGCACAGG - Intergenic
1070564012 10:77590216-77590238 TCACCCAGTGGATCCCGCACCGG + Intronic
1070937963 10:80315826-80315848 TCACCCAGTGGATCCCGCACTGG - Intergenic
1070968386 10:80543639-80543661 TCACCCAGTGGATCCCGCACTGG - Intronic
1071041008 10:81309010-81309032 TCACCCAGTGGATCCCGCACCGG + Intergenic
1071900928 10:90119765-90119787 TCACCCAGTGGATCCCACACCGG + Intergenic
1072189306 10:93067170-93067192 TCTCCAAGTGGAGCCCCTCCAGG - Intronic
1073789694 10:106928040-106928062 TCACCCAGTGGATCCCGCACCGG + Intronic
1074098216 10:110331891-110331913 TCACCCAGTGGATCCCGCACTGG - Intergenic
1075307698 10:121382544-121382566 TCACCCAGTGGATCCCGCACTGG - Intergenic
1075369901 10:121927483-121927505 GCTCCCACCGCAGCACCCACCGG + Intronic
1076261574 10:129071287-129071309 TCACCCAGTGGATCCCGCACCGG + Intergenic
1076549385 10:131267958-131267980 GCTCCCAGAGGAGCCAACCCTGG - Intronic
1076686524 10:132200657-132200679 CCTGCCAGGGGAGCCCCCGCTGG - Intronic
1076894572 10:133303535-133303557 GCTCCCTGTGTAGACCCCACAGG - Intronic
1076897250 10:133318721-133318743 GCTGCCAGTGGAGCAGACACAGG - Intronic
1077256285 11:1584926-1584948 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077258024 11:1597930-1597952 GCCCCCCTTGGAACCCCCACAGG + Exonic
1077258036 11:1597960-1597982 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077258048 11:1597990-1598012 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077259458 11:1608128-1608150 GCCCCCCTTGGAGCCTCCACAGG + Exonic
1077259478 11:1608188-1608210 GACCCCCTTGGAGCCCCCACAGG + Exonic
1077261135 11:1621704-1621726 GCCTCCTTTGGAGCCCCCACAGG + Exonic
1077261144 11:1621734-1621756 GCCCCCCTTGGAACCCCCACAGG + Exonic
1077261156 11:1621764-1621786 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077261168 11:1621794-1621816 GCCCCCCTTGGAACCCCCACAGG + Exonic
1077261190 11:1621854-1621876 GCCCCCCTTGGAGCCCCCACAGG + Exonic
1077262492 11:1630172-1630194 GCCCCCCTTGGACCCCCCACAGG - Exonic
1077262505 11:1630202-1630224 GCCCCCCTTGGACCCCCCACAGG - Exonic
1077262518 11:1630232-1630254 GCCCCCCTTGGACCCCCCACAGG - Exonic
1077262531 11:1630262-1630284 GCCCCCCTTGGACCCCCCACAGG - Exonic
1077764675 11:5144821-5144843 TCACCCAGTGGATCCCACACCGG - Intergenic
1078087720 11:8244125-8244147 GCTCCCTGTGAAGCCCCTGCAGG - Intronic
1079190904 11:18276071-18276093 TCACCCAGTGGATCCCGCACCGG + Intergenic
1079767691 11:24415936-24415958 TCACCCAGTGGATCCCACACTGG + Intergenic
1080107421 11:28525732-28525754 TCACCCAGTGGATCCCGCACCGG + Intergenic
1080557613 11:33431678-33431700 TCACCCAGTGGATCCCGCACCGG + Intergenic
1080966200 11:37217598-37217620 GCCCCACATGGAGCCCCCACTGG - Intergenic
1081329631 11:41788161-41788183 TCACCCAGTGGATCCCACACTGG + Intergenic
1081422148 11:42881808-42881830 TCACCCAGTGGATCCCGCACTGG - Intergenic
1084149716 11:67282425-67282447 GCTCCCACAGGGGCACCCACGGG + Exonic
1084578099 11:70003850-70003872 GCTACCTGTGGACACCCCACAGG + Intergenic
1084798793 11:71527476-71527498 GCCTCCCTTGGAGCCCCCACAGG - Exonic
1084798805 11:71527506-71527528 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084800126 11:71538210-71538232 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084800138 11:71538240-71538262 GTCCCCCTTGGAGCCCCCACAGG - Exonic
1084800148 11:71538270-71538292 GCCTCCCTTGGAGCCCCCACAGG - Exonic
1084801797 11:71548848-71548870 GCCTCCCTTGGAGCCCCCACAGG - Exonic
1084803898 11:71565784-71565806 GTCCCCCTTGGAGCCCCCACAGG - Exonic
1084803920 11:71565844-71565866 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084803932 11:71565874-71565896 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084803952 11:71565934-71565956 GCCACCTTTGGAGCCCCCACAGG - Exonic
1084803964 11:71565964-71565986 GCCCCCCTTGGAGCCCCCACAGG - Exonic
1084806468 11:71582640-71582662 GCCCCCTTTGGAGCCCCCACAGG + Exonic
1084813570 11:71631531-71631553 TCACCCAGTGGATCCCGCACAGG + Intergenic
1085671013 11:78464905-78464927 TCACCCAGTGGATCCCACACTGG + Intronic
1086034987 11:82404315-82404337 TCACCCAGTGGATCCCGCACCGG - Intergenic
1086210039 11:84308485-84308507 TCACCCAGTGGATCCCGCACGGG + Intronic
1086397668 11:86433458-86433480 TCACCCAGTGGATCCCGCACCGG + Intergenic
1087486307 11:98763343-98763365 TCACCCAGTGGATCCCGCACCGG + Intergenic
1088585090 11:111354536-111354558 GCCCGCAGTGGGGCCCCCGCTGG - Exonic
1089800325 11:121022085-121022107 TCACCCAGTGGATCCCGCACCGG - Intergenic
1090776643 11:129971767-129971789 TCACCCAGTGGATCCCGCACCGG + Intronic
1090782793 11:130022030-130022052 TCACCCAGTGGATCCCGCACCGG - Intergenic
1090820447 11:130337330-130337352 TCACCCAGTGGATCCCCCACAGG + Intergenic
1090924413 11:131236843-131236865 CCTCCCAGTCGAGGCCCCTCAGG - Intergenic
1091233368 11:134002823-134002845 TCACCCAGTGGATCCCGCACCGG + Intergenic
1091402169 12:188052-188074 TCACCCAGTGGATCCCTCACTGG + Intergenic
1091619325 12:2074542-2074564 TCTCCCAGAGGAGACCCCAGAGG - Intronic
1092101623 12:5888830-5888852 CCACCCAGTGGATCCCACACTGG + Intronic
1092253993 12:6916434-6916456 GTGCCCAGTGGAGCCTCTACGGG + Exonic
1092336755 12:7640247-7640269 TCACCCAGTGGATCCCGCACCGG - Intergenic
1092430516 12:8404653-8404675 TCACCCAGTGGATCCCGCACAGG - Intergenic
1092617067 12:10225548-10225570 TCACCCAGTGGATCCCACACCGG + Intergenic
1092732537 12:11547673-11547695 TCACCCAGTGGATCCCCCACCGG - Intergenic
1093266356 12:17008049-17008071 TCACCCAGTGGATCCCGCACTGG - Intergenic
1093770351 12:23010541-23010563 ACTCCCAGTGGAGCCCAGAAAGG - Intergenic
1093793802 12:23286353-23286375 TCACCCAGTGGATCCCGCACCGG - Intergenic
1093970287 12:25369791-25369813 TCACCCAGTGGATCCCGCACAGG - Intergenic
1094405281 12:30110417-30110439 TCACCCAGTGGATCCCGCACTGG + Intergenic
1094718115 12:33033866-33033888 TCACCCAGTGGATCCCGCACCGG + Intergenic
1095304217 12:40621037-40621059 TCACCCAGTGGATCCCTCACCGG - Intergenic
1095883520 12:47164649-47164671 GCCACCAGAGGAGCTCCCACAGG - Intronic
1096514905 12:52150373-52150395 GCTCCTTGCTGAGCCCCCACTGG + Intergenic
1097017842 12:56000080-56000102 TCACCCAGTGGATCCCGCACTGG + Intronic
1097982082 12:65744739-65744761 TCACCCAGTGGATCCCGCACAGG - Intergenic
1098168136 12:67719167-67719189 TCACCCAGTGGATCCCGCACAGG + Intergenic
1098498677 12:71166135-71166157 TCACCCAGTGGATCCCACACCGG + Intronic
1099191476 12:79565379-79565401 TCACCCAGTGGATCCCACACCGG - Intergenic
1099443900 12:82729148-82729170 TCACCCAGTGGATCCCGCACTGG - Intronic
1099467018 12:83000685-83000707 GCTCCCGGTGGAGCCCCAGTGGG + Intronic
1100166540 12:91923843-91923865 TCACCCAGTGGATCCCACACCGG + Intergenic
1100211806 12:92406474-92406496 TCACCCAGTGGATCCCGCACCGG + Intergenic
1101009074 12:100430727-100430749 TCACCCAGTGGATCCCGCACCGG - Intergenic
1101518332 12:105458514-105458536 GCTCCTACTGCAGCCTCCACTGG + Intergenic
1101874925 12:108591693-108591715 GGTCCCAGTGGAGACACCAGAGG - Exonic
1102207546 12:111100865-111100887 GCCCCCAGTAGAGCCCTCCCTGG + Intronic
1103439139 12:120950261-120950283 TCACCCAGTGGATCTCCCACTGG + Intergenic
1103497632 12:121374864-121374886 TCACCCAGTGGATCCCGCACAGG - Intronic
1103501530 12:121406649-121406671 GCTCTCAGTAGAGCCACCATAGG - Intronic
1103783311 12:123414048-123414070 TCACCCAGTGGATCCCGCACCGG + Exonic
1103853368 12:123947386-123947408 TCACCCAGTGGATCCCACACCGG - Intronic
1103985965 12:124767690-124767712 CCTCCCTCTGCAGCCCCCACAGG + Intergenic
1104598481 12:130136374-130136396 GCTCCCAGCTGGGCCCCGACGGG + Intergenic
1104749323 12:131228237-131228259 TCACCCAGTGGATCCCGCACCGG - Intergenic
1105240428 13:18603359-18603381 GCTCCCTGTGGATCACCCATGGG + Intergenic
1105722250 13:23127996-23128018 TCACCCAGTGGATCCCGCACTGG - Intergenic
1108019081 13:46107321-46107343 GCTCCAACAGGAGCCCCTACAGG - Intergenic
1108643896 13:52408010-52408032 TCACCCAGTGGATCCCGCACCGG + Intergenic
1108856461 13:54799659-54799681 TCACCCAGTGGATCCCCCACAGG + Intergenic
1108858879 13:54829435-54829457 TCACCCAGTGGATCCCGCACCGG + Intergenic
1109110935 13:58318470-58318492 TCACCTAGTGGATCCCCCACTGG + Intergenic
1109201948 13:59440335-59440357 TCACCCAGTGGATCCCACACAGG - Intergenic
1109364712 13:61339585-61339607 TCACCCAGTGGATCCCTCACTGG - Intergenic
1110368953 13:74718813-74718835 TCACCCAGTGGATCCCGCACCGG - Intergenic
1110609746 13:77475431-77475453 TCACCCAGTGGATCCCGCACAGG + Intergenic
1110751320 13:79119572-79119594 TCACCCAGTGGATCCTCCACCGG + Intergenic
1110862215 13:80355962-80355984 TCACCCAGTGGATCCCACACCGG - Intergenic
1110940212 13:81340706-81340728 TCACCCAGTGGATCCCGCACCGG + Intergenic
1112533088 13:100223984-100224006 TCACCCAGTGGATCCCGCACCGG + Intronic
1112613181 13:100976121-100976143 TCACCCAGTGGATCCCGCACCGG - Intergenic
1112910164 13:104472598-104472620 TCCCCCAGTGGAGACCTCACAGG + Intergenic
1116114421 14:40629576-40629598 TCACCCAGTGGATCCCGCACGGG + Intergenic
1116390606 14:44385167-44385189 TCACCCAGTGGATCCCCAACCGG - Intergenic
1116653843 14:47626930-47626952 TCACCCAGTGGATCCCGCACCGG - Intronic
1118215292 14:63803199-63803221 TCACCTAGTGGATCCCCCACCGG + Intergenic
1119027851 14:71167918-71167940 TCACCCAGTGGATCCCGCACTGG - Intergenic
1119038926 14:71254722-71254744 TCCCCCAGTGGATCCCACACCGG - Intergenic
1119673364 14:76536685-76536707 TCACCCAGTGGATCCCGCACCGG + Intergenic
1120331056 14:83092806-83092828 TCACCCAGTGGATCCCGCACCGG - Intergenic
1120439027 14:84512843-84512865 TCACCCAGTGGATCCCACACCGG + Intergenic
1121447908 14:93989763-93989785 GAACCCAGTGGAGCCCTCCCAGG - Intergenic
1123490799 15:20780723-20780745 GCTCCCTGTGGATCACCCATGGG - Intergenic
1123547301 15:21349814-21349836 GCTCCCTGTGGATCACCCATGGG - Intergenic
1123795095 15:23763180-23763202 GCTCCCAGAGGACCCCTCCCAGG - Intergenic
1123949052 15:25253128-25253150 TCACCCAGTGGATCCCGCACTGG + Intergenic
1124110538 15:26781604-26781626 TCACCCAGTGGATCCCGCACGGG + Intronic
1125112296 15:36047378-36047400 TCACCCAGTGGATCCCGCACCGG - Intergenic
1125631671 15:41152064-41152086 TCACTCAGTGGATCCCCCACCGG - Intergenic
1125681734 15:41535050-41535072 CCTCAGAGTGGAGACCCCACTGG + Intronic
1125885472 15:43226523-43226545 TCACCCAGTGGATCCCGCACTGG + Intergenic
1128598490 15:68975604-68975626 CCACCCAGTGGACCCCGCACCGG + Intronic
1129158186 15:73732120-73732142 TCACCCAGTGGATCCCCCACCGG + Intergenic
1129197001 15:73974134-73974156 TCACCCAGTGGATCCCACACGGG - Intergenic
1129208711 15:74052925-74052947 TCACCCAGTGGATCCCGCACGGG - Intergenic
1129479079 15:75808646-75808668 GCTCCCAGTGGGGCACACATGGG + Intergenic
1129997222 15:80016903-80016925 TCACCCAGTGGATCCCGCACTGG - Intergenic
1130132946 15:81159047-81159069 TCACCCAGTGGATCCCGCACCGG - Intergenic
1130270758 15:82445757-82445779 GCGCCCAGTGGCGGCCTCACGGG + Intergenic
1130463100 15:84173080-84173102 GCGCCCAGTGGCGGCCTCACGGG + Intronic
1130489574 15:84421708-84421730 GCGCCCAGTGGCGGCCTCACGGG - Intergenic
1130501165 15:84500470-84500492 GCGCCCAGTGGCGGCCTCACGGG - Intergenic
1130847982 15:87765390-87765412 GCTCCCAGTGGTCTCCCCTCTGG + Intergenic
1131012625 15:89031634-89031656 TCACCCAGTGGATCCCGCACCGG + Intergenic
1131175141 15:90204515-90204537 GCTGACTGTGGAGCCCCCAGTGG - Intronic
1131250325 15:90825898-90825920 TCACCCAGTGGATCCCCCACGGG - Intergenic
1131846031 15:96491767-96491789 TCACCCAGTGGATCCCGCACCGG + Intergenic
1202955632 15_KI270727v1_random:77045-77067 GCTCCCTGTGGATCACCCATGGG - Intergenic
1132497525 16:270883-270905 GCTCCCTGGGAACCCCCCACCGG - Intronic
1132511095 16:341669-341691 TCACCCAGTGGATCCCGCACCGG - Intronic
1132735618 16:1384401-1384423 GCTCCCAGCCAGGCCCCCACGGG + Intronic
1133066233 16:3209250-3209272 GGTCCCAGTGTGGCCCCCAAAGG - Intergenic
1133345810 16:5069770-5069792 GTTCCCAGTGGTGCTCCCAAGGG - Intronic
1133362578 16:5186299-5186321 TCACCCAGTGGATCCCGCACCGG + Intergenic
1135181168 16:20275886-20275908 GCTCCTAGTGTAGCCCTTACTGG + Intergenic
1136163376 16:28435794-28435816 TCACCCAGTGGATCCCGCACCGG - Intergenic
1136199587 16:28679193-28679215 TCACCCAGTGGATCCCGCACCGG + Intergenic
1136215933 16:28793366-28793388 TCACCCAGTGGATCCCGCACCGG + Intergenic
1137395380 16:48113391-48113413 GCTCCCGGGGAAGCCCCCTCTGG + Intronic
1137442591 16:48509113-48509135 TCACCCAGTGGATCCCGCACCGG - Intergenic
1138693523 16:58790704-58790726 TCACCCAGTGGATCCCACACCGG + Intergenic
1139676488 16:68527126-68527148 TCACCCAGTGGATCCCGCACCGG - Intergenic
1140790193 16:78384151-78384173 GCCCCCAGTGGAAACCCCAAGGG - Intronic
1142423753 16:89989612-89989634 GCTGCCAGTGGAGCTCCAACAGG - Intergenic
1143283444 17:5771642-5771664 TCACCCAGTGGATCCCGCACCGG - Intergenic
1143554480 17:7651843-7651865 GCCCCCCGCGGAGCCCCCTCGGG + Intronic
1143664197 17:8347053-8347075 TCACCCAGTGGATCCCACACCGG + Intergenic
1143708573 17:8718012-8718034 TCACCCAGTGGATCCCGCACTGG + Intergenic
1144579085 17:16447874-16447896 ACTCCCAGTGGAGGCGGCACCGG - Exonic
1147244184 17:39109589-39109611 GCCCCTAGTGGTGCCCCAACAGG + Intronic
1147956552 17:44138491-44138513 GACCCCAGTGGAGCCCCACCTGG - Intergenic
1147997612 17:44369229-44369251 TCACCCAGTGGATCCCGCACAGG - Intergenic
1148366100 17:47057219-47057241 TCACCCAGTGGATCCCGCACTGG + Intergenic
1148551552 17:48553360-48553382 GCTCCATGTGGGGGCCCCACAGG - Exonic
1148699696 17:49580078-49580100 GCTCCCAGAGGAGCCAGCAGGGG - Exonic
1148848367 17:50541951-50541973 GAGCCCAGGGGCGCCCCCACAGG - Exonic
1149850055 17:60028795-60028817 GCCCCCAGCCTAGCCCCCACGGG + Intergenic
1150778358 17:68099706-68099728 TCATCCAGTGGATCCCCCACCGG - Intergenic
1150792312 17:68208239-68208261 TCACCCAGTGGATCCCGCACTGG - Intergenic
1150804532 17:68308847-68308869 TCACCCAGTGGATCCCGCACCGG + Intronic
1151782593 17:76257582-76257604 TCACCCAGTGGATCCCGCACTGG + Intergenic
1151866510 17:76806540-76806562 TCACCCAGTGGATCCCACACTGG - Intergenic
1151976828 17:77488060-77488082 GCTCCCAGGGGAACCGTCACCGG + Intronic
1152830838 17:82496185-82496207 GCTCCCTGTGCTGCACCCACAGG + Intergenic
1153070465 18:1098657-1098679 TCACCCAGTGGATCCCGCACAGG - Intergenic
1153643976 18:7178601-7178623 TCAACCAGTGGATCCCCCACCGG + Intergenic
1153817006 18:8799229-8799251 GCTCCCATTAGAGCTCCCAGAGG - Intronic
1154057158 18:11023584-11023606 TCACCCAGTGGATCCCGCACCGG + Intronic
1154128682 18:11716881-11716903 TCACCCAGTGGATCCCGCACGGG + Intronic
1154448401 18:14455414-14455436 GCTCCCTGTGGATCACCCATGGG - Intergenic
1155294955 18:24376514-24376536 TCACCCAGTGGATCCCGCACTGG + Intronic
1156038750 18:32794999-32795021 TCACCCAGTGGATCCCGCACCGG - Intergenic
1156079572 18:33316583-33316605 TCACCCAGTGGATCTCCCACTGG - Intronic
1156969753 18:43139945-43139967 TCACCCAGTGGATCCCGCACTGG - Intergenic
1157856828 18:51111778-51111800 TCACCCAGTGGATCCCGCACCGG + Intergenic
1158553959 18:58459800-58459822 TCACCCAGTGGATCCCGCACCGG - Intergenic
1159167876 18:64725574-64725596 TCACCCAGTGGATCCCGCACTGG + Intergenic
1159230884 18:65605679-65605701 TCACCCAGTGGATCCCGCACCGG - Intergenic
1160277566 18:77451752-77451774 GCTCCCAGGGGAGAGCCCAGGGG + Intergenic
1160667921 19:341926-341948 TCCCCCAGGGCAGCCCCCACAGG + Intronic
1160755922 19:757180-757202 TCTCCGAGTGGAGCCCCCGTGGG - Exonic
1161122845 19:2539663-2539685 GGTCCCAGTGGAGCCCTGAATGG + Intronic
1162233028 19:9283387-9283409 TCACCCAGTGGATCCCGCACTGG + Intergenic
1162261980 19:9541261-9541283 TCACCCAGTGGATCCCGCACTGG + Intergenic
1163218929 19:15900109-15900131 TCACCCAGTGGATCCCGCACCGG - Intergenic
1163284428 19:16337775-16337797 GCTGCCAGTGGGGACTCCACTGG + Intergenic
1163284430 19:16337779-16337801 ACCTCCAGTGGAGTCCCCACTGG - Intergenic
1163370297 19:16897601-16897623 GCCCCCAGGGGAGCCCTCCCTGG + Intronic
1163496161 19:17647725-17647747 GCACCCCTTGGAGTCCCCACTGG + Intronic
1163556058 19:17993427-17993449 GCCCCCACTGCAGCCTCCACGGG + Intronic
1163700273 19:18783283-18783305 GCTCCCAGTGCAGCCCAGTCAGG - Intronic
1164143955 19:22498923-22498945 TCACCCAGTGGATCCCGCACCGG + Intronic
1164270514 19:23668462-23668484 TCACCCAGTGGATCCCGCACCGG + Intronic
1164975872 19:32572010-32572032 TCACCCAGTGGATCCCTCACCGG - Intergenic
1165267000 19:34668571-34668593 TCACCCAGTGGATCCCGCACCGG - Intronic
1165415456 19:35691031-35691053 TCACCCAGTGGATCCCGCACTGG + Intergenic
1166036139 19:40170075-40170097 TCACCCAGTGGATCCCGCACTGG + Intergenic
1166351481 19:42200562-42200584 ACTCCCAGTAGAGCCAGCACAGG - Intronic
1166486935 19:43221856-43221878 TCACCCAGTGGATCCCACACTGG + Intronic
1167064751 19:47176545-47176567 GTGCCCACTGGAGTCCCCACAGG + Intronic
1168117678 19:54233367-54233389 GATCTCAGTAGAACCCCCACAGG + Intronic
1168117700 19:54233466-54233488 GATCTCAGTAGAACCCCCACAGG + Intronic
1168117714 19:54233532-54233554 GATCTCAGTAGAACCCCCACAGG + Intronic
1168659966 19:58157732-58157754 TCACCCAGTGGATCCCGCACAGG - Intergenic
925088614 2:1134660-1134682 TCACCCAGTGGATCCCCCACCGG + Intronic
925328753 2:3042454-3042476 GGTCCCAGGGGAGCCGCCTCGGG - Intergenic
925537731 2:4935249-4935271 TCACCCAGTGGATCCCGCACCGG + Intergenic
926616553 2:15002469-15002491 TCACCCAGTGGATCCCGCACCGG + Intergenic
927357154 2:22186724-22186746 TCACCCAGTGGATCCCGCACTGG - Intergenic
927449818 2:23199082-23199104 GATCCCAGGGACGCCCCCACAGG - Intergenic
927777871 2:25915887-25915909 TCACCCAGTGGATCCCCCACGGG - Intergenic
928936979 2:36688686-36688708 TCACCCAGTGGATCCCGCACCGG - Intergenic
929233788 2:39585781-39585803 TCACCCAGTGGATCCCGCACCGG - Intergenic
929493486 2:42418758-42418780 GCTACCAGTGGAGCCTCCCTAGG - Intronic
929890788 2:45917605-45917627 TCACCCAGTGGATCCCGCACTGG + Intronic
932001430 2:67888792-67888814 GCTCCTGATGGGGCCCCCACTGG - Intergenic
932002940 2:67901094-67901116 TCTCCCAGTTGAGCCCTCATTGG - Intergenic
932240007 2:70148731-70148753 TCACCCAGTGGATCCCACACTGG - Intergenic
932440734 2:71733091-71733113 GCTCACAGTGGACCTCCCGCTGG + Intergenic
933506391 2:83181425-83181447 TCACCCAGTGGATCCCGCACCGG - Intergenic
934898571 2:98139428-98139450 TCACCCAGTGGATCCCACACAGG - Intronic
934951821 2:98580725-98580747 TCTCCAAGTGGAGCCTTCACAGG + Intronic
935896766 2:107747275-107747297 TCACCCAGTGGATCCCGCACCGG + Intergenic
937900182 2:127013998-127014020 GCCCACCGTGGAGCCCCCACAGG + Intergenic
938401102 2:130991870-130991892 TCACCCAGTGGATCCCGCACCGG - Intronic
938931134 2:136088003-136088025 TCACCCAGTGGATCCCCCACGGG + Intergenic
939003205 2:136758846-136758868 TCACCCAGTGGATCCCGCACAGG - Intergenic
939229842 2:139410767-139410789 TCACCCAGTGGATCCCGCACCGG - Intergenic
939738693 2:145880838-145880860 TCACCCAGTGGATCCCGCACTGG + Intergenic
940112583 2:150171036-150171058 TCTCCCAGTGGATCCCGAACTGG + Intergenic
940666627 2:156617969-156617991 TCACCCAGTGGATCCCGCACTGG + Intergenic
941240166 2:163026702-163026724 TCACCCAGTGGATCCCGCACCGG - Intergenic
941397851 2:164994689-164994711 TCACCCAGTGGATCCCGCACGGG + Intergenic
941712044 2:168724832-168724854 TCACACAGTGGATCCCCCACCGG + Intronic
942746563 2:179240865-179240887 GAGCCCAGTGGAGCCCACAAGGG + Intronic
943790109 2:191922013-191922035 TCACCCAGTGGATCCCGCACCGG - Intergenic
944857853 2:203785508-203785530 TCACCCAGTGGATCCCGCACCGG + Intergenic
945069708 2:205977610-205977632 TCACCCAGTGGATCCCGCACAGG - Intergenic
945575396 2:211524312-211524334 TCACCCAGTGGATCCCTCACGGG + Intronic
945872753 2:215245675-215245697 TCACCCAGTGGATCCCGCACCGG + Intergenic
946376576 2:219313202-219313224 TCACCCAGTGGATCCCACACCGG - Intergenic
946651460 2:221896292-221896314 ACTCCCACTGAAGCCCTCACAGG + Intergenic
947029697 2:225780022-225780044 GCTCCCTGTGGAGTCCCTAGAGG + Intergenic
947360444 2:229340530-229340552 GCTCCCAGTGCAGCTCTCAGAGG + Intergenic
948141010 2:235671398-235671420 GCTCCCTGGGGCGGCCCCACAGG - Intronic
1170230808 20:14044763-14044785 TCACCCAGTGGATCCCGCACTGG + Intronic
1170806770 20:19639563-19639585 TCACCCAGTGGATCCCGCACTGG + Intronic
1170989970 20:21292305-21292327 TCACCCAGTGGATCCCGCACCGG - Intergenic
1172431774 20:34898736-34898758 TCACCCAGTGGATCCCGCACTGG + Intronic
1175210149 20:57348823-57348845 TCACCCAGTGGATCCCGCACCGG - Intergenic
1175391350 20:58629395-58629417 GAGCCCAGAGCAGCCCCCACTGG + Intergenic
1175511180 20:59527417-59527439 GATCCCACTGGATCACCCACTGG - Intergenic
1175801137 20:61801623-61801645 GCTCCCACTGGAGGCCCTAGGGG + Intronic
1175890246 20:62312789-62312811 GCTGGCCCTGGAGCCCCCACTGG - Intronic
1176332226 21:5559586-5559608 TCACCCAGTGGATCCCCCACAGG + Intergenic
1176395531 21:6261365-6261387 TCACCCAGTGGATCCCCCACAGG - Intergenic
1176441626 21:6727739-6727761 TCACCCAGTGGATCCCCCACAGG + Intergenic
1176447823 21:6835104-6835126 GCTCCCTGTGGATCACCCATGGG + Intergenic
1176465888 21:7054808-7054830 TCACCCAGTGGATCCCCCACAGG + Intronic
1176489449 21:7436586-7436608 TCACCCAGTGGATCCCCCACAGG + Intergenic
1176671116 21:9735962-9735984 TCACCCAGTGGATCCCGCACTGG - Intergenic
1176825993 21:13700130-13700152 GCTCCCTGTGGATCACCCATGGG + Intergenic
1177565753 21:22818793-22818815 TCACCCAGTGGATCCCACACCGG + Intergenic
1177637695 21:23807441-23807463 TCACCCAGTGGATCCCACACTGG - Intergenic
1177763849 21:25434218-25434240 CCTCCCAGAGGGGCACCCACTGG - Intergenic
1177795968 21:25778740-25778762 TCACCCAGTGGATCCCGCACCGG - Intergenic
1178585570 21:33868252-33868274 TCACCCAGTGGATCCCACACCGG + Intronic
1178709672 21:34905003-34905025 ACTAAAAGTGGAGCCCCCACTGG - Intronic
1178983277 21:37283120-37283142 TCACCCAGTGGATCCCACACCGG + Intergenic
1179044566 21:37832754-37832776 GCTCCCAGTGGAGCCCCCACTGG - Intronic
1180043717 21:45293265-45293287 GCTCCCAGGGCCGCCCCCACGGG - Intergenic
1180740964 22:18053304-18053326 TCACCCAGTGGATCCCGCACAGG + Intergenic
1180877783 22:19183017-19183039 GCTCCCTGAGGAGCTCCCAGTGG - Intronic
1181015464 22:20066168-20066190 GGTCGCAATGGAGGCCCCACTGG + Intergenic
1181053786 22:20249929-20249951 GCTCCCATTGGAGCCATCCCAGG + Intronic
1181077596 22:20392345-20392367 TCACCCAGTGGATCCCGCACCGG + Intergenic
1181421679 22:22803596-22803618 TCTCCCAGTGTAGTCCCCACAGG - Intronic
1184089174 22:42283493-42283515 GCTCCCCGAGCAGCCCCCTCGGG + Intronic
1184477305 22:44728710-44728732 GCTCCCAGTGGAACCCAAGCAGG - Intronic
1185276485 22:49952129-49952151 GCTCAGGGTGGAGGCCCCACCGG + Intergenic
949259058 3:2084053-2084075 TCACCCAGTGGATCCCGCACCGG - Intergenic
950256886 3:11513180-11513202 TCACCCAGTGGATCCCGCACCGG + Intronic
950400890 3:12768727-12768749 TCACCCAGTGGATCCCGCACCGG + Intronic
950418628 3:12883275-12883297 TCACCCAGTGGATCCCGCACCGG - Intergenic
950632716 3:14293597-14293619 TCACCCAGTGGATCCCGCACGGG - Intergenic
951951007 3:28200347-28200369 TCACTCAGTGGATCCCCCACCGG + Intergenic
952275328 3:31870541-31870563 TCACCCAGTGGATCCCGCACCGG - Intronic
952355457 3:32579140-32579162 TCACCCAGTGGATCCCCCACTGG - Intergenic
952360551 3:32626060-32626082 TCACCCAGTGGATCCCTCACAGG - Intergenic
952398308 3:32940108-32940130 TCACCCAGTGGATCCCGCACTGG - Intergenic
952593720 3:34988803-34988825 TCACCCAGTGGATCCCCCACTGG - Intergenic
952713391 3:36453728-36453750 TCACCCAGTGGATCCCGCACCGG - Intronic
952730727 3:36634333-36634355 TCACCCAGTGGATCCCGCACCGG - Intergenic
953002968 3:38951577-38951599 TCACCCAGTGGATCCCGCACCGG - Intergenic
953124425 3:40077843-40077865 TCACCCAGTGGATCCCGCACCGG + Intronic
953307525 3:41844103-41844125 TCACCCAGTGGATCCCCCACCGG + Intronic
953522418 3:43656361-43656383 TCACCCAGTGGATCCCGCACAGG + Intronic
953714697 3:45307113-45307135 TCACCCAGTGGATCCCACACTGG - Intergenic
954149096 3:48648366-48648388 GCTGCCTGGGGAGCCCCCAGGGG + Exonic
954226126 3:49182599-49182621 TCACCCAGTGGATCCCGCACTGG + Intronic
954371511 3:50171611-50171633 GCTGCCAGTGGAGCCCCCCCAGG - Intronic
954620216 3:51990998-51991020 TCACCCAGTGGATCCCGCACCGG - Intergenic
954861431 3:53694218-53694240 AGCCCCAGTGGAGCCCCCACGGG - Intronic
955183434 3:56692306-56692328 TCACCCAGTGGATCCCGCACTGG - Intergenic
956632677 3:71331523-71331545 TCACCCAGTGGATCCCGCACCGG - Intronic
957009106 3:74985060-74985082 TCACCCAGTGGATCCCACACCGG + Intergenic
957074156 3:75588180-75588202 TCACCCAGTGGATCCCACACAGG - Intergenic
957556218 3:81767311-81767333 TCACCCAGTGGATCCCGCACTGG + Intergenic
957804824 3:85133795-85133817 TCACCCAGTGGATCCCTCACCGG + Intronic
957921901 3:86758025-86758047 TCACCCAGTGGATCCCGCACTGG - Intergenic
958022719 3:88016114-88016136 TCACCCAGTGGATCCCCCACCGG - Intergenic
958810685 3:98857907-98857929 GCACCCAGTGGATCCCGCACCGG + Intronic
960149720 3:114238224-114238246 TCACCCAGTGGATCCCGCACCGG + Intergenic
960227456 3:115184823-115184845 TCACCCAGTGGATCCCGCACCGG + Intergenic
960685565 3:120290095-120290117 TCACCCAGTGGATCCCACACTGG - Intergenic
960868511 3:122227149-122227171 TCACCCAGTGGATCCCGCACCGG + Intronic
961064369 3:123862030-123862052 GATTCCAATGGAGCCCCCACGGG - Intronic
961233338 3:125340556-125340578 GATCCTACTGGAGCTCCCACTGG - Intronic
961279936 3:125758560-125758582 TCACCCAGTGGATCCCGCACAGG + Intergenic
961461925 3:127056205-127056227 TCACCCAGTGGATCCCGCACAGG + Intergenic
961464975 3:127076219-127076241 TCACCCAGTGGATCCCACACCGG + Intergenic
961476931 3:127152858-127152880 GCTCTCGATGGAGCCCACACAGG - Intergenic
961746642 3:129068242-129068264 TCACCCAGTGGATCCCGCACGGG + Intergenic
961874459 3:130011019-130011041 TCACCCAGTGGATCCCACACAGG - Intergenic
962590994 3:136889935-136889957 TCACCCAGTGGATCCCGCACAGG + Intronic
963440488 3:145333803-145333825 TCACCCAGTGGATCCCGCACCGG - Intergenic
963673432 3:148280500-148280522 TCACCCAGTGGATCCCGCACTGG + Intergenic
964014462 3:151928582-151928604 TCACCCAGTGGATCCCGCACCGG - Intergenic
964444081 3:156741003-156741025 TCACCCAGTGGATCCCGCACAGG - Intergenic
965044058 3:163552257-163552279 TCACCCAGTGGATCCCGCACAGG + Intergenic
965078075 3:164003394-164003416 TCACCCAGTGGATCCCGCACTGG - Intergenic
965109340 3:164401823-164401845 TCACCCAGTGGATCCCGCACCGG + Intergenic
965298206 3:166976259-166976281 TCACCCAGTGGATCCCGCACCGG - Intergenic
966096706 3:176213350-176213372 TCACCCAGTGGATCCCGCACTGG + Intergenic
966372351 3:179262988-179263010 TCACCCAGTGGATCCCGCACCGG + Intronic
966548898 3:181182953-181182975 TCACCCAGTGGATCCCTCACAGG + Intergenic
966905976 3:184525996-184526018 GCTCCCAGTAGAGCCTGCGCAGG + Intronic
967448581 3:189596550-189596572 TCGCCCAGTGGATCTCCCACCGG - Intergenic
968181514 3:196598972-196598994 TCGCCCAGTGGATCCCGCACTGG + Intergenic
969017775 4:4115780-4115802 TCACCCAGTGGATCCCACACAGG - Intergenic
969369694 4:6723786-6723808 ACTCCCAGTGAAGTCCCCAGTGG - Intergenic
969440819 4:7215555-7215577 TCACCCAGTGGATCCCGCACCGG - Intronic
969488736 4:7486679-7486701 GCTCCCCCTGGAGCCTCCAAAGG + Intronic
969673733 4:8603512-8603534 GCTCCTTGTGGTGCCCCCTCCGG - Intronic
969736217 4:8992832-8992854 TCACCCAGTGGATCCCACACAGG + Intergenic
970391294 4:15615340-15615362 TCACCCAGTGGATCCCACACCGG - Intronic
970649244 4:18159204-18159226 TCACCCAGTGGATCCCGCACCGG + Intergenic
970673085 4:18418271-18418293 TCACCCAGTGGATCCCGCACCGG + Intergenic
970803611 4:20004441-20004463 TCACCCAGTGGATCCCGCACCGG - Intergenic
971280453 4:25239176-25239198 TCACCCAGTGGATCCCACACTGG + Intronic
971281603 4:25246558-25246580 TCACCCAGTGGATCCCACACTGG + Intronic
971318661 4:25587641-25587663 GCACCCTGTGGAGCCCCTCCAGG - Intergenic
971377031 4:26063904-26063926 TCACCCAGTGGATCCCGCACTGG + Intergenic
971639901 4:29117780-29117802 TCACCCAGTGGATCCCGCACTGG - Intergenic
971852181 4:31996843-31996865 TCACTCAGTGGATCCCCCACCGG - Intergenic
972388616 4:38591738-38591760 GCTCCCAGAGGAGCTTCCTCGGG - Intergenic
973037180 4:45420577-45420599 TCACCCAGTGGATCCCGCACAGG - Intergenic
973146403 4:46831474-46831496 TCACCCAGTGGATCCCGCACTGG - Intronic
973817664 4:54632962-54632984 TCACCCAGTGGATCCCGCACTGG - Intergenic
974147498 4:57965851-57965873 TCACCCAGTGGATCCCGCACTGG - Intergenic
974792689 4:66712352-66712374 CCACCCAGTGGATCCCGCACTGG + Intergenic
974804467 4:66860595-66860617 TCACCCAGTGGATCCCGCACCGG - Intergenic
974827838 4:67152306-67152328 TCACCCAGTGGATCCCGCACAGG - Intergenic
974992794 4:69115174-69115196 TCACCCAGTGGATCCCACACTGG + Intronic
975055478 4:69924317-69924339 TCACCCAGTGGATCCCACACTGG - Intergenic
975439869 4:74398999-74399021 TCACCCAGTGGATCCCCCACCGG + Intergenic
975755945 4:77571089-77571111 TCACCCAGTGGATCCCACACCGG - Intronic
976736226 4:88313137-88313159 TCACCCAGTGGATCCCGCACTGG + Intergenic
977470620 4:97438016-97438038 TCACCCAGTGGATCCCGCACCGG + Intronic
978207117 4:106092333-106092355 TCACCCAGTGGATCCCACACTGG + Intronic
978241806 4:106525278-106525300 TCACCCAGTGGATCCCTCACTGG + Intergenic
978463544 4:108984325-108984347 TCACCCAGTGGATCCCGCACAGG + Intronic
978999500 4:115200128-115200150 TCACCCAGTGGATCCCGCACTGG + Intergenic
979825626 4:125229516-125229538 TCACCCAGTGGATCCCGCACTGG + Intergenic
979857434 4:125651697-125651719 TCACCCAGTGGATCCCACACCGG + Intergenic
979899626 4:126201225-126201247 TCACCCAGTGGATCCCGCACCGG + Intergenic
980043299 4:127964171-127964193 TCGCCCAGTGGATCCCGCACCGG + Intronic
980739338 4:136929421-136929443 TCACCCAGTGGATCCCACACCGG - Intergenic
980815636 4:137942497-137942519 TCACCCAGTGGATCCCGCACCGG - Intergenic
981176511 4:141689792-141689814 TCACCCAGTGGATCCCACACTGG + Intronic
982814501 4:159868966-159868988 TCACCCAGTGGATCCCGCACCGG + Intergenic
982874450 4:160627714-160627736 ACTCCAAGTGGATACCCCACTGG + Intergenic
982921349 4:161277653-161277675 TCACCCAGTGGATCCCGCACCGG - Intergenic
983656821 4:170091657-170091679 TCCCCCAGTGGAGCCGGCACTGG - Intronic
983752925 4:171298707-171298729 TCACCCAGTGGATCCCGCACCGG - Intergenic
984265744 4:177496018-177496040 TCCCCCAGTGGATCCCGCACAGG - Intergenic
984662328 4:182386976-182386998 TCACCCAGTGGATCCCGCACAGG - Intronic
984776028 4:183482622-183482644 TCACCCAGTGGATCCCCCACCGG + Intergenic
985203330 4:187506057-187506079 TCACCCAGTGGATCCCGCACAGG - Intergenic
985403789 4:189616580-189616602 TCACCCAGTGGATCCCGCACAGG + Intergenic
985634168 5:1027855-1027877 GCTCCCAGAGGTGCCTGCACCGG + Intronic
985666705 5:1184769-1184791 TCTCCCAGAGGAGCCTCCCCAGG - Intergenic
986121222 5:4837960-4837982 TCACCCAGTGGATCCCACACCGG - Intergenic
986626254 5:9725754-9725776 TCACCCAGTGGATCCCGCACTGG - Intergenic
986949141 5:13060517-13060539 GGCCCCAGTAGAGTCCCCACCGG - Intergenic
987146171 5:14993738-14993760 TCACCCAGTGGATCCCACACCGG + Intergenic
987347363 5:16990915-16990937 TCACCCAGTGGATCCCGCACTGG + Intergenic
987570233 5:19647643-19647665 GCTCCCTGTGGAGCTTACACAGG + Intronic
987896372 5:23951723-23951745 TCACCCAGTGGATCCCTCACCGG - Exonic
988073586 5:26324887-26324909 TCACCCAGTGGATCCCGCACCGG - Intergenic
988291687 5:29296426-29296448 TCACCCATTGGATCCCCCACTGG + Intergenic
988369344 5:30346178-30346200 TCACCCAGTGGATCCCGCACAGG - Intergenic
988684658 5:33515322-33515344 TCACCCAGTGGATCCCACACAGG + Intergenic
989003282 5:36783007-36783029 TCACCCAGTGGATCCCACACCGG - Intergenic
990490144 5:56295751-56295773 TCACCCAGTGGATCCCTCACAGG - Intergenic
990875850 5:60484649-60484671 GCTCCCATTGAAGCTCCCATTGG - Intronic
990880299 5:60530724-60530746 TCACCCAGTGGATCCCGCACGGG - Intergenic
990907570 5:60820227-60820249 GCTCCCATTGGAGCTCCAAATGG + Intronic
991330158 5:65485412-65485434 TCACCCAGTGGATCCCGCACCGG + Intergenic
991657869 5:68921293-68921315 GAGCCCAGTGGATCCCACACCGG - Intergenic
992169289 5:74086200-74086222 GCTCCTAGTGGAGGCCCTACTGG - Intergenic
993031953 5:82715116-82715138 TCACCCAGTGGATCCCGCACTGG - Intergenic
993529108 5:89003558-89003580 TCACCCAGTGGATCCCGCACCGG + Intergenic
993822120 5:92631758-92631780 TCACCCAGTGGATCCCACACTGG - Intergenic
994254715 5:97579928-97579950 TCACCCAGTGGATCCCGCACCGG + Intergenic
994509761 5:100688801-100688823 TCACCCAGTGGATCCCGCACGGG + Intergenic
994620430 5:102155367-102155389 TCACCCAGTGGATCTCCCACAGG - Intergenic
994647684 5:102491325-102491347 TCACCCAGTGGATCCCCTACCGG + Intronic
994841472 5:104929428-104929450 TCACCCAGTGGATCCCGCACCGG - Intergenic
994928883 5:106154684-106154706 TCACCCAGTGGATCCCGCACAGG - Intergenic
995032386 5:107494622-107494644 TCACCCAGTGGATCCCCCAACGG - Intronic
995326341 5:110893961-110893983 TCACCCAGTGGATCCCGCACGGG + Intergenic
995975908 5:118034252-118034274 TCACCCAGTGGATCCCACACTGG - Intergenic
996115044 5:119608978-119609000 ACCCCCAGTGGAGTCCCCAGGGG + Intronic
996435778 5:123430981-123431003 TCACCCAGTGGATCCCGCACCGG - Intergenic
996530479 5:124522049-124522071 TCACCCAGTGGATCCCGCACGGG - Intergenic
997302176 5:132813999-132814021 GCGGCCAGTGGAGCCGCCAGGGG + Exonic
997760642 5:136444641-136444663 TCACCCAGTGGATCCCGCACCGG - Intergenic
997977308 5:138448057-138448079 GATCCCAGTGAGGCCCCCAGGGG + Intergenic
998446713 5:142204481-142204503 GCTCCCAGTAGTGCCCCAGCTGG - Intergenic
999406263 5:151309619-151309641 TCACCCAGTGGATCCCACACCGG - Intergenic
999855203 5:155586686-155586708 TCACCCAGTGGATCCCGCACGGG + Intergenic
1000547691 5:162622271-162622293 TCACCCAGTGGATCCCGCACTGG - Intergenic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1002004556 5:176221959-176221981 TCACCCAGTGGATCCCGCACCGG + Intergenic
1002221819 5:177688661-177688683 TCACCCAGTGGATCCCGCACTGG - Intergenic
1002789299 6:426134-426156 TCACCCAGTGGATCCCGCACCGG + Intergenic
1002906947 6:1456904-1456926 TCACCCAGTGGATCCCCTACCGG + Intergenic
1003060805 6:2860567-2860589 TCACCCAGTGGACCCCACACTGG - Intergenic
1003214775 6:4099338-4099360 GCTGCTAGAGGAGCCCTCACTGG + Intronic
1003578243 6:7316757-7316779 TCACCCAGTGGATCCCACACCGG + Intronic
1003589674 6:7426164-7426186 TCACCCAGTGGATCCCGCACTGG - Intergenic
1003717782 6:8666395-8666417 TCACCCAGTGGATCCCACACCGG - Intergenic
1003901672 6:10660316-10660338 TCACCCAGTGGATCCCGCACTGG - Intergenic
1003956756 6:11171490-11171512 TCACCCAGTGGATCCCGCACGGG - Intergenic
1004045288 6:12017865-12017887 TCACCCAGTGGATCCCGCACTGG + Intronic
1004665457 6:17745241-17745263 TCACCCAGTGGATCCCGCACCGG + Intergenic
1004689015 6:17976128-17976150 TCACCCAGTGGATCCCGCACCGG + Intronic
1004861309 6:19806944-19806966 TCACCCAGTGGATCCCGCACTGG + Intergenic
1004865973 6:19854367-19854389 TCACCCAGTGGATCCCGCACCGG + Intergenic
1005059370 6:21761588-21761610 TCACCCAGTGGATCCCGCACCGG - Intergenic
1005707371 6:28469287-28469309 TCACCCAGTGGATCCCGCACTGG + Intergenic
1005758814 6:28949727-28949749 TCACCCAGTGGATCCCGCACCGG + Intergenic
1006005854 6:31000892-31000914 TCACCCAGTGGATCCCGCACCGG - Intergenic
1006066398 6:31465327-31465349 GCTTTGAGTGGAGCCTCCACAGG - Intergenic
1006128031 6:31852442-31852464 TCACCCAGTGGATCCCGCACTGG - Intergenic
1006352722 6:33532817-33532839 TCACCCAGTGGATCCCGCACTGG - Intergenic
1006696088 6:35931697-35931719 TCACCCAGTGGATCCCGCACTGG - Intergenic
1006920471 6:37624459-37624481 ACTTCCACTGGAGCCCCCAGGGG + Intergenic
1008230749 6:48983365-48983387 TCACCCAGTGGATCCCACACAGG + Intergenic
1008230969 6:48984330-48984352 TCACCCAGTGGATCCCGCACAGG - Intergenic
1008254147 6:49275870-49275892 TCACCCAGTGGATCCCACACCGG - Intergenic
1008270107 6:49481760-49481782 TCACCCAGTGGAGCCCACACTGG + Intronic
1008270416 6:49483355-49483377 TCACCCAGTGGATCCCACACTGG + Intronic
1008567904 6:52786911-52786933 TCACCCAGTGGATCCCACACCGG - Intergenic
1009685419 6:66949641-66949663 TCACCCAGTGGATCCCGCACGGG - Intergenic
1010235562 6:73572465-73572487 TCACCCAGTGGATCCCGCACTGG + Intergenic
1012037818 6:94165651-94165673 GCTCCCTGTGGATCCCCCAGTGG - Intergenic
1012189262 6:96260879-96260901 TCACCCAGTGGATCCCACACAGG + Intergenic
1012733481 6:102910653-102910675 TCACCCAGTGGATCCCACACTGG + Intergenic
1012760422 6:103294337-103294359 TCACCCAGTGGATCCCGCACCGG + Intergenic
1013694730 6:112689300-112689322 TCACCCAGTGGATCCCGCACCGG + Intergenic
1014383942 6:120778925-120778947 GCTCCAAGGGGAGCCCTGACAGG + Intergenic
1014499201 6:122165061-122165083 TCACCCAGTGGATCCCACACCGG + Intergenic
1014739083 6:125126281-125126303 TCACCCAGTGGATCCCGCACTGG - Intronic
1015572169 6:134633477-134633499 TCACCCAGTGGATCCCGCACCGG + Intergenic
1016092750 6:139999517-139999539 TCACCCAGTGGATCCCGCACTGG + Intergenic
1016858719 6:148697126-148697148 TCACCCAGTAGATCCCCCACCGG + Intergenic
1016933599 6:149432098-149432120 GCTCCCGGTGGAACTGCCACTGG - Intergenic
1017581135 6:155866688-155866710 TCACCCAGTGGATCCCGCACCGG + Intergenic
1018064156 6:160114450-160114472 TCACCCAGTGGATCCCACACCGG + Intergenic
1018624567 6:165765220-165765242 TCACCCAGTGGATCCCGCACGGG + Intronic
1019634219 7:2066984-2067006 GCTACAAGTGTGGCCCCCACAGG - Intronic
1019944184 7:4313870-4313892 TCACCCAGTGGATCCCGCACAGG + Intergenic
1019965673 7:4496863-4496885 TCACCCAGTGGATCCCGCACAGG + Intergenic
1020163993 7:5793920-5793942 TCACCCAGTGGATCCCGCACTGG - Intergenic
1020570316 7:9851747-9851769 GGTGCCAGTGGAGACCACACAGG - Intergenic
1020784353 7:12556095-12556117 TCACCCAGTGGATCCCACACTGG + Intergenic
1021520634 7:21536522-21536544 TCACCCAGTGGATCCCACACCGG + Intergenic
1021567815 7:22032300-22032322 TCACCCAGTGGATCCCGCACTGG + Intergenic
1022971594 7:35522793-35522815 GCTCCCAGATGAGCGCCCCCGGG + Intergenic
1023368788 7:39491225-39491247 GAGCACAGTGGAGCTCCCACAGG + Intronic
1024269158 7:47628904-47628926 TCACCCAGTGGATCCCGCACCGG - Intergenic
1024465985 7:49711684-49711706 TCACCCAGTGGATCCCACACTGG - Intergenic
1024834126 7:53495448-53495470 TCACCCAGTGGATCCCGCACTGG - Intergenic
1025961999 7:66231294-66231316 TCGCCCAGTGGATCCCGCACCGG + Intronic
1026516647 7:71078414-71078436 TCACCCAGTGGATCCCACACCGG - Intergenic
1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG + Intergenic
1026903770 7:74051249-74051271 CCTCCCAGTGGAGGCCCCGCAGG + Intronic
1027495194 7:78879148-78879170 CCACCCACTGGAGCCCCCATTGG + Intronic
1027561754 7:79739728-79739750 TCACCCAGTGGATCCCGCACCGG - Intergenic
1027674557 7:81142165-81142187 TCACCCAGTGGATCCCGCACCGG - Intergenic
1027698204 7:81437023-81437045 TCACCCAGTGGATCCCGCACTGG + Intergenic
1027779028 7:82499997-82500019 TCACCCAGTGGATCCCACACTGG - Intergenic
1027868177 7:83673738-83673760 TCACCCAGTGGATCCCGCACTGG - Intergenic
1028303222 7:89228702-89228724 TCACCCAGTGGATCCCACACCGG + Intronic
1028778402 7:94705920-94705942 TCACCCAGTGGATCCCGCACCGG - Intergenic
1028852438 7:95552399-95552421 TCACCCAGTGGATCCCACACCGG + Intergenic
1029076215 7:97936309-97936331 TCACCCAGTGGATCCCGCACAGG - Intergenic
1029338029 7:99919125-99919147 GCTCCCAGTGGCGGCCGCACAGG + Exonic
1030215652 7:107042295-107042317 TCACCCAGTGGATCCCGCACTGG + Intergenic
1030733568 7:113017773-113017795 TCACCCAGTGGATCCCGCACCGG - Intergenic
1030780492 7:113593745-113593767 TCACCCAGTGGATCCCGCACCGG - Intergenic
1030980615 7:116181916-116181938 TCACCCAGTGGATCCCGCACTGG + Intergenic
1031110042 7:117596536-117596558 TCACCCAGTGGATCCCGCACTGG - Intronic
1031378871 7:121060363-121060385 TCACCCAGTGGATCCCGCACCGG - Intronic
1031409288 7:121422154-121422176 TCACCCAGTGGATCCCGCACTGG - Intergenic
1033866568 7:145697346-145697368 TCACCCAGTGGATCCCGCACCGG + Intergenic
1034097993 7:148426835-148426857 TCACCCAGTGGATCCCGCACTGG - Intergenic
1036180970 8:6585201-6585223 TCTCCCCGTGGAGTACCCACTGG - Intronic
1036440950 8:8781325-8781347 TCACCCAGTGGATCCCGCACCGG + Intergenic
1036601425 8:10264544-10264566 GCTCCCAGTGGAGCCCAGGTGGG + Intronic
1036901650 8:12673832-12673854 TCACCCAGTGGATCCCACACAGG - Intergenic
1037065104 8:14567263-14567285 TCACCCAGTGGATCCCGCACTGG - Intronic
1037425532 8:18750977-18750999 TCACCCAGTGGATCCCGCACCGG + Intronic
1037957469 8:23070714-23070736 TCACCCAGTGGATCCCGCACCGG + Intergenic
1038639484 8:29311889-29311911 TCACCCAGTGGATCCCGCACAGG - Intergenic
1039568791 8:38570089-38570111 GCTCCCCAGGCAGCCCCCACTGG - Intergenic
1039912415 8:41835615-41835637 GCTGCCAGCAGAGCCCACACTGG + Intronic
1041142939 8:54842469-54842491 GCTCCTGGTGGAAACCCCACAGG - Intergenic
1041914599 8:63126501-63126523 TCACCCAGTGGATCCCGCACCGG - Intergenic
1042666459 8:71212011-71212033 GCTGACAGTGTAGCCACCACAGG - Intronic
1043073264 8:75665399-75665421 TCACCCAGTGGATCCCGCACCGG + Intergenic
1043129859 8:76447549-76447571 TCACCCAGTGGATCCCGCACGGG + Intergenic
1043352414 8:79377137-79377159 TCACCCAGTGGATCCCGCACCGG + Intergenic
1044633396 8:94300267-94300289 TCACCCAGTGGATCCCACACCGG + Intergenic
1046149269 8:110202510-110202532 TCACCCAGTGGATCCCGCACCGG + Intergenic
1046621284 8:116531471-116531493 TCACCCAGTGGATCCCGCACGGG - Intergenic
1047124837 8:121948503-121948525 TCACCCAGTGGATCCCGCACTGG - Intergenic
1047631624 8:126714571-126714593 TCACCCAGTGGACCCCGCACTGG + Intergenic
1048676888 8:136793740-136793762 TCACCCAGTGGATCCCGCACCGG + Intergenic
1048967531 8:139625308-139625330 GCTCCCAGGACAGCACCCACAGG + Intronic
1049087558 8:140490450-140490472 TCACCCAGTGGATCCCACACTGG + Intergenic
1049095270 8:140544865-140544887 CCTCCCAGGGAAGTCCCCACTGG - Intronic
1049157769 8:141077067-141077089 TCACCCAGTGGATCCCGCACCGG - Intergenic
1049500390 8:142959903-142959925 TCACCCAGTGGATCCCGCACCGG - Intergenic
1049599299 8:143499676-143499698 GCTCACAGTAGAGCCAGCACCGG + Intronic
1049850934 8:144829705-144829727 GCCCCCTGTGGAGCCCACAAGGG - Intronic
1051380891 9:16457495-16457517 GCTTCCAGTGGTGCTCCCAGAGG + Intronic
1051439932 9:17073029-17073051 TCACCCAGTGGATCCCGCACGGG - Intergenic
1051463877 9:17354362-17354384 TCACCCAGTGGATCCCGCACCGG - Intronic
1052056602 9:23914393-23914415 TCACCCAGTGGATCCCGCACTGG + Intergenic
1052979627 9:34438372-34438394 TCACCCAGTGGATCCCGCACCGG - Intronic
1052985273 9:34482698-34482720 TCACCTAGTGGATCCCCCACCGG + Intronic
1055248508 9:74275874-74275896 TCACCCAGTGGATCCCGCACGGG + Intergenic
1055461385 9:76523662-76523684 TCACCCAGTGGATCCCACACAGG + Intergenic
1055651449 9:78410421-78410443 TCACCCAGTGGATCCCGCACTGG - Intergenic
1056305839 9:85289470-85289492 TCACCCAGTGGATCCCCCGCCGG - Intergenic
1056558028 9:87706215-87706237 GCTGTCCGTGGAGACCCCACGGG + Exonic
1056758430 9:89397429-89397451 GGTCCCAGTCCAGCCCCCATGGG + Intronic
1057543784 9:96001653-96001675 TCACCCAGTGGATCCCGCACCGG + Intronic
1057785487 9:98084289-98084311 GCACCCAGTGATACCCCCACAGG - Intronic
1059791080 9:117642699-117642721 TCACCCAGTGGATCCCGCACCGG + Intergenic
1059810691 9:117852411-117852433 TCACCCAGTGGATCCCACACCGG - Intergenic
1062146133 9:134990966-134990988 TCACCCAGTGGATCCCGCACTGG + Intergenic
1062465329 9:136678275-136678297 GCTCCAAGGGCAGCCCCCAGTGG - Intronic
1203429869 Un_GL000195v1:80746-80768 TCACCCAGTGGATCCCCCACAGG - Intergenic
1203521367 Un_GL000213v1:49427-49449 GCTCCCTGTGGATCACCCATGGG - Intergenic
1185446077 X:258592-258614 GCACCCAGCTGGGCCCCCACAGG + Intergenic
1186152520 X:6690442-6690464 TCACCCAGTGGATCCCGCACCGG + Intergenic
1186323177 X:8452425-8452447 TCACCCAGTGGATCCCGCACCGG + Intergenic
1187139129 X:16575878-16575900 TCACCCAGTGGATCCCGCACTGG - Intergenic
1187157688 X:16736434-16736456 GCTGCCAGTGCTGGCCCCACTGG + Intronic
1188166888 X:26873635-26873657 TCACCCAGTGGATCCCGCACTGG + Intergenic
1188189601 X:27157429-27157451 TCACCCAGTGGATCCCGCACTGG - Intergenic
1188242752 X:27809717-27809739 TCACCCAGTGGATCCCGCACTGG - Intronic
1189979202 X:46492154-46492176 GCAATCAGTGGAGACCCCACGGG + Intronic
1192186828 X:68952540-68952562 TCACCCAGTGGATCCCGCACTGG - Intergenic
1192924459 X:75741054-75741076 GCACCCAGTGCAACCCTCACAGG + Intergenic
1193040134 X:76996593-76996615 TCACCCAGTGGATCCCGCACTGG + Intergenic
1193382077 X:80827548-80827570 CCTCCCAGAGGGGCACCCACCGG + Intergenic
1194384458 X:93236163-93236185 TCACCCAGTGGATCCCGCACTGG - Intergenic
1195257962 X:103107283-103107305 TCACCCAGTGGATCCCACACTGG + Intergenic
1195259298 X:103117045-103117067 TCACCCAGTGGATCCCGCACAGG + Intergenic
1195896292 X:109749269-109749291 TCACCCAGTGGATCCCTCACTGG + Intergenic
1195909533 X:109875829-109875851 TCACCCAGTGGATCCCGCACAGG + Intergenic
1196705834 X:118716871-118716893 TCACCCAGTGGATCCCGCACTGG + Intergenic
1197533708 X:127662948-127662970 TCACCCAGTGGATCCCGCACAGG + Intergenic
1197555477 X:127947349-127947371 GCTCACAGTGTAGTCACCACTGG - Intergenic
1197978828 X:132194511-132194533 TCACCTAGTGGATCCCCCACAGG - Intergenic
1198694530 X:139321229-139321251 TCACCCAGTGGATCCCCCACCGG - Intergenic
1198972515 X:142298180-142298202 TCACCCAGTGGATCCCGCACAGG + Intergenic
1199356170 X:146866817-146866839 TCACCCAGTGGATCCCGCACAGG + Intergenic
1200512688 Y:4099542-4099564 TCACCCAGTGGATCCCGCACCGG - Intergenic
1200888744 Y:8299042-8299064 TCACCCAGTGGATCCCGCACCGG - Intergenic
1201468407 Y:14309669-14309691 TCACCCAGTGGATCCCACACTGG - Intergenic
1201469171 Y:14314876-14314898 TCACCCAGTGGATCCCGCACTGG - Intergenic
1201715882 Y:17043539-17043561 TCACCCAGTGGATCCCTCACCGG - Intergenic
1202137017 Y:21676598-21676620 TCACCCAGTGGATCCCGCACCGG + Intergenic
1202372095 Y:24205532-24205554 GCGCCCAGTGGCGGCCTCACGGG - Intergenic
1202498690 Y:25464584-25464606 GCGCCCAGTGGCGGCCTCACGGG + Intergenic