ID: 1179046213

View in Genome Browser
Species Human (GRCh38)
Location 21:37847694-37847716
Sequence TACAGGACATCGATAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179046213 Original CRISPR TACAGGACATCGATAGAAAG AGG Intronic
910451488 1:87351175-87351197 TACAGAATATCAATAGAAAAGGG + Intergenic
912148460 1:106824092-106824114 TACATTACATCAATAGAATGAGG - Intergenic
912507699 1:110167392-110167414 TACAGGACATGATAAGAAAGTGG + Intronic
1065242228 10:23718207-23718229 TGCATGTCATCAATAGAAAGTGG + Intronic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1073932847 10:108596414-108596436 TATAGAACATCCATAAAAAGAGG + Intergenic
1074402489 10:113153422-113153444 TCCAAGACATCGACAGGAAGGGG - Intronic
1076037527 10:127213027-127213049 TAAAGGGGATGGATAGAAAGGGG - Intronic
1078807831 11:14724297-14724319 TACAGAACATTAATAGGAAGGGG + Intronic
1080706135 11:34695791-34695813 TACAGGAAATGGATAAATAGTGG - Intergenic
1085913492 11:80856898-80856920 GACTGGAAATCTATAGAAAGAGG - Intergenic
1088753247 11:112863863-112863885 TACAGGGAATCCAAAGAAAGAGG + Intergenic
1089855918 11:121544764-121544786 TACAGGATCTCCATGGAAAGAGG - Intronic
1092424347 12:8362278-8362300 AACAGGAGACAGATAGAAAGTGG + Intergenic
1094912607 12:35304183-35304205 TTCAGGCCATCGTTAGAAACGGG + Intergenic
1094922736 12:35468249-35468271 TTCAGGCCATCGTTAGAAACGGG + Intergenic
1095009810 12:36877507-36877529 TTCAGGCCATCGTTAGAAACGGG + Intergenic
1099213599 12:79825106-79825128 TACAGGTCATTAAGAGAAAGTGG + Intronic
1100894050 12:99159401-99159423 AAGAAGACATCAATAGAAAGTGG - Intronic
1101593731 12:106145073-106145095 AAGAGAACATAGATAGAAAGTGG - Intergenic
1104804963 12:131583325-131583347 TACAGCACAATGTTAGAAAGAGG + Intergenic
1112241988 13:97691322-97691344 TACTGGAGATAGATAGACAGAGG + Intergenic
1115888228 14:37997904-37997926 TCCAAGACATGGATACAAAGAGG + Intronic
1116505329 14:45670768-45670790 TAAAGGAAATCGATATAAATGGG + Intergenic
1118615303 14:67571029-67571051 TACTGGACACCTATAGAAGGAGG - Intronic
1122412156 14:101531115-101531137 TCCAGGGCATGGACAGAAAGTGG - Intergenic
1129091179 15:73152504-73152526 TAAAGGACATTGATACAATGAGG - Intronic
1137479768 16:48842539-48842561 TGCAGGAAATATATAGAAAGAGG + Intergenic
1140871334 16:79109303-79109325 TACAGTAGCTCGATAGAAACTGG - Intronic
1143183955 17:4999618-4999640 TAGAGGACAGAGAGAGAAAGAGG - Intronic
1146761016 17:35478709-35478731 TACAGGAAATAAATGGAAAGTGG + Intronic
1150601597 17:66655534-66655556 TAAAGGGCATGGAGAGAAAGTGG - Intronic
1162321894 19:9975500-9975522 TATTGGACATCGATATAGAGGGG + Intronic
1163811827 19:19437601-19437623 TAGAGGTCATCAGTAGAAAGGGG - Intronic
1167140175 19:47644921-47644943 CACAGGACAGAGAGAGAAAGAGG - Intronic
926440793 2:12886483-12886505 CAAAGGACATGGATACAAAGAGG - Intergenic
926780284 2:16464680-16464702 TCCAGGACATCAAAAGATAGAGG + Intergenic
928556211 2:32427781-32427803 TACAAGACATGCAAAGAAAGAGG - Intronic
929321053 2:40543924-40543946 TACATGGCACAGATAGAAAGTGG - Intronic
931940272 2:67244453-67244475 TAAAAGACATAGATAGCAAGAGG - Intergenic
938889413 2:135688309-135688331 TACAGTACATCCAGAAAAAGAGG + Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
948881350 2:240858916-240858938 TACAGGGCATCAAGTGAAAGTGG - Intergenic
1170779216 20:19408822-19408844 TAAAGGACATCCATATAATGTGG + Intronic
1175164602 20:57034355-57034377 TACAGGACATGAATAGCAGGAGG - Intergenic
1175558916 20:59900393-59900415 AACAGCACATGGATAGAAAAGGG - Intronic
1179046213 21:37847694-37847716 TACAGGACATCGATAGAAAGAGG + Intronic
1183842235 22:40508561-40508583 TACATTATATCCATAGAAAGTGG - Intronic
950891155 3:16405651-16405673 TAGAGGACACGGATAGAAGGAGG - Intronic
951609550 3:24477064-24477086 TCCAGGACATACATATAAAGGGG + Intronic
952032662 3:29162969-29162991 TGCAGGACATGGACACAAAGGGG + Intergenic
953812549 3:46126397-46126419 TACATGACATTAATAGAATGAGG + Intergenic
958763749 3:98340274-98340296 TACAACACATAGAAAGAAAGTGG + Intergenic
961019892 3:123496731-123496753 TACAGTAAATCTATAGAAATGGG - Intronic
964199576 3:154103440-154103462 TACAGGAGATCCAAAGACAGAGG - Intergenic
966925881 3:184644306-184644328 TACAGGAGATTGACAAAAAGAGG - Intronic
967089544 3:186123863-186123885 TACAGAACATGGATGTAAAGAGG + Intronic
969741155 4:9027832-9027854 AACAGGAGACGGATAGAAAGTGG - Intergenic
973859693 4:55050701-55050723 TACAGGATATCTATATTAAGTGG + Intergenic
981985047 4:150844127-150844149 TACAGGACATGGATATTAATCGG - Exonic
982461597 4:155676238-155676260 TACAGGGCTTAAATAGAAAGAGG + Intronic
984050156 4:174855823-174855845 TCCAGGACAGGGATAGAAAGGGG - Intronic
984128075 4:175837053-175837075 TAAAGGACATCAAAAGAGAGAGG + Intronic
987786715 5:22509777-22509799 GACTGGCCATAGATAGAAAGAGG + Intronic
1001458020 5:171882033-171882055 AACAGGAAATCCATAGAAATAGG - Intronic
1003466615 6:6385893-6385915 TGAAGGACACAGATAGAAAGTGG - Intergenic
1005354185 6:24966981-24967003 TCCAGGATATTGAAAGAAAGTGG - Intronic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1008334073 6:50279043-50279065 GACAGGACATTGACAAAAAGAGG + Intergenic
1010462340 6:76127815-76127837 GTCAGGACATAGAAAGAAAGGGG - Intergenic
1015698936 6:136013361-136013383 TACAGGATTTGGAAAGAAAGAGG - Intronic
1016320901 6:142844960-142844982 AACAGGACCAGGATAGAAAGGGG - Intronic
1024034514 7:45495850-45495872 TTCAGGACATGGTGAGAAAGGGG - Intergenic
1029838843 7:103341208-103341230 TACAGGAAATTGCTTGAAAGGGG - Intronic
1032624610 7:133577342-133577364 TACAGGACATTGACACACAGTGG - Intronic
1032989098 7:137371221-137371243 TACAGGACATTAATATCAAGGGG + Intergenic
1036138193 8:6181327-6181349 AACAGGACACAGAAAGAAAGCGG + Intergenic
1037345341 8:17893516-17893538 TTCAGGACATCAAGAGACAGAGG - Intronic
1037345406 8:17894996-17895018 TTCAGGACATCAAGAGACAGAGG - Intronic
1042478548 8:69278032-69278054 TACAGGACATCTATACAAATGGG - Intergenic
1042960941 8:74303176-74303198 TACGGGACATGCAGAGAAAGAGG - Intronic
1043820590 8:84858799-84858821 AACAAGACAAGGATAGAAAGCGG - Intronic
1051186875 9:14469660-14469682 TACAAGACAGTGGTAGAAAGAGG - Intergenic
1056165616 9:83937950-83937972 TACAGGACAGGGATAGACACAGG + Intergenic
1059507667 9:114814399-114814421 AAAAGGACAGAGATAGAAAGAGG + Intergenic
1059598234 9:115746466-115746488 TACATGTCATAGATTGAAAGGGG + Intergenic
1060035444 9:120251696-120251718 TTCAGGACATGGATAGAGTGAGG - Intergenic
1187977330 X:24716218-24716240 TACATGACATCGATGGGAGGGGG + Intronic
1189098109 X:38161129-38161151 TACAGGACATGGAGAGACTGAGG + Intronic
1190145450 X:47887573-47887595 AACAGGGCATCAAGAGAAAGAGG + Intronic
1191566254 X:62536568-62536590 TTCAGGCCATCGTTGGAAAGGGG + Intergenic
1192859108 X:75047207-75047229 TACAAGACATGGAAAGAAACAGG - Intergenic
1198654903 X:138903083-138903105 TCTAGGACATCAATAAAAAGTGG + Intronic
1200706652 Y:6448642-6448664 TGCAGCACCTCGATAGAAATGGG + Intergenic
1201027460 Y:9716066-9716088 TGCAGCACCTCGATAGAAATGGG - Intergenic
1201515475 Y:14815301-14815323 TTCAAGACAGTGATAGAAAGAGG + Intronic