ID: 1179046447

View in Genome Browser
Species Human (GRCh38)
Location 21:37849305-37849327
Sequence GTGGTTCAGCGTCTCTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179046440_1179046447 15 Left 1179046440 21:37849267-37849289 CCTGTTGGTCTCATGACTCTCAA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1179046447 21:37849305-37849327 GTGGTTCAGCGTCTCTCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179046447 Original CRISPR GTGGTTCAGCGTCTCTCTGG GGG Intronic
900189712 1:1348237-1348259 CTGGGTCAGCGTCTCCCTGCTGG - Intronic
902269302 1:15291698-15291720 GTAGTTCAGGGACTCTCAGGAGG + Intronic
903177538 1:21589983-21590005 GGGGGTGAGTGTCTCTCTGGAGG + Intergenic
903369206 1:22824475-22824497 TGGGTCCAGGGTCTCTCTGGCGG + Intronic
904345980 1:29870136-29870158 GTGGCTCAGCGTCCCTCATGAGG + Intergenic
905174018 1:36125177-36125199 GGGGTTCCGCGTCGCTCTGCCGG + Exonic
905339193 1:37266653-37266675 CTGGTTCTGAGTCTCTCTGAAGG - Intergenic
907575485 1:55522146-55522168 CTGGTTCAGGGTCTCTCATGAGG - Intergenic
910392510 1:86759491-86759513 CTGGTTCAGCGTTTCTCATGAGG + Intergenic
910725971 1:90339356-90339378 CTGGTTCAGAGTCTCTCGTGAGG - Intergenic
911058340 1:93726716-93726738 GTGGTTCATCGTATCACTGATGG + Intronic
919396911 1:197061819-197061841 GTGGTTCAATGTCTCTCTGATGG - Exonic
919946632 1:202323880-202323902 CCGGTTCAGCTGCTCTCTGGAGG + Intergenic
920168886 1:204057287-204057309 CTGGTTCAGGGTCTCTCATGAGG + Intergenic
923533755 1:234832104-234832126 GGGGATGGGCGTCTCTCTGGAGG - Intergenic
1064462107 10:15545015-15545037 CTGGTTCAGTGTCTCTCCTGAGG - Intronic
1068939586 10:62667799-62667821 GTAGCTCAGGTTCTCTCTGGTGG + Intronic
1069099547 10:64302204-64302226 GTGGTTCAGTGGATCTCAGGTGG + Intergenic
1071023251 10:81083164-81083186 GTGGTTTTGTGTCTCTCTGGTGG - Intergenic
1071129069 10:82370451-82370473 GTGGTTCAGGGTTTATATGGGGG + Intronic
1079354116 11:19715704-19715726 GTTCTTCAGCTTCTCTCTGAGGG + Intronic
1080553527 11:33394969-33394991 GTGTTTCAGCCTCTCCCTGCAGG - Intergenic
1083490632 11:63012768-63012790 GCGGGTCTGCGTCTCGCTGGTGG + Intronic
1085037253 11:73308035-73308057 GTGTCTCAGCGACTCCCTGGGGG + Intergenic
1085183164 11:74553231-74553253 TTGGGTCATTGTCTCTCTGGAGG + Intronic
1088979212 11:114846577-114846599 CTGACTCAGCGTCTCTGTGGTGG - Intergenic
1089131396 11:116215088-116215110 GGAGCTCAGCCTCTCTCTGGTGG - Intergenic
1090249592 11:125242120-125242142 GTGGTTCCCCGTCTATGTGGGGG + Intronic
1092229395 12:6768257-6768279 GCTGGTCAGCTTCTCTCTGGGGG - Intronic
1102786191 12:115606893-115606915 CTGGTTCAGCGGGTCTCGGGTGG - Intergenic
1103021015 12:117534306-117534328 GTAGCTCTGAGTCTCTCTGGAGG + Intronic
1103926684 12:124427247-124427269 GAGGGTCAGCGCCTCGCTGGTGG + Intronic
1107962846 13:45574479-45574501 CTGGTTCTGTGTCTCTCTGCAGG + Intronic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112957093 13:105073350-105073372 GTGGGTCAGAGATTCTCTGGGGG + Intergenic
1118089203 14:62454011-62454033 ATGGTTCAGACTCTCTCTGGCGG - Intergenic
1118954634 14:70469047-70469069 GTGGTTTCGCTTCTCTTTGGTGG - Intergenic
1121425654 14:93849760-93849782 GTGGATCAGAGTCTCTCATGCGG + Intergenic
1122939451 14:104974723-104974745 GTGCTTCCCCGTCTGTCTGGCGG - Intronic
1125376148 15:39031721-39031743 GTGGCTCATCCTCTCTCCGGAGG + Intergenic
1130315927 15:82796497-82796519 GTGGCTCAGAGTCTCTCATGAGG - Intronic
1131076652 15:89499424-89499446 GTGAGTCAGCGTCTCTCTCCTGG - Intergenic
1131960999 15:97790091-97790113 GTGGCTCAGCTTCTCACTGTGGG - Intergenic
1135121321 16:19768932-19768954 GTGGTTCAGAGTCTCCCATGAGG + Intronic
1138425340 16:56928434-56928456 GGGCTTCAGCATCTCTTTGGAGG - Intergenic
1138813654 16:60179208-60179230 GTGGCTCAGGGTCTCTCATGAGG - Intergenic
1140132194 16:72173081-72173103 CTGGTTCAGCACCTCACTGGAGG + Intronic
1141510254 16:84507239-84507261 GTGGCTCAGCCTTTCTGTGGAGG - Intronic
1142211221 16:88809563-88809585 GGGGTTCAGCGCCTCTCCTGGGG - Exonic
1143226735 17:5311166-5311188 GTGAGTCAGCGTCTCTGAGGGGG - Intronic
1146907712 17:36628624-36628646 CTGAGTCAGTGTCTCTCTGGGGG - Intergenic
1151787109 17:76280377-76280399 GTGGTTCAGCTGCTCCGTGGTGG + Exonic
1152072684 17:78141772-78141794 CTGGGTCAGCCTCTCCCTGGCGG + Exonic
1152389860 17:79997132-79997154 GTGGTTCTGCGTCTAGCTAGTGG + Intronic
1152733519 17:81985377-81985399 GGGGGTCAGCCTCTCCCTGGAGG + Intronic
1154172744 18:12063083-12063105 GGGGATCAGGGTCTCCCTGGGGG + Intergenic
1159768291 18:72517369-72517391 GTTGTTCAGGGTCTCACTGAGGG - Intergenic
1160905001 19:1447789-1447811 GAGGTTCAGTGTCACTCCGGAGG + Intronic
1161378865 19:3954066-3954088 GGGGCTCAGGGTCTGTCTGGTGG - Intergenic
1165771576 19:38383586-38383608 CTGGGTCAGCCTCTGTCTGGTGG + Exonic
1167431668 19:49458753-49458775 ATGGTTCCGGGTCTCTGTGGAGG + Intronic
926747483 2:16170923-16170945 ATGGTTCAGCTTCACTCTGAGGG + Intergenic
931365174 2:61613083-61613105 CTGGTTCAGGGTCTCTCAGGAGG + Intergenic
931450178 2:62362041-62362063 CTGTTTCAGAGTCTCTCAGGAGG - Intergenic
931455729 2:62408453-62408475 CTGGTTCAGGGTCTCTCATGAGG - Intergenic
937988625 2:127650049-127650071 GAGTTTCAGCATCTCTCTTGGGG - Exonic
943843607 2:192611963-192611985 GTGTCTCAGGGTCTCCCTGGAGG - Intergenic
949000684 2:241611119-241611141 GTGGGTCAGTGCCTCGCTGGAGG + Intronic
1170571500 20:17635347-17635369 GTGGCCCAGCGTCCCTGTGGTGG - Intronic
1174338464 20:49881334-49881356 GTGCTTCAGCGCCTCCCTGGGGG + Intronic
1177376754 21:20280245-20280267 GTGGTTCAGGGATTCCCTGGAGG + Intergenic
1179046447 21:37849305-37849327 GTGGTTCAGCGTCTCTCTGGGGG + Intronic
1179102582 21:38367364-38367386 GTGGCTCAGGGTCTCTCATGAGG + Intergenic
1182485177 22:30635132-30635154 GTGATTCAGCTTCCCTCTGAGGG + Intergenic
1183551747 22:38491727-38491749 ATGGCTCAGCTTCTCTCTGGTGG - Intronic
1184889026 22:47368299-47368321 GTGGTTCACCCTCACTCGGGAGG + Intergenic
1185326182 22:50226921-50226943 GTGGCTGAGCGTGTCCCTGGAGG - Intronic
950280500 3:11703942-11703964 GTGGATCAGTGTTTCTTTGGAGG - Intronic
953583233 3:44175944-44175966 CTGGTTCAGAGTCTCTCATGAGG - Intergenic
955658404 3:61269716-61269738 GTGGCTCAGCGTCTCTCATGAGG - Intergenic
956051130 3:65249641-65249663 CTGGTTCAGAATCTCTGTGGTGG + Intergenic
958954314 3:100450958-100450980 GGAGATCAGCGACTCTCTGGAGG + Intronic
960364439 3:116753739-116753761 GTGGTTCAGCACTTCACTGGGGG + Intronic
961081346 3:124031898-124031920 TTGGTTCCACCTCTCTCTGGGGG - Intergenic
962438512 3:135389555-135389577 GTGGATCAGACTTTCTCTGGAGG - Intergenic
962830597 3:139135896-139135918 ATTGTTCAGTGTCTCTTTGGTGG + Intronic
963055781 3:141185326-141185348 GTGGCTCAATTTCTCTCTGGGGG - Intergenic
967593957 3:191309120-191309142 GTGTTTCTGCATCTCTCTTGTGG + Intronic
968134001 3:196208687-196208709 GTGGCTCAGTTTCTCCCTGGGGG - Intronic
968669145 4:1839318-1839340 CTGCTTCAACGTCTGTCTGGAGG - Intronic
972374718 4:38459612-38459634 GGGCCTCAGTGTCTCTCTGGAGG - Intergenic
984420396 4:179513943-179513965 GTGGTGCAGTGGATCTCTGGAGG - Intergenic
985109570 4:186534964-186534986 GTGCTTCAGCAGCTCTCAGGGGG + Intronic
985492636 5:188343-188365 GTGGGTCAGCATCTCCCTGCAGG - Exonic
986690788 5:10312042-10312064 CTGGCTCAGGGTCTCTCAGGAGG - Intergenic
988217782 5:28298869-28298891 GTGATTCAGTTGCTCTCTGGTGG - Intergenic
988508591 5:31846080-31846102 ATGGTTCAGCCCCTCTGTGGTGG + Intronic
994017901 5:94989822-94989844 GTTGTTTAGGGTCTCTATGGAGG - Intronic
998034784 5:138905656-138905678 GTGCTTCAGAGTCTTTCTAGAGG - Intronic
999699084 5:154211648-154211670 GTGGTACAGTGTCTCTCATGAGG + Intronic
1001096012 5:168776071-168776093 CTGGTTCAGCCCCTCCCTGGTGG + Intronic
1001585185 5:172829306-172829328 GTGGCTCAGAGTCTCTCACGAGG + Intergenic
1001782115 5:174378551-174378573 GTGGCTCAGGGTCTCTCATGAGG + Intergenic
1006941913 6:37757583-37757605 GTGATTCAGCGTCTCACTAAAGG + Intergenic
1007358344 6:41336636-41336658 CTGTTTCAGCATCTCTCAGGAGG - Intronic
1008957410 6:57230880-57230902 GTGCTTCAGCTTCTCAGTGGTGG - Intergenic
1010082929 6:71885738-71885760 GTAGTTCAGAGTATCTCTGTAGG - Intergenic
1012433261 6:99188285-99188307 GTGGTTCAGCGTTTGGTTGGAGG - Intergenic
1013626112 6:111938682-111938704 CTGGTTCAGGATCTCTCAGGAGG + Intergenic
1019542228 7:1556529-1556551 ATGGTACAGGGTTTCTCTGGGGG + Intronic
1021328881 7:19309848-19309870 ATGCTTCAGCATCTCTCTGATGG + Intergenic
1021487765 7:21185799-21185821 AGGGTTCAGAGTCTCTCTGATGG + Intergenic
1023561191 7:41474788-41474810 CTGGTTCAGTGTCTCTCCTGAGG - Intergenic
1025036501 7:55596099-55596121 CTGGCTCAGGGTCTCTCTTGAGG - Intergenic
1028169936 7:87584043-87584065 GTGGTGCAGCATCTTTCTGCAGG + Intronic
1034001933 7:147423987-147424009 GTGCTTCAGCATCTCCCTGGGGG + Intronic
1035597802 8:872888-872910 GTGGATCTGCGTATCTGTGGGGG - Intergenic
1037220228 8:16510036-16510058 GTGGTTCAGTGTCTCTCACAAGG - Intronic
1038229293 8:25685552-25685574 GGGGTTCACTGTCTCCCTGGAGG + Intergenic
1042554330 8:70021546-70021568 GAGGTTCAGTGGCTCTCTTGAGG - Intergenic
1044280089 8:90344278-90344300 GTGGGTTTGCATCTCTCTGGAGG + Intergenic
1045237469 8:100366074-100366096 GTGTTTCAGTCTCTCTCTGGTGG + Intronic
1047133735 8:122052031-122052053 GGGGTTCAGGGACCCTCTGGAGG - Intergenic
1048898321 8:139015012-139015034 CTGGTTCAGAGTCTCTCGTGAGG + Intergenic
1049070656 8:140353085-140353107 GTGGTCCAGTGTCTTTCTGGAGG - Intronic
1051140114 9:13969671-13969693 GTGGCTCAGGGTCTCTCATGAGG + Intergenic
1052874999 9:33552502-33552524 GTGGCTCAGCCTGTCTCTGCTGG + Intronic
1053501020 9:38591824-38591846 GTGGCTCAGCCTGTCTCTGCTGG - Intergenic
1055680861 9:78713803-78713825 GTAGTGCAGTGTCTCTCTGCTGG - Intergenic
1056055567 9:82819487-82819509 GTGGTTCAGCGCTACACTGGGGG + Intergenic
1057054843 9:91952274-91952296 CTGGCTCAGGGTCTCTCAGGAGG + Intergenic
1057223172 9:93268646-93268668 GTGGTTCATCATCTGTCCGGTGG + Exonic
1058119159 9:101119436-101119458 ATGGTCCAGTGTCCCTCTGGAGG + Intronic
1058880686 9:109283506-109283528 GTGGTTCTGCGTCCCTGTGGTGG - Intronic
1059791732 9:117647917-117647939 ATGGCTCAGCATCTCTCAGGAGG + Intergenic
1060864191 9:126981874-126981896 CTGGCTCAGGGTCTCTCAGGAGG + Intronic
1186516236 X:10167750-10167772 CTGGCTCAGCGTCTCTCAGGAGG - Intronic
1189952542 X:46247295-46247317 CTGGCTCAGAGTCTCTCAGGAGG - Intergenic
1190931459 X:54952171-54952193 GTGGTTCGGGGTTTCTCTCGGGG - Intronic
1193978442 X:88152029-88152051 GTGGTTCAGAATCTCTCATGAGG + Intergenic
1196844027 X:119884311-119884333 GTGGTTAAGAGTTTCTTTGGTGG + Intergenic
1198333654 X:135645326-135645348 GTGGTTCAGTGTCTCATTTGTGG + Intergenic
1200695898 Y:6359294-6359316 GTGGTTCAGGGGCACTCAGGAGG + Intergenic
1200884709 Y:8255659-8255681 GTGGTTCAGGGGCACTCAGGAGG - Intergenic
1200940937 Y:8781003-8781025 GTGGTTCAGGGACACTCAGGAGG - Intergenic
1201023606 Y:9683515-9683537 GTGGTTCAGGGGCACTCAGGAGG + Intergenic
1201039379 Y:9815412-9815434 GTGGTTCAGGGGCACTCAGGAGG - Intergenic
1201947415 Y:19526812-19526834 TTGGCTCAGCTTGTCTCTGGAGG - Intergenic
1202107670 Y:21387071-21387093 GTGGTTCAGGGGCACTCAGGAGG - Intergenic
1202119019 Y:21505733-21505755 GTGGTTCAGGGGCGCTCAGGAGG + Intergenic
1202121471 Y:21529273-21529295 GTGGTTCAGGGGCGCTCAGGAGG + Intronic
1202157532 Y:21900109-21900131 GTGGTTCAGGGGCGCTCAGGAGG - Intronic
1202159981 Y:21923650-21923672 GTGGTTCAGGGGCACTCAGGAGG - Intergenic
1202196127 Y:22299582-22299604 GTGGTTCAGGGTCACTCAGGAGG - Intergenic
1202231947 Y:22667580-22667602 GTGGTTCAGGGGCACTCAGGAGG + Intergenic
1202311209 Y:23528578-23528600 GTGGTTCAGGGGCACTCAGGAGG - Intergenic
1202559593 Y:26142016-26142038 GTGGTTCAGGGGCACTCAGGAGG + Intergenic