ID: 1179047682

View in Genome Browser
Species Human (GRCh38)
Location 21:37861069-37861091
Sequence AAACCACTTAGAAGGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179047682 Original CRISPR AAACCACTTAGAAGGCTGAC AGG Intronic
901304267 1:8221315-8221337 CAGCCACTTAGGAGGCTGACAGG - Intergenic
902308319 1:15560835-15560857 AGACTAGTTAGAAGGCTGCCAGG - Intronic
902443810 1:16448701-16448723 CAAACACTCAGAAGGCAGACGGG - Intronic
903469559 1:23576426-23576448 AAAGCACTTAGAATGGTGCCTGG - Intergenic
904241228 1:29146917-29146939 CAACTACTTGGGAGGCTGACAGG + Intergenic
905745060 1:40408751-40408773 GAGCAACTTAGAAGGCTGAGTGG + Intronic
905858450 1:41330392-41330414 AAAGCACTTAGCATCCTGACTGG - Intergenic
906160520 1:43645693-43645715 AAACCAGTTAGAAGTCTAATTGG - Intergenic
906177485 1:43787367-43787389 AAACCACTTTGACAGCTAACGGG - Intronic
907798085 1:57737532-57737554 AAACCACTTAGGAAAATGACGGG + Intronic
907853808 1:58281843-58281865 AAAGCACTTAGAACAATGACTGG + Intronic
909140697 1:71861277-71861299 AAAACACTTAGAAGAGTGACTGG + Intronic
910241265 1:85088571-85088593 AAAGCACTTAGAAGAATGCCTGG - Intronic
910674430 1:89802395-89802417 AAAGCATTTAGAGGGCTGATGGG - Intronic
910755111 1:90681309-90681331 CAGCCACTCAGAAGGCTGAGGGG + Intergenic
910863265 1:91764187-91764209 AAACCACTTAAAGTGCTGAGAGG + Intronic
910863821 1:91769178-91769200 AAAGCACTTAGAACAGTGACTGG + Intronic
911648317 1:100359195-100359217 AAACCACTTAGAACACTGCCTGG - Intronic
911991831 1:104707818-104707840 AAGCCACTCGGGAGGCTGACAGG + Intergenic
912023044 1:105130819-105130841 AAAACACTAAAAAGACTGACTGG + Intergenic
915313142 1:155014531-155014553 AAAGTACTCAGAAGGGTGACTGG + Intronic
915385260 1:155485432-155485454 CAACTACTCAGAAGGCTGAGCGG - Intronic
916592038 1:166201218-166201240 AAAGCACTTGGCAGGGTGACTGG + Intergenic
916902189 1:169239222-169239244 AAATCATTTAGAATGCTGATTGG + Intronic
917137001 1:171797563-171797585 AAACCACTTAGAAGAATGCCTGG - Exonic
917719306 1:177771048-177771070 AAAGCACTTAGAACACTGTCTGG - Intergenic
918864539 1:189877955-189877977 TACACACTTAGAAGGGTGACTGG - Intergenic
919484166 1:198126464-198126486 TAACCAATTAGAAAGCTTACTGG - Intergenic
921222625 1:212984044-212984066 AAACCTCTTAGAATGATGCCTGG + Intronic
921863478 1:220064036-220064058 AAAGCACTTAGAATGGTGCCTGG - Intronic
922581228 1:226699587-226699609 AAACCACTTAGAACAATGCCTGG + Intronic
923291399 1:232549353-232549375 AAACCACTGGGAAGAGTGACAGG - Intronic
923615191 1:235531440-235531462 AAGCCACTGGGAAGGCTCACAGG - Intergenic
924263954 1:242261892-242261914 CAACCACTTAGAAAACTGACTGG + Intronic
924472804 1:244357972-244357994 AAGCTACTCAGAAGGCTGAAGGG + Intronic
1063143781 10:3277833-3277855 AAAGCACTTAGAAAACTGTCAGG + Intergenic
1064114242 10:12564346-12564368 AAACCACATAGAAGACAGAACGG - Intronic
1064669199 10:17691761-17691783 ACAGCACTTAGAACACTGACTGG - Intronic
1066720840 10:38336573-38336595 CAACCACTTAGAAAACTGATTGG - Intergenic
1068515961 10:58025852-58025874 AAAGCACTTAGAATGATGCCTGG + Intergenic
1070698406 10:78580282-78580304 GAACCACTTAGAGGGGTGGCTGG - Intergenic
1071858089 10:89645582-89645604 AAACTACTTAGAGGCCTGAGGGG + Intergenic
1072303501 10:94085097-94085119 AAACTACTTAGAACAGTGACTGG - Intronic
1073156511 10:101351348-101351370 AATCCACTTAGAAATCTCACAGG + Intergenic
1074047953 10:109856416-109856438 AAATCACTTAGCATGCTGTCAGG - Intergenic
1074794280 10:116925330-116925352 AACCCAGTTAGAAGGCAGTCAGG - Intronic
1075201196 10:120405662-120405684 AAAGCACTTAGAAGAGTGCCTGG - Intergenic
1075476957 10:122744432-122744454 AAAGCACTTAGCAGGCAGCCTGG + Intergenic
1075670005 10:124257844-124257866 AAACCTCTTAGCAGCCTAACGGG + Intergenic
1078193500 11:9113881-9113903 TAGCTACTTAGGAGGCTGACAGG + Intronic
1079088755 11:17465809-17465831 AAACCAATGAGAAGGCTCTCAGG - Intronic
1079422623 11:20308218-20308240 AAAGCACTTAGAATGCTGCCTGG - Intergenic
1080878368 11:36297027-36297049 AAAACAGTTAGAATGCTGCCTGG - Intronic
1080883406 11:36343663-36343685 AAACCACTATAAAGGCTGATGGG - Intronic
1080937454 11:36879565-36879587 AAGCTACTCAGAAGGCTGAATGG - Intergenic
1082818746 11:57529142-57529164 AAAGCACTTAGCAGGATGCCTGG - Intronic
1083938311 11:65881895-65881917 CAGCTACTTAGAAGGCTGAGGGG - Intronic
1084307321 11:68295314-68295336 CAACTACTCAGAAGGCTGAGTGG + Intergenic
1085147998 11:74220663-74220685 GAAGCACTTAGATTGCTGACTGG + Intronic
1085723275 11:78932059-78932081 AAAGCACTTAATAGGCTGCCTGG + Intronic
1086359187 11:86039277-86039299 CAGCTACTTGGAAGGCTGACAGG + Intronic
1086974127 11:93113634-93113656 AAACCACTTAGCAGTGTGCCTGG - Intergenic
1089318583 11:117609419-117609441 CAACTACTTAGAAGGGTGAGAGG - Intronic
1091035501 11:132229174-132229196 AAAACACTTAGAAGAGTGCCTGG - Intronic
1092014955 12:5150902-5150924 AAAGCACTTAGAAGACAGCCTGG - Intergenic
1094821241 12:34227479-34227501 AAACCTCTTAGATGGCTCCCAGG + Intergenic
1097276988 12:57820452-57820474 AATCCCCTCAGAAGGCTGTCTGG - Exonic
1097306891 12:58079220-58079242 AAACTAGTTAAATGGCTGACTGG - Intergenic
1097924204 12:65109853-65109875 AAAGCACTTAGAAGAGTGCCCGG + Intronic
1098386964 12:69929901-69929923 AAAGCACTTAGAAGGGTGCATGG + Intronic
1098910272 12:76201981-76202003 AAACCACATGGAAAGGTGACTGG + Intergenic
1098929190 12:76390759-76390781 AAAACACTTAGAACACTGTCTGG - Intronic
1099066318 12:77984518-77984540 AGATCACTTAGAAGGGTGTCTGG - Intronic
1099473781 12:83083117-83083139 AAAGCATTTAGAATGCTGCCTGG + Intronic
1099870327 12:88340226-88340248 AAATCACTTAGTAGCCTGCCTGG + Intergenic
1100202125 12:92310335-92310357 AAATTATTTAGAAGGCTGAATGG - Intergenic
1101115654 12:101529107-101529129 AGATCAGTTAGGAGGCTGACTGG - Intergenic
1101237294 12:102802593-102802615 AAATCACTGAAAAGGCTGAAAGG - Intergenic
1101288847 12:103345348-103345370 AAAGCACTTAGAAGAGTGCCTGG + Intronic
1102835392 12:116053540-116053562 AAAACACTTAGAATACTGCCTGG - Intronic
1103078986 12:118008437-118008459 CAGCCACTCAGGAGGCTGACGGG + Intergenic
1104217063 12:126744202-126744224 AAAGCACTTAGAAGAGTTACTGG - Intergenic
1105553503 13:21422078-21422100 AAAACACTTAGAAGGATGCCTGG + Intronic
1106298571 13:28440795-28440817 AAAGCACTTAGAATGATGCCTGG + Intronic
1107438261 13:40401290-40401312 AAAGCACTTAGAAGAGTGCCTGG - Intergenic
1107857000 13:44626101-44626123 AGGGCATTTAGAAGGCTGACTGG + Intergenic
1108079685 13:46722195-46722217 ATACCACATAGAAGGCTGCATGG - Intronic
1109392051 13:61706346-61706368 AATCCACTCAGAAGACTGAGAGG - Intergenic
1109552943 13:63929603-63929625 CAACCACTCAGGAGGCTGAGAGG - Intergenic
1110225965 13:73119930-73119952 AAAGCACTTAGGATGGTGACTGG + Intergenic
1111438290 13:88241124-88241146 ATACCACTTTGAAGACTTACAGG + Intergenic
1112418519 13:99226464-99226486 AAACCAGTTAGAAGGCTGTTAGG - Intronic
1112621377 13:101057393-101057415 AATGCACTTAGAAGAGTGACTGG + Intronic
1114611000 14:24040449-24040471 TAGCCACTTGGGAGGCTGACGGG - Intergenic
1115910471 14:38251066-38251088 CAACTACTTGGAAGGCTGAGAGG + Intergenic
1116541128 14:46103153-46103175 AAAGCACTTAGAAGAGTGCCTGG - Intergenic
1116813871 14:49566010-49566032 ATACTACTCAGAAGGCTGAAGGG + Intergenic
1118357103 14:65023407-65023429 AAACTCCTTATAAGGCTGAGAGG + Intronic
1120287858 14:82527596-82527618 AAACCAGTTAGAAAGATGAATGG - Intergenic
1120493900 14:85210124-85210146 GAACAACTTAGAAGGCAGAGTGG + Intergenic
1121166713 14:91808929-91808951 AAACAACTTACAAGGCTGCATGG + Intronic
1121390775 14:93572156-93572178 AAAACGCTTAGTAGGGTGACCGG - Intronic
1124994047 15:34705588-34705610 AAAGCACTTAGCAGGTTGCCTGG + Intergenic
1126232932 15:46348523-46348545 AAAGCAATTAGAGGGTTGACTGG + Intergenic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1130021590 15:80235922-80235944 AAAGCACTTAGAAGAGTGTCGGG + Intergenic
1130046096 15:80446049-80446071 AAAGCACTTAGAATGATGCCTGG - Intronic
1130831853 15:87609068-87609090 AAACCTCTTAGAATGATGCCAGG - Intergenic
1132363647 15:101239547-101239569 AAACAGCTTAGAAGCCTGCCTGG + Intronic
1132496365 16:265294-265316 AGACCACTATGAAGGCTGCCTGG - Exonic
1133388322 16:5388686-5388708 CAGCTACTCAGAAGGCTGACAGG - Intergenic
1133791153 16:9010272-9010294 AAACCACTTAAAAGGAAGACAGG + Intergenic
1133920457 16:10148073-10148095 AAACCATCAAGGAGGCTGACAGG - Intronic
1133978250 16:10615728-10615750 AAAGCATTTAGAAGAGTGACTGG + Intergenic
1134100531 16:11448611-11448633 TAACTACTTAGTAGGCTGAGCGG + Intronic
1134104194 16:11473965-11473987 TAGCTACTTGGAAGGCTGACAGG - Intronic
1134691886 16:16196484-16196506 AAAGCACTTAAAAGGGTGCCGGG - Intronic
1135091094 16:19518362-19518384 AAAGCACTTAGAAGAGTGCCTGG - Intronic
1137243531 16:46681719-46681741 AAACCCATTAGCAGTCTGACAGG - Intronic
1137264637 16:46858824-46858846 AAAATACTTAGAACTCTGACTGG - Intergenic
1139406084 16:66718839-66718861 AAACCACCTAGAAGAGTGACTGG + Intergenic
1139454593 16:67063006-67063028 AACCCTGTTAGAAGGCTAACAGG - Intronic
1140213249 16:72987330-72987352 ACACCACTTTGAGAGCTGACAGG + Intronic
1140534880 16:75700629-75700651 CAGCTACTTAGGAGGCTGACCGG - Intronic
1141213480 16:82002471-82002493 AAAGCACTTAGCATGCTGCCTGG - Intronic
1143526107 17:7473660-7473682 CAGCTACTCAGAAGGCTGACAGG - Intronic
1145947055 17:28784360-28784382 CAACGACTTAGGAGGCTGAGAGG + Intronic
1146382693 17:32342595-32342617 AAAACACTTAGAAGTCATACAGG + Intronic
1147235525 17:39054703-39054725 CACCTACTTAGGAGGCTGACGGG + Intergenic
1148008250 17:44452605-44452627 AAACCATTTAGAAAGTTGTCTGG - Intronic
1148013488 17:44504316-44504338 AAAACACATAGAAGGGTGGCAGG + Intergenic
1148843514 17:50514769-50514791 CAACCACTTGGGAGGCTGAGGGG - Intronic
1149261044 17:54879709-54879731 AAACCACTTAGAACGTGTACAGG + Intergenic
1149446636 17:56718205-56718227 AAAGTACTTAGAAGGCTGCCTGG + Intergenic
1150024646 17:61660413-61660435 AAACCACTTAGAATAGTGCCTGG - Intergenic
1151392713 17:73798461-73798483 CAACCATTTAGATGGATGACTGG + Intergenic
1154009590 18:10563767-10563789 AAGCCACTTAGAATGATGCCTGG + Intergenic
1155195679 18:23471855-23471877 ACATCACTTAGAAGTCTAACAGG - Intronic
1155271081 18:24141807-24141829 ATACCACTTAAAAGGCAGAAAGG + Intronic
1157210050 18:45734624-45734646 AAACTATTCAGAAGGCTGAGGGG + Intronic
1157690457 18:49677729-49677751 AAAGACCTTAGAAGGCTGCCTGG + Intergenic
1158013555 18:52757258-52757280 AAGCCATTAAGAAGGCTGAGAGG - Intronic
1160848819 19:1179776-1179798 CAGCTACTTAGGAGGCTGACTGG - Intronic
1160881779 19:1324207-1324229 AAACCACTTGGAGGGGTGTCTGG + Intergenic
1161881116 19:6953531-6953553 TAAGCGCTTAGAAGGCTGCCTGG - Intergenic
1163331343 19:16640188-16640210 CAGCTACTTGGAAGGCTGACAGG - Intronic
1163696666 19:18767804-18767826 AAACCACTTAGCAGGATGCCCGG - Intronic
1164550248 19:29204788-29204810 CAGCTACTTAGGAGGCTGACAGG + Intergenic
1165217146 19:34283502-34283524 AAAGCACTTAGAATGATGTCTGG - Intronic
1165993875 19:39831458-39831480 AAAACACTTAGAATGGTGCCTGG - Intronic
1167284816 19:48593001-48593023 AAACCACACAGCAGGCTGGCGGG + Intronic
925488750 2:4368737-4368759 AAACCTCTGGGCAGGCTGACTGG - Intergenic
927093569 2:19730386-19730408 AAAGCACTTAGAACAATGACTGG - Intergenic
927728307 2:25446003-25446025 AAAGCACTTAGAATAATGACTGG + Intronic
928326187 2:30321506-30321528 AAAGCCATTAGAAGGCTGAGGGG - Intronic
929145306 2:38702272-38702294 AAACCTCTTAGACGGCTCTCAGG + Intronic
929973345 2:46605792-46605814 GAAGAACTTAGAAAGCTGACAGG - Intronic
930795871 2:55390144-55390166 AAACAACTTAGAAAACTGAGTGG + Intronic
931908060 2:66864202-66864224 AAAGCCCTTAGAAGGGTGGCAGG + Intergenic
932190369 2:69736434-69736456 AAAGCACCTAGAATACTGACTGG + Intronic
933877324 2:86632248-86632270 AAATCACTCAAAAAGCTGACTGG - Intronic
937615272 2:123914243-123914265 AAAGCACTTAGAATGGTGCCGGG + Intergenic
937880300 2:126859505-126859527 AAATCACTAAAAAGGCTGTCAGG + Intergenic
937945582 2:127333014-127333036 CAGCTACTTAGAAGGCTGAGTGG + Intronic
939788051 2:146540513-146540535 AAACCACTTAAGAGGCTAAAAGG - Intergenic
942890839 2:180985610-180985632 ACACCATTTAGAAGGCTGGAGGG - Intronic
943485400 2:188473431-188473453 AAACCACTTAGAAGTCTTTCTGG + Intronic
945273765 2:207967740-207967762 AAAGGACTTAGAATGCTGCCTGG - Intronic
946340356 2:219062625-219062647 AAAGCACTTGGAAGGCTTTCAGG - Intergenic
946376154 2:219310000-219310022 GGATCACTTAGAAGGATGACTGG + Intergenic
947795452 2:232891270-232891292 AGACCTCCTAGAAAGCTGACAGG + Intronic
1169026591 20:2376680-2376702 AAAGCACTTAGAACACTGCCTGG - Intergenic
1170122237 20:12923905-12923927 AAAGTACTTAGCAGGGTGACTGG + Intergenic
1172861490 20:38056946-38056968 TAACCACTTTTGAGGCTGACAGG - Intronic
1173347468 20:42214168-42214190 AGAACATTTAGAAGCCTGACTGG - Intronic
1173814534 20:45976779-45976801 AAACCACTTAGAATGGTGACCGG - Intergenic
1174236296 20:49095438-49095460 TAGCTACTTGGAAGGCTGACAGG - Intronic
1174441857 20:50562002-50562024 CAATCACTCAGAAGGCGGACAGG - Intronic
1177765804 21:25456061-25456083 ATACAACTCAGAAGGCTGAGTGG + Intergenic
1178699712 21:34822678-34822700 AAACCACTTAGTGGGCAGAAAGG + Intronic
1179047682 21:37861069-37861091 AAACCACTTAGAAGGCTGACAGG + Intronic
1182726921 22:32454958-32454980 AAAGCGCTTAGAATGCTGTCTGG - Intronic
1183779802 22:39991984-39992006 AGACCACTTAGAAGAATGTCTGG - Intergenic
1184582915 22:45429373-45429395 AAACCACTGAGAATCCTGGCAGG + Intronic
1184915626 22:47566985-47567007 AAACTACTTAGAACAGTGACCGG - Intergenic
949290655 3:2461744-2461766 AAAGCACTTAGAAGAGTGGCTGG - Intronic
950970326 3:17180130-17180152 AAACCTCTTCTAAAGCTGACAGG + Intronic
951177780 3:19622013-19622035 AAAAGACATACAAGGCTGACTGG - Intergenic
951215567 3:20021680-20021702 CAACCACTTGGGAGGCTGAGAGG + Intergenic
951581509 3:24169614-24169636 AAAGCACTTAGAATGATGACTGG + Intronic
951587217 3:24227651-24227673 AAAACTTTTAGAAGGCTGAGTGG + Intronic
952539571 3:34353515-34353537 AAAATACTTAGAAGATTGACTGG - Intergenic
953508594 3:43511765-43511787 AAACCACTTACAAAGCATACAGG + Intronic
955324146 3:57996758-57996780 CAACTACTTGGAAGGCTGAGAGG - Intergenic
955638662 3:61058123-61058145 AGACCACTTAGAACACTGCCTGG + Intronic
955754525 3:62214384-62214406 AAAACACTTAGAATGTTGCCTGG - Intronic
955985225 3:64566909-64566931 AAAACATTAAGAAGGATGACTGG + Intronic
956582560 3:70830711-70830733 AGACCAGTTAGAAGGCTGGTGGG - Intergenic
956851259 3:73230349-73230371 AGGCAACTTAGAAGGCTGGCAGG - Intergenic
960313913 3:116152262-116152284 AAAGCACCTAGAAGGGTGCCCGG - Intronic
961021918 3:123515075-123515097 AAAGCACTTAGAACACTGCCTGG - Intronic
964138473 3:153370784-153370806 AACACACTTCTAAGGCTGACAGG + Intergenic
967153656 3:186673063-186673085 AAATCACTTAGAAGAGTGCCTGG - Intronic
969668625 4:8576706-8576728 CAGCCACTCAGGAGGCTGACAGG - Intronic
970316303 4:14831504-14831526 AAACCACAAAGAATGCTGGCAGG + Intergenic
970669407 4:18378748-18378770 AAACCACTTAGAAGGGTACTTGG - Intergenic
971477792 4:27088716-27088738 GAACCACTCAGAAGAGTGACAGG - Intergenic
972134930 4:35880266-35880288 AAACCACTTACAAGGAGGAAAGG + Intergenic
972379051 4:38501839-38501861 AAGGCACTTAGAAGGGTGCCTGG + Intergenic
972404278 4:38731670-38731692 AAAACACTTAGAATGGTGCCTGG + Intergenic
973318469 4:48785575-48785597 AAAAAACTTGGAAGGCTGAGTGG + Intergenic
973652187 4:53007165-53007187 CAGCCACTCAGAAGGCTGAGGGG + Intronic
973916546 4:55639669-55639691 ATACCACTTAGTTGCCTGACTGG - Intergenic
973942213 4:55922682-55922704 AAATTACTTAGAAGAGTGACTGG - Intergenic
974381393 4:61144961-61144983 AAAGCTCTTAGAAGACTGCCTGG + Intergenic
975105467 4:70563973-70563995 AAACCTTTTAGAAGGCCGAAAGG + Intergenic
975239034 4:72034954-72034976 GAGCCAGTTAGAAGTCTGACTGG - Intronic
978528630 4:109692323-109692345 AAACCACTTAGAACAGTGCCTGG - Intronic
978599444 4:110412647-110412669 AAAACACTTAGAATAGTGACTGG + Intronic
979430369 4:120622309-120622331 AAAGCACTTGGAAGGGTGGCTGG - Intergenic
979487408 4:121284197-121284219 AAACCTCTTGACAGGCTGACTGG + Intergenic
980806714 4:137824952-137824974 CAGCTACTTAGAAGGCTGAGGGG + Intergenic
980810905 4:137878281-137878303 AAATCATTTAGAAGAGTGACTGG - Intergenic
981996212 4:150977879-150977901 AAAACTCTTAGAAATCTGACTGG - Intronic
983265590 4:165504672-165504694 AAGGCACTTAGAAAGCTGCCTGG + Intergenic
990356259 5:54969136-54969158 AAACCACTTAGAGTCCTGTCTGG - Intergenic
990778001 5:59324913-59324935 AAACATCTTAGAAGGCTGCATGG + Intronic
990879959 5:60528209-60528231 AACTGCCTTAGAAGGCTGACAGG - Intergenic
991284369 5:64954614-64954636 AAAGCACTTAGCAGGCTGCCTGG + Intronic
992444241 5:76819773-76819795 AAACAACCTAGAAGGCTCCCGGG - Intronic
992526928 5:77620672-77620694 CAACGACTTAGAAGCCTGAGGGG - Intergenic
993009240 5:82460700-82460722 AACCCACTTAAAAGGCAGAGTGG + Intergenic
994468851 5:100176379-100176401 AAACAACTAGGAAGGCTGAAGGG + Intergenic
995636226 5:114194782-114194804 AAAACTCTTAGAAGACTCACAGG - Intergenic
995983553 5:118139808-118139830 AAAACAGATAGAAGGCAGACAGG + Intergenic
996424605 5:123300419-123300441 CAGCTACTTAGAAGGCTGAAGGG + Intergenic
997106467 5:131024988-131025010 AACCCACTCAGAAGACTGAATGG + Intergenic
998630980 5:143898285-143898307 AAAACACTTAGAACAGTGACTGG + Intergenic
998748202 5:145286105-145286127 AAATCACTTAGAAAAGTGACTGG - Intergenic
998874243 5:146583340-146583362 AAAGCTCTTAGAAGGATGCCTGG - Intronic
999081157 5:148844745-148844767 ACACCCCTTAGAAAGATGACTGG - Intergenic
999311877 5:150556880-150556902 AAACCTCTTTGAATGCTGAAAGG + Exonic
999482736 5:151964015-151964037 AAACAAATCAGAATGCTGACAGG + Intergenic
999801968 5:155046740-155046762 AAAGCACTCAGAAGCCTGCCAGG - Intergenic
999802056 5:155047439-155047461 AAAGCACTTAGCAGGGTGCCTGG + Intergenic
1000284670 5:159816758-159816780 TAAACACTTAGAAGGGTGTCTGG - Intergenic
1000627925 5:163560412-163560434 TAACCACTTGGGAGGCTGAGTGG - Intergenic
1005463437 6:26090101-26090123 TCACCACTTGGAAGCCTGACTGG - Intronic
1006549156 6:34806416-34806438 AAACAACTCAGATGTCTGACAGG + Intronic
1006769430 6:36539990-36540012 AAAACACTTATAATGCTGAAAGG - Intronic
1007313868 6:40968716-40968738 AAAGCACCTAGAAGAGTGACTGG - Intergenic
1008383260 6:50857621-50857643 AAACCATGAAGAAGGCTGCCTGG - Intergenic
1009819035 6:68775581-68775603 AAAGCACTCAGAATGGTGACTGG + Intronic
1010826361 6:80481526-80481548 AAGGCACTTAGAAGGTTGCCTGG + Intergenic
1010880653 6:81165810-81165832 AAAAGACTTAGAAGGATGTCTGG + Intergenic
1011847423 6:91583503-91583525 AATCTACTTTGAAGGCTGATAGG + Intergenic
1013496996 6:110707357-110707379 AAAAAACTGAGAAGGCTGAAAGG + Intronic
1013673715 6:112433915-112433937 AAAGCACTTAGAATGCTGCCCGG + Intergenic
1015088909 6:129330476-129330498 AAATCACTAAGAATGATGACAGG - Intronic
1015301906 6:131662351-131662373 CAACTACTTAGGAGGCTGAGGGG - Intronic
1016536563 6:145113112-145113134 AAAGCACTTAGAAGAGTGTCTGG - Intergenic
1016624483 6:146150093-146150115 AAACAAATTAAAAGGCTGCCAGG + Intronic
1016643745 6:146380258-146380280 AAAAAACTTAGAAGTCTGCCTGG + Intronic
1017774541 6:157670588-157670610 AAACTACTTGGAAGGCGGCCGGG - Intronic
1018180785 6:161221572-161221594 AAAAGACTTAGAACGCAGACTGG + Intronic
1019222599 6:170485945-170485967 AAAGCACCTTGAAGGCAGACAGG - Intergenic
1019951916 7:4380108-4380130 AAACCACTGAGTACGCTGGCTGG - Intergenic
1020039510 7:4991275-4991297 AAAGCACTTAGAAAAGTGACTGG - Intronic
1020155797 7:5723179-5723201 AAAGCACTTAGAAAAGTGACTGG + Intronic
1022304913 7:29138139-29138161 AAAATAATTAGAAGGTTGACTGG + Intronic
1022742116 7:33132380-33132402 AAAGCATTTAGAATCCTGACTGG + Intronic
1022853796 7:34295703-34295725 AAAACACTTAGGAGGATGCCTGG + Intergenic
1023530497 7:41148892-41148914 AAACCACAGAGAAGGCAGAATGG + Intergenic
1026863371 7:73808253-73808275 CAGCCACTTAGAAGGCTGAGAGG - Intronic
1028567622 7:92249775-92249797 AAAGCACTTAGCATGGTGACTGG - Intronic
1030461355 7:109840078-109840100 AATCCCCTCAGAAGGCTGTCTGG + Intergenic
1030964587 7:115974913-115974935 AAAGCACTTAGAAGCATGCCTGG - Intronic
1031820936 7:126500462-126500484 AAACCCTTTAGGAGGATGACAGG - Intronic
1031912339 7:127531517-127531539 AAAACACTTAGAATGGTGTCTGG + Intergenic
1032679412 7:134166928-134166950 AATTCACTTAGAAGCCTGATTGG - Intronic
1035206592 7:157297559-157297581 AAACATCTTAGCAGGATGACCGG - Intergenic
1036961279 8:13247432-13247454 AAAGCACTTAGAATGCTGCCTGG - Intronic
1037007629 8:13801514-13801536 AAAATAATTAGAAAGCTGACAGG + Intergenic
1038316987 8:26493225-26493247 GAACCACTTAAAAGGATGAGAGG + Intronic
1039191383 8:34980053-34980075 AAACCATTCAGAAGGCAAACTGG + Intergenic
1040400679 8:47046252-47046274 AAACCAATTGGGAGGCTGAAGGG + Intergenic
1040728242 8:50409641-50409663 AAACCATTCAGAAGGATGACAGG - Intronic
1040903344 8:52439634-52439656 ATCCCACTCAGAAGGCTGAGCGG + Intronic
1041794189 8:61729087-61729109 AAACACCTGAGAAGGCTGAAAGG + Intergenic
1041809962 8:61896921-61896943 TCACTACTTAGAAGGCTCACAGG + Intergenic
1041863772 8:62544680-62544702 TAAACACTTAGAAGGATGTCTGG - Intronic
1042173929 8:66020749-66020771 TAACTACTCAGGAGGCTGACAGG - Intergenic
1042868360 8:73375871-73375893 AAAGCACTTAGAAGAATGCCTGG + Intergenic
1043251328 8:78077412-78077434 CAACTACTTAGAAGGGAGACTGG + Intergenic
1043577158 8:81671444-81671466 CATCCATTTACAAGGCTGACAGG + Intronic
1043977875 8:86603533-86603555 AAAGCACTTAGAACACTGCCTGG - Intronic
1044872051 8:96629006-96629028 AAAGCACTTAGAATGGTGCCTGG - Intergenic
1046049922 8:109010619-109010641 ACACCACTTAGAAGGCCCTCAGG + Intergenic
1046610446 8:116417485-116417507 AAACCACCAAGATGGCTGTCAGG - Intergenic
1046950670 8:120016712-120016734 AAGCTACATTGAAGGCTGACAGG - Intronic
1047829006 8:128611520-128611542 ATACTACTTAGAAGGCTGTTTGG + Intergenic
1049349604 8:142157493-142157515 AAACCCCCTAGAAGGATGGCTGG + Intergenic
1050593916 9:7186975-7186997 AAACCAATGTGAAAGCTGACAGG - Intergenic
1051703147 9:19846549-19846571 AATCCACTTAAAAGGCAGAGTGG - Intergenic
1052309019 9:27043876-27043898 AAACCAGTTAGAAAGTTGTCAGG - Intronic
1053290235 9:36874908-36874930 AAAGCTCTTAGAATTCTGACTGG - Intronic
1057005844 9:91558129-91558151 AGGGCACTTGGAAGGCTGACTGG + Intergenic
1057067652 9:92070745-92070767 AAAACACTTAGAACACTGCCTGG + Intronic
1059126447 9:111691155-111691177 AAAGCACTTAGAATGGAGACTGG + Intronic
1059213641 9:112538822-112538844 AAAACACTTAGAAGAGTGCCTGG - Intronic
1061250791 9:129425159-129425181 AAAGCACTTAGAATGGTGCCTGG - Intergenic
1185689086 X:2138467-2138489 AAACAACTTAGAGTGATGACTGG + Intergenic
1186432071 X:9513502-9513524 AATCCACATGGAAGGCTGCCTGG + Intronic
1186827295 X:13353069-13353091 CAGCTACTTAGGAGGCTGACAGG + Intergenic
1187199406 X:17120490-17120512 AAAGCACTTAGAATGATGCCTGG + Intronic
1187305305 X:18089919-18089941 AAAGCACTTAGAAGAGTGTCAGG - Intergenic
1190380895 X:49838950-49838972 ATACAACTAAGAAGCCTGACAGG - Intergenic
1192139640 X:68636782-68636804 TAACCACTTAGAAGGTGCACAGG + Intergenic
1193847077 X:86486028-86486050 AAAACACTTAGAAGAGTGCCTGG + Intronic
1193925174 X:87475851-87475873 AAACAACTTAGAAAGCTACCTGG + Intergenic
1196027423 X:111055609-111055631 AAACCACTCAGGACACTGACTGG + Intronic
1196968531 X:121084292-121084314 AAACCTTTTGGAAGGCTGAAAGG + Intergenic
1197149745 X:123207317-123207339 AAATCACTTAGAAGGATGCCTGG - Intronic
1198053543 X:132971977-132971999 AAAACAATTAGAACACTGACTGG + Intergenic
1198217124 X:134565765-134565787 AAACCACTTAGAACAATGTCTGG + Intergenic
1198313727 X:135445696-135445718 AAAGCACTTAGAAGAGTGCCTGG - Intergenic
1198928620 X:141827030-141827052 TAACCACTTGGAAGTCTGAAAGG + Intergenic
1200876648 Y:8163116-8163138 AGGCCACTTAGAACACTGACTGG - Intergenic
1201856754 Y:18553002-18553024 AAACCTTTTGGAAGGCTGAAAGG + Intronic
1201876567 Y:18767378-18767400 AAACCTTTTGGAAGGCTGAAAGG - Intronic
1202601096 Y:26593813-26593835 AAACTTCTTGGAAGGCTGGCAGG - Intergenic