ID: 1179049099

View in Genome Browser
Species Human (GRCh38)
Location 21:37873525-37873547
Sequence TAGCAATGCTCAGCTAGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179049099_1179049100 -1 Left 1179049099 21:37873525-37873547 CCACAACTAGCTGAGCATTGCTA 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1179049100 21:37873547-37873569 AGCAGTGTGCATACTCGTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 60
1179049099_1179049101 4 Left 1179049099 21:37873525-37873547 CCACAACTAGCTGAGCATTGCTA 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1179049101 21:37873552-37873574 TGTGCATACTCGTCTAGGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179049099 Original CRISPR TAGCAATGCTCAGCTAGTTG TGG (reversed) Intronic
902788742 1:18750596-18750618 TAGCAAAGCTCCTCAAGTTGGGG - Intergenic
904074303 1:27828722-27828744 AGGCACTGCTCAGCAAGTTGAGG - Intergenic
905077847 1:35289724-35289746 TAGCACTGCCCCACTAGTTGTGG + Intronic
911695577 1:100887458-100887480 TAGTAATGCTCAGCTCTGTGAGG - Intronic
914386798 1:147177539-147177561 TAGCCTTGATCAGCTGGTTGAGG - Intronic
917532492 1:175849430-175849452 TAGCATTGGCAAGCTAGTTGGGG + Intergenic
917817924 1:178729421-178729443 TAGTGATGCTCAGATATTTGTGG + Intronic
921324708 1:213979330-213979352 TAGCAGTGCTCAGCAAGTGCTGG + Intergenic
1063495358 10:6502444-6502466 TGGCAATGCCCAGCTAGTGCTGG - Intronic
1066647315 10:37622923-37622945 TAGCACTGCTGAGCTATGTGTGG - Intergenic
1068250848 10:54438126-54438148 TATCAATTCTGAGCTAGGTGAGG - Intronic
1074414889 10:113259357-113259379 TAGCAATACTCAGTTGGTAGAGG - Intergenic
1074495502 10:113976785-113976807 TAGAATTGGTCAGCTAGTGGTGG + Intergenic
1077359445 11:2134217-2134239 CAGCAATGCTCAGCTGGAAGGGG + Intronic
1079409997 11:20178691-20178713 TAGGAGTGCCCAGCTAGCTGAGG + Intergenic
1087448626 11:98288400-98288422 TAGCATTGCACAGATAGATGAGG - Intergenic
1090912524 11:131133889-131133911 AAGGAATGCTGAGCTGGTTGAGG - Intergenic
1093282565 12:17212021-17212043 TAGCACTGCTCAGCCGGGTGTGG - Intergenic
1094640813 12:32273611-32273633 TAATAATGATCAGCTAGTAGAGG + Intronic
1106328703 13:28718945-28718967 CAGCGATGCTCAGCTGGCTGCGG - Exonic
1127112573 15:55690476-55690498 TTGCAATGCTCAGCTTTTGGGGG - Intronic
1130753257 15:86736043-86736065 TTGCAATGCTGAGCTCTTTGAGG - Intronic
1133087017 16:3372878-3372900 TTGCAATGCCCAGCAAGGTGTGG + Intronic
1133503476 16:6387623-6387645 TAGCATTGCTCAGCTGTTTTAGG + Intronic
1155416885 18:25607798-25607820 TAACAATGCCCATCTAGTTCAGG - Intergenic
1157114248 18:44848239-44848261 AAGCAAGGCTTAGCTAGTTTGGG + Intronic
1167012560 19:46818477-46818499 TTGCAATACTCAGCCAGGTGCGG + Intergenic
927037157 2:19189851-19189873 TAACAATGCACAGCTAGTAAAGG - Intergenic
931102998 2:59023581-59023603 TAACAATGCTCAGAAAGTTAGGG - Intergenic
932000851 2:67882937-67882959 TAGCAATGCCCAGCTGGTCTTGG - Intergenic
932793006 2:74672220-74672242 TAGCCATGCTCAGCCATGTGGGG - Intronic
933038963 2:77436306-77436328 TAGCAATGCTAAGCTAATGATGG + Intronic
936759021 2:115751492-115751514 AAGCAGAGCTCAGCTAGTTGTGG + Intronic
937382706 2:121395025-121395047 CAGCCATTCTCAGCTAGTAGAGG - Intronic
940181492 2:150939077-150939099 TGGGAATACTCAGCTAGGTGGGG - Intergenic
942183421 2:173402232-173402254 TTGCATTGCTCATCTAGATGGGG - Intergenic
948240526 2:236429473-236429495 TGGTTATGCTCATCTAGTTGTGG + Intronic
1173354443 20:42273931-42273953 CAGTAATGCTCAGCTATCTGGGG + Intronic
1174135656 20:48377235-48377257 GAGCATTGCTTAGCTAGTGGCGG - Intergenic
1175274115 20:57755772-57755794 CAGCAATGCTCAGTGAGGTGAGG + Intergenic
1178314324 21:31556660-31556682 TAGCAGTGCAGAGCTAGTGGAGG + Intronic
1179049099 21:37873525-37873547 TAGCAATGCTCAGCTAGTTGTGG - Intronic
1179813519 21:43887544-43887566 AAGTAATGCTCAGGTGGTTGAGG + Intronic
952513243 3:34077866-34077888 TAGCAATGCAAGGCTTGTTGTGG + Intergenic
955576607 3:60371709-60371731 TATGAATGCTCAGCTATCTGGGG - Intronic
956464872 3:69509407-69509429 TAGAAATGGTCATCTAGTTAGGG + Intronic
956947860 3:74244248-74244270 TAACAATGATCAGCCAGGTGTGG + Intergenic
958721709 3:97851778-97851800 TGGCAATGCTCAGCCATTGGAGG + Intronic
959434089 3:106291618-106291640 CCGCAATGCTCAGCTAATTTTGG - Intergenic
963662396 3:148143518-148143540 TAGCAATGCTCAGCTGCTTGTGG + Intergenic
974491873 4:62574065-62574087 TAGCAATTCTCTGCTATTTAAGG + Intergenic
975258898 4:72272905-72272927 TAGCTATGATCAGCTACTTACGG + Intergenic
976888914 4:90020966-90020988 GAGAAATGCTCAGCTACTGGAGG + Intergenic
980510195 4:133775079-133775101 TAGTAAGGCTCAGCTAATTAAGG - Intergenic
980776431 4:137442561-137442583 TAGCAATGATCATCAAATTGGGG - Intergenic
981043022 4:140240558-140240580 TACAAATGCTCAGCACGTTGTGG - Intergenic
984489889 4:180419804-180419826 TAGCAATAAGGAGCTAGTTGTGG - Intergenic
987565226 5:19575522-19575544 CAGGAATGCTCAGATAGTTGAGG - Intronic
987682803 5:21159744-21159766 TGGCAATAATCAGCTATTTGGGG + Intergenic
989738696 5:44741654-44741676 AAGCAATGATTATCTAGTTGAGG + Intergenic
992097273 5:73374465-73374487 TAGCAGTGCTCAGAAAGATGTGG + Intergenic
995056654 5:107766630-107766652 TAGCAAGACTCAGCTGGATGAGG - Intergenic
995559030 5:113361073-113361095 TAGGAAGGCTCTGCTGGTTGAGG - Intronic
997869370 5:137493623-137493645 TATCAATGGTCAGCTAGTACAGG + Intronic
1003420249 6:5951285-5951307 TAGCACTGCTCACCTGGTGGCGG + Intergenic
1004484077 6:16049114-16049136 AAGCAATGCCCAGGAAGTTGGGG - Intergenic
1005977838 6:30813800-30813822 AAGAAATTCTCAGCTAGGTGTGG - Intergenic
1008088102 6:47265316-47265338 TAGCAAAGCCCAGCTTGTTCTGG - Intronic
1013394014 6:109715987-109716009 TAAAAATGCTCAGATAGGTGGGG - Intronic
1014319079 6:119904112-119904134 TAGAAATGGTCAGATAATTGTGG - Intergenic
1024434035 7:49327887-49327909 TAGCAAAAATCAGCTAGGTGTGG + Intergenic
1027873386 7:83739113-83739135 TTCTAATGCTCTGCTAGTTGGGG - Intergenic
1030876205 7:114816597-114816619 TAGCAAAGCTCAGTGAGTTCTGG + Intergenic
1034685587 7:152968036-152968058 TAGGAATGCTCAGCTAGTAAGGG + Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1042650483 8:71034958-71034980 TAGCAGTTCTCAACTATTTGTGG + Intergenic
1045327761 8:101129348-101129370 TATAAATGCTCTGCTAGTTGAGG + Intergenic
1050144785 9:2555662-2555684 TATCAAAGATCAGATAGTTGTGG - Intergenic
1053536921 9:38935505-38935527 GAGGAATGGTCACCTAGTTGGGG + Intergenic
1054629215 9:67428425-67428447 GAGGAATGGTCACCTAGTTGGGG - Intergenic
1055141376 9:72881006-72881028 TAGCATTCCTCATCCAGTTGTGG + Intergenic
1055543455 9:77340743-77340765 TAGGAATGCCCAGCTTGTTAAGG + Intronic
1059349528 9:113654644-113654666 TTGGAATGCTCATCTAGATGAGG + Intergenic
1061232900 9:129325250-129325272 CAGCAAGGCTCAGCTTGGTGGGG + Intergenic
1062120263 9:134830308-134830330 CAGCAAGACTCAGCTAGGTGTGG + Intronic
1187451071 X:19396866-19396888 TTGCAATGCTCATTTTGTTGGGG + Intronic
1188375170 X:29419702-29419724 CAACAATGCTCAGTTAGTAGTGG + Intronic
1189811045 X:44780925-44780947 TCGCCATGCCCAGCTTGTTGTGG - Intergenic
1195867009 X:109443536-109443558 TAGCACTGCTTAGCTATTTATGG + Intronic