ID: 1179049380

View in Genome Browser
Species Human (GRCh38)
Location 21:37875557-37875579
Sequence TATGCTTCTGAAGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179049378_1179049380 3 Left 1179049378 21:37875531-37875553 CCTCGGGGTTTAATTGCTGGTGG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1179049380 21:37875557-37875579 TATGCTTCTGAAGCTGCTGCAGG 0: 1
1: 0
2: 4
3: 29
4: 273
1179049375_1179049380 13 Left 1179049375 21:37875521-37875543 CCCTAGGGTTCCTCGGGGTTTAA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1179049380 21:37875557-37875579 TATGCTTCTGAAGCTGCTGCAGG 0: 1
1: 0
2: 4
3: 29
4: 273
1179049376_1179049380 12 Left 1179049376 21:37875522-37875544 CCTAGGGTTCCTCGGGGTTTAAT 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1179049380 21:37875557-37875579 TATGCTTCTGAAGCTGCTGCAGG 0: 1
1: 0
2: 4
3: 29
4: 273
1179049371_1179049380 24 Left 1179049371 21:37875510-37875532 CCTGGCTTCTACCCTAGGGTTCC 0: 1
1: 0
2: 0
3: 16
4: 157
Right 1179049380 21:37875557-37875579 TATGCTTCTGAAGCTGCTGCAGG 0: 1
1: 0
2: 4
3: 29
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179049380 Original CRISPR TATGCTTCTGAAGCTGCTGC AGG Intronic
901614599 1:10528338-10528360 TGAGCATCTGAAGCTGCTGGAGG + Intronic
903754341 1:25650418-25650440 TGCTCTTCTGAGGCTGCTGCAGG + Intronic
905205728 1:36341907-36341929 CATGCGTCAGCAGCTGCTGCTGG - Exonic
905705897 1:40057458-40057480 GAGGCTTCTGCTGCTGCTGCAGG + Intronic
905824074 1:41016138-41016160 CGTGCTGCTGCAGCTGCTGCTGG + Exonic
907383393 1:54109753-54109775 CATGGTTCTGAAGTTGGTGCTGG + Intronic
907417990 1:54327593-54327615 AATGATTCTGCAGCTGCTGCTGG + Intronic
908260817 1:62338307-62338329 TGTGCTTCTAAAGCCTCTGCTGG + Intergenic
908271933 1:62430683-62430705 TACTCTTCTGAAGCTCCTGTTGG + Intergenic
908442803 1:64171538-64171560 TATTCTTTTGAAGCTGATTCTGG - Intronic
908480932 1:64538337-64538359 TATATCTCTGAAACTGCTGCAGG - Intronic
910266101 1:85339423-85339445 TATGGTTCTGTTGCTGCTGTTGG - Intronic
913253885 1:116937073-116937095 TATGGATCTGAAGCTGGTGAAGG + Intronic
916259296 1:162824813-162824835 TATCCTTCTGCAGCAGCTGCTGG + Intronic
916408927 1:164525584-164525606 TAAGCTTCTGAACCCACTGCAGG + Intergenic
919765886 1:201127178-201127200 GAGGCTGCTGAAGGTGCTGCTGG - Exonic
920152826 1:203922739-203922761 ATTGCTTCTGCATCTGCTGCTGG - Intergenic
921104271 1:211959968-211959990 TATGCTGCTGTTGCTGCTGCTGG + Intronic
921525271 1:216209770-216209792 AATTGTTCTGAAGCTGCTTCAGG - Intronic
922233559 1:223706359-223706381 TTCTCTTCTGAAGCAGCTGCAGG - Intronic
922886898 1:229027368-229027390 TTTGCTTCTGCACCTGCAGCAGG - Intergenic
922965835 1:229690076-229690098 TATCCTGCTGCTGCTGCTGCTGG + Intergenic
923145763 1:231196737-231196759 CATGCTTCAGAAGCTTCTGCTGG + Intronic
924139265 1:241004949-241004971 TTTGCTTCTGAGGCTGCTTCAGG + Intronic
924828679 1:247569574-247569596 TATGCTTTTTAATGTGCTGCTGG + Intronic
1065770413 10:29072853-29072875 GATGGGTCTGGAGCTGCTGCAGG + Intergenic
1068050485 10:51943822-51943844 TAAGCTTCTTGAGGTGCTGCTGG + Intronic
1068455319 10:57247448-57247470 TATCCCCCAGAAGCTGCTGCAGG + Intergenic
1070385296 10:75918663-75918685 TCTGCTTCTGAAGGTGTTGGAGG - Intronic
1072792763 10:98330411-98330433 AATGCTTCTGCATCTTCTGCAGG - Intergenic
1074205127 10:111276580-111276602 TATGCTTCTCCAGGTGCCGCGGG - Intergenic
1075071219 10:119321056-119321078 TTTGGCTCTCAAGCTGCTGCGGG - Intronic
1076616240 10:131756707-131756729 TCTGCTTCTGTAGCTTCTTCTGG + Intergenic
1077835875 11:5928168-5928190 TCTGCTTCTGCCGCTGCAGCAGG + Intronic
1078716718 11:13846721-13846743 AATGATTCTGAAGGTGTTGCTGG - Intergenic
1080367306 11:31590670-31590692 TATGCTTCTGAGGATGCCTCAGG + Intronic
1081363632 11:42209141-42209163 TAAGCTTCTTAATGTGCTGCTGG - Intergenic
1081989611 11:47330698-47330720 TATGGGTCTGAACCCGCTGCTGG + Intergenic
1084274310 11:68043868-68043890 TCTGCTGTTGCAGCTGCTGCAGG - Exonic
1084859503 11:72009092-72009114 TTTCCTTCTGCAGCTGCTCCAGG + Exonic
1085755757 11:79200056-79200078 GATGCTTCTAGAGATGCTGCAGG - Intronic
1086202054 11:84215697-84215719 TTTGTTTCTGATGCTGATGCTGG - Intronic
1087049048 11:93867973-93867995 CAAGCTTCTGAAGCTTGTGCTGG + Intergenic
1087928422 11:103947690-103947712 TTGGTCTCTGAAGCTGCTGCGGG + Exonic
1089398287 11:118149893-118149915 TCTCCTTCTGAACCTGCTGGAGG - Intronic
1089678178 11:120104545-120104567 TATCCCTCTGAAGCCGCTGTGGG - Intergenic
1091014060 11:132033652-132033674 TATGCTTCTCACGCTGCATCTGG - Intronic
1093006866 12:14060731-14060753 TTTGCTTCTGAAGCTGCTGTTGG - Intergenic
1093587564 12:20859223-20859245 TTTGCTTCTGAAAATGCTCCTGG - Intronic
1096469001 12:51864608-51864630 TCAGCTTCTGCAGCGGCTGCCGG + Intergenic
1098403131 12:70094984-70095006 TATGGATCTGATTCTGCTGCTGG - Intergenic
1100443572 12:94640488-94640510 TCTACTTCTTAATCTGCTGCTGG + Intronic
1101449817 12:104765897-104765919 TAATCTTCTCTAGCTGCTGCTGG - Intergenic
1102483627 12:113241351-113241373 TCTGCTGCTGCTGCTGCTGCAGG - Intronic
1102966347 12:117130654-117130676 TTTGGTTCTGAAGCTGCCGATGG + Intergenic
1103254683 12:119530991-119531013 TGTCCTCCTGAAGGTGCTGCAGG + Exonic
1103289228 12:119830560-119830582 GATGCTTCTCAACCTACTGCAGG + Intronic
1104857991 12:131910751-131910773 GCTGCTGCTGGAGCTGCTGCCGG - Exonic
1105303994 13:19156653-19156675 TGTGCTGCTGAGGCTGGTGCAGG + Intergenic
1105605732 13:21925131-21925153 TCTGCTTGTGAAGCTTCAGCTGG + Intergenic
1106036699 13:26050906-26050928 TTCGCTCCTGCAGCTGCTGCTGG - Exonic
1106676150 13:31960585-31960607 TATGCTTGTGGAGCAGCTGGGGG + Intergenic
1107077185 13:36335289-36335311 TATACTCCTCAAGCTGCTGAAGG - Exonic
1107656182 13:42593802-42593824 GATGTCTCTGCAGCTGCTGCTGG + Intronic
1108747305 13:53408902-53408924 TCTCCTCCTGGAGCTGCTGCTGG + Intergenic
1109413876 13:62009922-62009944 TATGATGCTGCTGCTGCTGCAGG - Intergenic
1113487837 13:110668035-110668057 CATGCTTCTGCAGCTGGTCCAGG - Intronic
1113598148 13:111548655-111548677 TTGGCTCCTGAAGCTGCAGCTGG + Intergenic
1113922829 13:113923687-113923709 CTTGCTTCAGAGGCTGCTGCTGG - Intergenic
1114199911 14:20510501-20510523 CATGTTGCTGATGCTGCTGCTGG + Exonic
1115308005 14:31951765-31951787 TATGATTAAGAAGCTGTTGCAGG - Intergenic
1115347485 14:32358777-32358799 TAGGCTTCTCATGCTGATGCAGG - Intronic
1115483338 14:33884219-33884241 GAAGCCTCTGAAACTGCTGCCGG + Intergenic
1116290285 14:43026463-43026485 TCTGCTTCTGAGGAGGCTGCAGG - Intergenic
1116725266 14:48554771-48554793 TCTGCTGCTGCTGCTGCTGCTGG + Intergenic
1116875396 14:50106603-50106625 CATGCTTCGGAATCTGCTGCTGG + Intergenic
1119445315 14:74658373-74658395 CATGGTTAAGAAGCTGCTGCTGG + Intronic
1121783281 14:96636315-96636337 ATTGCTTCTGAGGCTGCAGCTGG + Intergenic
1124436794 15:29656966-29656988 TATGTGTCTGCAGTTGCTGCCGG + Intergenic
1124722243 15:32120441-32120463 TCTTTTTCTGAAGCTGCTGTGGG + Intronic
1125506324 15:40269812-40269834 TGTGCTGCTGCTGCTGCTGCAGG - Intronic
1126544813 15:49861803-49861825 CATGTTTCTGAATCTGCTACTGG + Intronic
1127404807 15:58631510-58631532 AATGCTGCTGCTGCTGCTGCTGG - Intronic
1127830780 15:62749199-62749221 AATGCTTCAGAAGCTGCAGTGGG - Intronic
1128506958 15:68279167-68279189 CATGATGCTGCAGCTGCTGCTGG - Intronic
1129909622 15:79215229-79215251 TGTGCTTCTGTAGCTGATCCAGG + Intergenic
1132045749 15:98561666-98561688 GATGACTCTGAAGCTGCAGCCGG + Intergenic
1132066604 15:98736191-98736213 TTTGCTTCTGTCGCTGCTGCTGG + Intronic
1133346073 16:5071409-5071431 TCTGCTTCTGGATCTGGTGCTGG - Intronic
1133784315 16:8963255-8963277 TCTGCTGCTGCTGCTGCTGCTGG + Exonic
1135006602 16:18829300-18829322 TATGCAGCTGAACCCGCTGCAGG + Exonic
1136461717 16:30415333-30415355 TCTGTTTCTGAAGCTGCAGGAGG - Intronic
1136633746 16:31505937-31505959 TATGGTTCAGAAGCTGATACAGG + Intronic
1137916697 16:52439467-52439489 GATGCTGCTGCTGCTGCTGCAGG + Exonic
1138166656 16:54808122-54808144 GATGCTGCTGCTGCTGCTGCTGG + Intergenic
1138720714 16:59076012-59076034 TAAGCTTTTGGATCTGCTGCTGG - Intergenic
1139383656 16:66550040-66550062 TATGCTGCTGTGGCCGCTGCGGG - Exonic
1141591113 16:85069373-85069395 GCTGCTTCTGAATCAGCTGCTGG - Intronic
1142219158 16:88844622-88844644 TGTGCTGCCGAAGCTGCTGAAGG - Intronic
1142979779 17:3664862-3664884 CATGGCTCTGAGGCTGCTGCTGG - Intronic
1143352218 17:6297362-6297384 TATCCTACTGAAGCTGCTCTTGG - Intergenic
1143409347 17:6699215-6699237 GATGGTCCTGAACCTGCTGCAGG - Intronic
1145123200 17:20279004-20279026 TATGCTGCAGCAGCAGCTGCTGG - Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1150025038 17:61665466-61665488 TATGCTTTTTAATGTGCTGCTGG + Intergenic
1151045472 17:70915593-70915615 TATGATTCTGAAGATGGTGATGG + Intergenic
1152979796 18:266378-266400 GATGCCACTGTAGCTGCTGCTGG - Intronic
1154039364 18:10838439-10838461 CATGCTTCTGAAGCTTTTGGGGG + Intronic
1157530585 18:48417245-48417267 TCTGCTCCTGACGCTGCAGCAGG + Intergenic
1158705281 18:59787029-59787051 TATGTTGCTGCTGCTGCTGCTGG - Intergenic
1159565757 18:70046758-70046780 CAGGCTTCTGAAGGCGCTGCTGG + Intronic
1159936313 18:74370728-74370750 GAAGCTTCTGAAGTTCCTGCGGG - Intergenic
1160417573 18:78721660-78721682 TCTGTTTCTGAAGCTGCTTCAGG - Intergenic
1161597257 19:5156845-5156867 TGTGTTTCTAAAGCAGCTGCTGG - Intergenic
1162106627 19:8373766-8373788 TAAGCTTCTGCCGCTGCTGTGGG - Exonic
1163378742 19:16950346-16950368 TGTACTTCTGCAGCTGGTGCTGG - Intronic
1167050024 19:47072434-47072456 CCTGCTGCTGCAGCTGCTGCGGG + Exonic
1168429712 19:56268437-56268459 GATGCTGCTGCTGCTGCTGCTGG + Intronic
924994623 2:347577-347599 TATGCTTCTGAAGATATTACAGG + Intergenic
925339511 2:3126413-3126435 GCTGCTTCTGAAGCTGCTGGCGG + Intergenic
926130208 2:10298248-10298270 TTTCCTGCTGCAGCTGCTGCTGG + Intergenic
926853657 2:17228567-17228589 TATGCTGTGGAAGCAGCTGCTGG - Intergenic
927104984 2:19816430-19816452 TATGCATCTGAAGAAGTTGCTGG - Intergenic
927977793 2:27352729-27352751 TATGCTTCTTAGGATGATGCAGG - Intronic
930441699 2:51416770-51416792 TTTGCTTCTGAGGCTGCTCCTGG - Intergenic
931694105 2:64859425-64859447 TGCGGTTCTGCAGCTGCTGCGGG + Intergenic
931961499 2:67488062-67488084 TATCCTTATAAAGCTGCTGTAGG + Intergenic
932546415 2:72715396-72715418 TATACTTCTGAAGTAGATGCTGG - Intronic
932646360 2:73507147-73507169 TAAGCTTTTGAATGTGCTGCTGG + Intronic
932703216 2:74004549-74004571 TTTGCTTCTGGAGCAGCTTCTGG + Intronic
935414369 2:102799948-102799970 TTTGCTCCTGAGGCTGCTGCTGG + Intronic
935593833 2:104864240-104864262 TTCGCTTCTGAAGCTGCAGACGG + Intergenic
938292734 2:130158815-130158837 TGTGCTGCTGAGGCTGGTGCAGG + Intronic
938463821 2:131514155-131514177 TGTGCTGCTGAGGCTGGTGCAGG - Intergenic
938806928 2:134814681-134814703 GATGCTGCTGAAGCTGCTTTTGG - Intergenic
942545547 2:177059895-177059917 TTTGCTTTTGATCCTGCTGCAGG - Intergenic
943111998 2:183618349-183618371 TATGCTTTTTAATATGCTGCTGG + Intergenic
943159747 2:184232324-184232346 TAAGCTTCTGGATGTGCTGCTGG + Intergenic
943160521 2:184244373-184244395 TAAGCTTCTGGATGTGCTGCTGG - Intergenic
943217634 2:185059038-185059060 TAAGCTTTTTAAGGTGCTGCTGG - Intergenic
943219334 2:185084758-185084780 TATGCTTGTGAAGCTGGGGAAGG + Intergenic
944211865 2:197214755-197214777 TTTGCTTCTGTTGTTGCTGCTGG - Intronic
945056949 2:205877653-205877675 TATGCTTCAGAACCTTCTGATGG - Intergenic
945064555 2:205937828-205937850 TTTGCTTCTGAGGGTGCAGCTGG - Intergenic
945516186 2:210765818-210765840 TTTGCTTCTGAAGATGCTTCTGG - Intergenic
947207455 2:227674958-227674980 GATGCTTCTGAGGCTGAGGCAGG - Intergenic
948217074 2:236239823-236239845 TCTGCTGCTGGATCTGCTGCAGG + Intronic
1169529447 20:6468617-6468639 TATGCTTCTGTGGCTGCTCTGGG - Intergenic
1172190481 20:33059408-33059430 GGTGTTGCTGAAGCTGCTGCCGG + Exonic
1172484004 20:35287726-35287748 GATGCTGCTGAGGCTGGTGCTGG + Exonic
1172590169 20:36112232-36112254 TATGCACCTGAAGCGGCAGCAGG - Intronic
1172623995 20:36337059-36337081 AATGCGGCTGCAGCTGCTGCTGG - Intronic
1173364354 20:42371440-42371462 TTTGCTTCAGAAGTAGCTGCAGG - Intronic
1174952029 20:55052700-55052722 TATGATTTTGTTGCTGCTGCAGG + Intergenic
1175315883 20:58046350-58046372 CGTGCTGCAGAAGCTGCTGCTGG + Intergenic
1175627765 20:60503139-60503161 CAGGCTTCTGCAGCTGCTGCTGG + Intergenic
1175977466 20:62718287-62718309 AATGGTTGGGAAGCTGCTGCTGG + Intronic
1178600233 21:33988312-33988334 TCTGCTTCTGAAGAGGCTTCAGG + Intergenic
1178855416 21:36246297-36246319 TGAGCTGCTGAAGCTGCTGCAGG + Exonic
1179049380 21:37875557-37875579 TATGCTTCTGAAGCTGCTGCAGG + Intronic
1179974463 21:44856276-44856298 TCTGCTGCTGCTGCTGCTGCAGG - Exonic
1180709206 22:17828381-17828403 TCTGCAGCTGGAGCTGCTGCTGG + Intronic
1181968219 22:26671361-26671383 GAGGCCTCTGAAGCTGCAGCTGG + Intergenic
1182123131 22:27799613-27799635 CATGCTGCTGCTGCTGCTGCTGG + Exonic
1182788061 22:32924483-32924505 GATGCTGCTGATGCTGCTGTTGG - Intronic
1183415905 22:37681709-37681731 CAGGCTTCTGAAGCTGTTTCTGG - Intronic
1183544858 22:38450016-38450038 TCTGCTTGTGACGCTGCAGCTGG - Intronic
1183875776 22:40779724-40779746 GATGCTTGTGAAGCTGTTTCAGG - Intronic
1184031729 22:41899092-41899114 AAAGCTTCTGAAGATGCTGGGGG - Intronic
950604243 3:14064343-14064365 GCTGCTGCTGGAGCTGCTGCTGG - Exonic
950636675 3:14320358-14320380 CATGCTTCTGGAGGAGCTGCTGG - Intergenic
950830757 3:15873375-15873397 GATGATTCTCAAGCTTCTGCAGG + Intergenic
953454190 3:43029123-43029145 CATCCACCTGAAGCTGCTGCTGG - Intronic
954527382 3:51284031-51284053 TCTGCTTCTCAGGCTGCTGGTGG - Intronic
954787006 3:53101219-53101241 TTTGCTTGTCAAGCCGCTGCAGG + Intronic
954861537 3:53694799-53694821 TATTCTGCTGAAGCTGCTGTTGG + Intronic
955119373 3:56041391-56041413 TCTGCTGATGAAGCTGCTGTAGG + Intronic
956329806 3:68093624-68093646 TATTCTTCTGCAGCTGCTCCAGG + Intronic
956465619 3:69517997-69518019 GATGCTGCTGCTGCTGCTGCTGG + Intronic
957446360 3:80316626-80316648 TTTGCTTCTTAAGGTGCTTCTGG - Intergenic
957564677 3:81868616-81868638 TTTGCTTCAGAAGATGCTTCAGG + Intergenic
958028930 3:88083423-88083445 TATGCTCTTGAAAGTGCTGCTGG + Intronic
958922409 3:100121877-100121899 TATGCTACTGGTTCTGCTGCTGG - Intronic
959291087 3:104475134-104475156 CATGCTGCTGCTGCTGCTGCTGG + Intergenic
959764676 3:110011436-110011458 TAAGCTTTTGAATGTGCTGCTGG - Intergenic
960146994 3:114214056-114214078 GATCCTGCTGAAGCTGGTGCTGG - Intergenic
960968549 3:123122859-123122881 TCTGCTTCTGTAACTACTGCTGG + Intronic
963001103 3:140682627-140682649 CGTGCTTCTGCAGCTGCCGCAGG - Exonic
963764957 3:149324883-149324905 TATGCTTTTGAAGGCACTGCTGG - Exonic
964715590 3:159718003-159718025 TAAGCTTTTGAATGTGCTGCTGG - Intronic
966885825 3:184377688-184377710 TAAGGTTCTGAATCTGGTGCTGG - Intronic
967638967 3:191838279-191838301 TAAGCTTCTGGATGTGCTGCTGG - Intergenic
969350890 4:6597264-6597286 GAAGCTGCTGGAGCTGCTGCAGG - Exonic
972290580 4:37686585-37686607 TACGCCGCTGAGGCTGCTGCGGG - Intergenic
973749252 4:53996677-53996699 TAAGTTTCTGAAACTGCTCCAGG + Intronic
973983852 4:56330853-56330875 GCTGCTTCTGCTGCTGCTGCTGG - Intergenic
974237253 4:59198165-59198187 TATCATTCAGAAGCTGCTGCAGG - Intergenic
978485635 4:109250747-109250769 TGTGTTTGTGAAGCTGCTTCTGG - Intronic
978664642 4:111167810-111167832 TAAGCTTTTGAATGTGCTGCTGG - Intergenic
978766091 4:112406524-112406546 CTTGCTTCTGAGGCTGCTTCTGG - Intronic
979632206 4:122916114-122916136 TTTGCTGCTGCTGCTGCTGCTGG - Intronic
981732047 4:147909839-147909861 TATGCATGTCAAGCTGTTGCTGG + Intronic
983927181 4:173414752-173414774 TGTGCTTCTGTGGCTGGTGCTGG + Intergenic
984004529 4:174293233-174293255 CATGCTGATGAGGCTGCTGCTGG + Intronic
985198998 4:187464581-187464603 TTTGCTTCTGAAACTGCCCCAGG + Intergenic
985816945 5:2134319-2134341 TGTGTTTCTGAAGCTTCTGAAGG - Intergenic
986746815 5:10752114-10752136 AAGTCTTCTGAAGCTCCTGCAGG + Intronic
987138363 5:14920649-14920671 TTTGCTTCTGAAGCTGCTTCTGG - Intergenic
989684438 5:44068756-44068778 TGTGGTTCTAAAGCTGCTGCTGG - Intergenic
991199342 5:63973301-63973323 TAAGCTTTTGAATGTGCTGCTGG - Intergenic
992213822 5:74506561-74506583 TCAGCTACTGAACCTGCTGCTGG - Intergenic
993468494 5:88277274-88277296 TCTGCTTCTGAGGCAGCTTCAGG - Intergenic
994190963 5:96868764-96868786 TATGCTGCTGATGCTGTTGGAGG + Intronic
994580242 5:101632486-101632508 CATGCTTCTGGAGAAGCTGCAGG - Intergenic
995052745 5:107724802-107724824 TCTGCTGCTGCTGCTGCTGCTGG - Intergenic
995059153 5:107795118-107795140 TTTGCCTCTGAAGCTGCTACAGG - Intergenic
995064076 5:107840781-107840803 TCTGCAGCTGAAGCTGATGCTGG + Intergenic
995760681 5:115558231-115558253 TCTTATTCTGAACCTGCTGCAGG - Intergenic
996591966 5:125158288-125158310 TATGCTTGTGAGCCTGCTGTGGG - Intergenic
998104086 5:139457292-139457314 TCGGCTTCAGAAGCTGCTTCTGG + Intronic
1000136291 5:158355041-158355063 TCTGCTTTTGAATCTGCTGAAGG + Intergenic
1005751585 6:28887692-28887714 TATGATTCTGAAGCTGTGGGAGG + Intergenic
1006981590 6:38152213-38152235 TCTGCTTCTCCCGCTGCTGCAGG + Exonic
1007379254 6:41476531-41476553 CATCTTTCTGAAGCAGCTGCAGG - Intergenic
1008034638 6:46733540-46733562 TGTGCACCAGAAGCTGCTGCTGG - Intronic
1009905369 6:69864538-69864560 CTTGCTTCTGAAGCTACTGCTGG - Intergenic
1011744269 6:90394312-90394334 AATGTTACTGATGCTGCTGCAGG + Intergenic
1012081606 6:94765108-94765130 TCAGAGTCTGAAGCTGCTGCAGG + Intergenic
1012517659 6:100081458-100081480 TAAGCATCTGAATCTGATGCTGG + Intergenic
1015631824 6:135238998-135239020 TATGAGTCTGAAGCTGCTGGTGG - Intergenic
1017488461 6:154923688-154923710 AATGCTGCTGGAGCAGCTGCAGG - Intronic
1019085698 6:169474219-169474241 TTTGCTTCTGTAGGTGCTCCAGG - Intronic
1019390806 7:785917-785939 GATGCTGCTGAAGTGGCTGCGGG - Exonic
1021121511 7:16800836-16800858 CATGCCTGTGAAGCTGGTGCTGG + Intronic
1021271018 7:18585495-18585517 TATGCTCCTGAAGCTGAGCCTGG - Exonic
1021407377 7:20287984-20288006 TATTTTTCTTTAGCTGCTGCTGG + Intergenic
1022490538 7:30814078-30814100 TCTGCTTCTGAACCTGACGCTGG - Intronic
1022568276 7:31425200-31425222 TATGGCTCTGAAGCTGCTCCAGG + Intergenic
1023865418 7:44235986-44236008 TCTGCTGCTGCTGCTGCTGCTGG - Intronic
1026661339 7:72305251-72305273 CATCCTTGTGAAGCTGGTGCAGG - Intronic
1026992406 7:74594599-74594621 TATGCTGCTGCTGCTGCTGGGGG - Intronic
1029258891 7:99287918-99287940 TGAGCTGCTGAAGCTGCGGCGGG + Intergenic
1029458396 7:100682403-100682425 GAAGCTGCTGAAGCTGCTGCAGG - Exonic
1030104816 7:105978248-105978270 TATGCTTCTGGTGCTGCTCCAGG - Intronic
1031023046 7:116649377-116649399 TAAGCTCCTGAATCTGTTGCTGG + Intergenic
1031176569 7:118359743-118359765 TTTGCTTCTGAGGCTGCTTTTGG + Intergenic
1031918423 7:127584417-127584439 TGAGCTCCAGAAGCTGCTGCAGG - Exonic
1033860784 7:145624056-145624078 TGTGCTTCTGAATCTGCTGATGG - Intergenic
1034412054 7:150946996-150947018 TCTGCCTCTGTAGCAGCTGCAGG + Exonic
1034908079 7:154968556-154968578 TCTGCTGCTGCTGCTGCTGCTGG + Exonic
1034908110 7:154968898-154968920 TCTGCTGCTGCTGCTGCTGCTGG + Exonic
1035470847 7:159107681-159107703 GCTGCTTCTGGAACTGCTGCAGG + Intronic
1035470861 7:159107735-159107757 ACTGCTTCTGGAGCTGCTGCAGG + Intronic
1037033631 8:14139958-14139980 TAAGCTTTTGGAGGTGCTGCTGG - Intronic
1037841510 8:22248519-22248541 TATGCCTGTGCAGCTGCCGCTGG + Exonic
1038054195 8:23842859-23842881 TGTGCTGCTGCTGCTGCTGCTGG + Exonic
1039422000 8:37450995-37451017 GCTGCTTCTGCTGCTGCTGCTGG - Intergenic
1039704125 8:39989843-39989865 GATGCTTCCGAAGCTCCTGAAGG + Intronic
1040510268 8:48087210-48087232 GGTCCTTCTGGAGCTGCTGCAGG + Intergenic
1041205583 8:55495253-55495275 GGTGCTTCTGAGCCTGCTGCAGG + Intronic
1043131809 8:76472184-76472206 CATGCTACTGCTGCTGCTGCTGG - Intergenic
1046164824 8:110418761-110418783 CATGATTCTGAACCTGCTCCTGG + Intergenic
1046611925 8:116435391-116435413 TCTGCTTCTGATGCTGCCTCTGG - Intergenic
1047249942 8:123174461-123174483 TATGATTTTCATGCTGCTGCAGG + Intergenic
1048233446 8:132666579-132666601 CCTGCTTCTGAAGCCGCAGCTGG - Intronic
1052268548 9:26602768-26602790 TATGCATTTGAATATGCTGCAGG - Intergenic
1052268701 9:26604173-26604195 TATGCTTATGAGGCTGTTTCTGG + Intergenic
1053051816 9:34967934-34967956 TATGATTCAGAACCTGTTGCTGG - Intronic
1053278181 9:36798936-36798958 GAGGTTTCTGAAGCTGCTGCTGG - Intergenic
1054818569 9:69499044-69499066 TATGCTTCTGAATAAGCTTCTGG + Intronic
1055056021 9:72024989-72025011 GATGCTGCTGCTGCTGCTGCTGG - Intergenic
1055733236 9:79300639-79300661 TCTTCTTCTGAAGATGCAGCAGG + Intergenic
1056082552 9:83110990-83111012 TATGCATCTGAATCTGCTGCTGG - Intergenic
1056256366 9:84803410-84803432 TCTGCTTCTGACGCTGCTGCAGG - Intronic
1056309050 9:85321305-85321327 AATGCCTGTGCAGCTGCTGCTGG + Intergenic
1057197124 9:93121410-93121432 TGTGCTTCTGACGCCCCTGCAGG + Intergenic
1057434961 9:95031730-95031752 TAAGCTCCCTAAGCTGCTGCTGG + Intronic
1057854791 9:98594010-98594032 TCTGCATCACAAGCTGCTGCAGG + Intronic
1058187761 9:101875472-101875494 TTTGCTTCTGCTGCTGCTGCAGG + Intergenic
1061780793 9:132995022-132995044 CATGCCTGAGAAGCTGCTGCAGG + Intergenic
1061888360 9:133604758-133604780 GATGCTGCTGCTGCTGCTGCTGG + Intergenic
1062164029 9:135096669-135096691 TGTCATTCTGCAGCTGCTGCAGG + Intronic
1062310206 9:135931345-135931367 TCTGCTCCTGCAGCGGCTGCTGG - Intergenic
1062412507 9:136432154-136432176 TCTGCTCCTGAGGCTGCTCCAGG - Intronic
1062476396 9:136729556-136729578 TCTCGTTCTGAAGCTGGTGCAGG + Intergenic
1062476483 9:136730108-136730130 TGTGCTGCTGGAGCTGTTGCTGG + Intergenic
1062578289 9:137218518-137218540 TGAGCTTCTGGGGCTGCTGCTGG + Intergenic
1186829947 X:13380006-13380028 TTTGCTTCTAAACCTGCTTCTGG + Intergenic
1187841943 X:23498101-23498123 TTTGCTTCTGAGACTGCTTCTGG - Intergenic
1187933002 X:24311278-24311300 TGGGCTGCTGGAGCTGCTGCAGG + Intergenic
1187939210 X:24364884-24364906 TGGGCTGCTGGAGCTGCTGCAGG - Intergenic
1188010706 X:25052772-25052794 TAACCTTCTGAAGCTTCTCCAGG - Intergenic
1189870929 X:45381933-45381955 CATGCTGCTGCAGCTGGTGCTGG - Intergenic
1191115060 X:56843774-56843796 TATAATCCTGAAGGTGCTGCAGG - Intergenic
1192260894 X:69505335-69505357 TCTGCTGCTGCTGCTGCTGCTGG + Exonic
1192435438 X:71140827-71140849 TCTGCTGCTGCTGCTGCTGCCGG - Exonic
1193250861 X:79289225-79289247 TGTGCTGCTGCTGCTGCTGCTGG + Intergenic
1193296803 X:79842927-79842949 TAAGCTTCTTAATATGCTGCTGG - Intergenic
1194041083 X:88942718-88942740 TTTGCTTCTGAAGCTATTTCTGG + Intergenic
1195352761 X:104010249-104010271 TATGCTTTTAATGCTGCTGTTGG - Intergenic
1196116641 X:112006070-112006092 TCTGCCTCTGCAGCTTCTGCTGG + Intronic
1196192701 X:112811201-112811223 TGTACTTCTGAAGCAGCTGCAGG - Intronic
1196934164 X:120713048-120713070 AATGCTTCTGGGGCTGTTGCTGG + Intergenic
1198157084 X:133971737-133971759 TATACCTCTGAAGCTACTGAGGG - Intronic
1198507945 X:137319758-137319780 TATGCTTTTGAAGATTCTTCTGG - Intergenic
1199477076 X:148257616-148257638 TATGCTTATGTAGATGTTGCAGG - Intergenic
1200281321 X:154779323-154779345 AGTCCTTCTGCAGCTGCTGCAGG + Exonic