ID: 1179050415

View in Genome Browser
Species Human (GRCh38)
Location 21:37884394-37884416
Sequence GCTGAGATGCAGAGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 1, 2: 5, 3: 69, 4: 596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179050415_1179050420 16 Left 1179050415 21:37884394-37884416 CCAGCTTCTCTCTGCATCTCAGC 0: 1
1: 1
2: 5
3: 69
4: 596
Right 1179050420 21:37884433-37884455 GTTTCCATCACAGCCTTCCAGGG 0: 1
1: 0
2: 1
3: 24
4: 267
1179050415_1179050419 15 Left 1179050415 21:37884394-37884416 CCAGCTTCTCTCTGCATCTCAGC 0: 1
1: 1
2: 5
3: 69
4: 596
Right 1179050419 21:37884432-37884454 TGTTTCCATCACAGCCTTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179050415 Original CRISPR GCTGAGATGCAGAGAGAAGC TGG (reversed) Intronic
900084072 1:878806-878828 GCTGAGCTGGAGAGATGAGCTGG - Intergenic
900285843 1:1899911-1899933 GGTGAGACGAAGGGAGAAGCTGG + Intergenic
900470315 1:2850761-2850783 GCTGAGTTGCAGTGAGGCGCAGG - Intergenic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900577955 1:3393728-3393750 GCGGAGGTGCAGACAAAAGCTGG - Intronic
901226701 1:7617274-7617296 GCTGAGCTGGAGAGAGAATGTGG - Intronic
902187656 1:14737421-14737443 GCAGATATACAGGGAGAAGCAGG + Intronic
902518995 1:17005237-17005259 GCTGAGGTCCAGAGAAGAGCGGG + Intronic
902742576 1:18449064-18449086 GCTGTGCCGCAGAGAGCAGCTGG + Intergenic
903306813 1:22418629-22418651 GCTTAGAGGCACAGAGCAGCAGG - Intergenic
903832388 1:26182987-26183009 GCTAAGAGCCAGAGGGAAGCTGG - Intronic
904262491 1:29297714-29297736 GCTGAGAGACAGAGAGAGGCAGG + Intronic
904334212 1:29786485-29786507 GCTGAGTTGCAGAGAAAATGCGG - Intergenic
904399546 1:30247216-30247238 GCCGAGATGCACTGAGGAGCGGG - Intergenic
904684394 1:32250109-32250131 CCTCAGCTGCAGAGAGAAGTGGG - Intergenic
904962485 1:34345212-34345234 GCTGAGATGCCAGGAGAAGACGG - Intergenic
904983556 1:34526350-34526372 GCTGAGATGAAGACAGAAAGAGG + Intergenic
905014873 1:34770924-34770946 GCTTAAATGCTGAGAGATGCAGG - Intronic
905309939 1:37042385-37042407 ACAGAGATGCAGGGAGAAGCGGG - Intergenic
905466713 1:38159929-38159951 GTAGAGATGGAGAGAGAAGTTGG + Intergenic
905892135 1:41524198-41524220 GCTGAGAGGTGCAGAGAAGCTGG + Intronic
906686226 1:47765174-47765196 ACTGAGATCCAGAGAGAACCAGG - Exonic
907919628 1:58900524-58900546 GATGAGATGCACAGAGAGGGAGG - Intergenic
909191143 1:72553619-72553641 GCCCAGATGTAGTGAGAAGCAGG + Intergenic
910420614 1:87057992-87058014 GCAGAAATAGAGAGAGAAGCAGG - Intronic
911942966 1:104070622-104070644 GCTTAGATGCAGAGGAAAACTGG + Intergenic
912274272 1:108240167-108240189 GCTGAAGTTCAGAGAGAGGCTGG - Intronic
912286995 1:108379695-108379717 GCTGAAGTTCAGAGAGAGGCTGG + Intronic
912293947 1:108454156-108454178 GCTGAAGTTCAGAGAGAGGCTGG + Intronic
912729310 1:112087972-112087994 GCTGAACTGCAAAGAGAAGTGGG - Intergenic
913090524 1:115473740-115473762 GGTGAGATCCAGAGAGAAGCAGG + Intergenic
913168128 1:116208328-116208350 GGGGAGAGGCGGAGAGAAGCCGG - Intergenic
913325099 1:117621251-117621273 GCCGAGAGGCAGAAAGCAGCGGG - Intronic
913355578 1:117917804-117917826 GCTGAAAGGAACAGAGAAGCTGG - Intronic
915269867 1:154746377-154746399 GGTGAGTTGGAGGGAGAAGCAGG + Intronic
915348001 1:155207864-155207886 GCTGAGAGGCATGGAGACGCAGG - Exonic
915457773 1:156052099-156052121 GCTGGGAGGCAGATAGCAGCAGG - Intronic
915528324 1:156489544-156489566 ACAAAGATTCAGAGAGAAGCAGG + Intronic
915918118 1:159953406-159953428 GCTGATATGCAGGGAATAGCTGG + Exonic
916962035 1:169898281-169898303 GCTGGGAGGCAGAGAGATGTAGG - Intergenic
917295356 1:173513241-173513263 CCAGAGATACAAAGAGAAGCTGG - Intronic
918073074 1:181147986-181148008 GGTGAGATGGAGAGCTAAGCAGG + Intergenic
918378892 1:183935317-183935339 ACTGAGATGCTCAGAGAAGTAGG - Intronic
918455158 1:184703969-184703991 GCAGAATTGCAAAGAGAAGCAGG + Intronic
919184596 1:194129488-194129510 GCGTAGATGCAGATAGCAGCTGG - Intergenic
920033484 1:203050954-203050976 GCTGAGTTGCAGGGAGAAAAGGG + Intronic
920560687 1:206936338-206936360 GCTGAGATCCAGAGAGAAGCAGG + Intronic
920650447 1:207833502-207833524 ACTGAGATGCTGAGATAAGCTGG + Intergenic
920693905 1:208167229-208167251 GCTGAGAGGAAGAGAGGAACAGG + Intronic
920832188 1:209475481-209475503 GGTGTGAAGCAGAGAGGAGCAGG - Intergenic
921118924 1:212119762-212119784 GCTGAGGTGCCCAGAGAGGCAGG + Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921655871 1:217736652-217736674 AGTGAGAGGGAGAGAGAAGCAGG + Intronic
922174111 1:223181690-223181712 TCTGAAAGGCAGAGAGAAGGAGG + Intergenic
922294588 1:224238465-224238487 GCTGGGAGGCAGTGAGACGCTGG - Intronic
922664095 1:227454233-227454255 GCAGACAGGCAGAGAGAAGCTGG + Intergenic
923339828 1:232997817-232997839 GGTGAGAATCAGTGAGAAGCAGG + Intronic
924708931 1:246518757-246518779 GCTCAGGTGCAGGGAGAGGCAGG - Intergenic
924737260 1:246769318-246769340 GCTGACATGCAGAAAAAATCAGG - Intergenic
1062763174 10:43130-43152 GCTGAGCTGGAGAGATGAGCTGG + Intergenic
1063124649 10:3127745-3127767 GCCGAGATGGGGAGAGAAACAGG - Intronic
1063348970 10:5337270-5337292 GATGAGATGCAGACAGAAAGGGG + Intergenic
1064928901 10:20602068-20602090 ACTGAGAGGCAGAGAAAAACTGG + Intergenic
1065045411 10:21743846-21743868 GATGAGACGGAGAGAGAAGAGGG + Intergenic
1065331207 10:24602420-24602442 GCTGAGAAGCAGCTAGAACCTGG + Intronic
1065829478 10:29601580-29601602 GCTCTGATGCAGAGAGAAACAGG + Intronic
1065842280 10:29712479-29712501 ACTGAAAGGCAGAGAGGAGCTGG - Intronic
1066019993 10:31288903-31288925 GGTGACATGTAAAGAGAAGCTGG + Intergenic
1066620025 10:37338447-37338469 GATCAGATGAAGAAAGAAGCAGG + Intronic
1067146795 10:43700222-43700244 GCAGAGATGCAGACAGCAGCAGG - Intergenic
1067918999 10:50433866-50433888 GGAGAGATGGAGAGAGAAGGTGG - Intronic
1068491969 10:57735770-57735792 GTTGAGAGGAAGAGAGGAGCAGG + Intergenic
1069736266 10:70656726-70656748 GCTGGGATGCAGAGAGCGGAAGG + Intergenic
1070366800 10:75744606-75744628 CCTGAGATGGAGACAGAAGGAGG + Intronic
1072223564 10:93347862-93347884 GCTGTGTGGCAGAGAGAATCTGG - Intronic
1072756519 10:98025096-98025118 ACTGAGATCCAGAGAGGAGAGGG - Intronic
1073036069 10:100565021-100565043 GCTGAGTTCCAGAGGGAAGGGGG + Intergenic
1073229670 10:101958534-101958556 TCTGAGATGGGCAGAGAAGCAGG - Intronic
1073381127 10:103078852-103078874 GCTGAGGAGCAGACAGCAGCGGG + Exonic
1073442361 10:103559629-103559651 GCTGAGATGCAGACAGATGAAGG - Intronic
1073578097 10:104641622-104641644 GGTGAGATGCAGGTGGAAGCCGG + Exonic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1074022612 10:109599401-109599423 CCAGAGATACAAAGAGAAGCTGG + Intergenic
1074038084 10:109761308-109761330 GATGAGATGCATAGAGATGGGGG + Intergenic
1074736278 10:116437407-116437429 GCTCACAAGCAGAGATAAGCAGG + Intronic
1074899558 10:117804406-117804428 GCAGGGGTGCAGAGAGAAGAGGG + Intergenic
1075212341 10:120501957-120501979 GCAGAGGGGCAGAGAGCAGCTGG + Intronic
1075447108 10:122520828-122520850 GGTGAGAGGAAGAGAGAGGCAGG - Intergenic
1075655675 10:124159523-124159545 GCTGAGAGGGAGTGAGAATCAGG + Intergenic
1075970561 10:126648740-126648762 GGAGGGATGCAGAGAGAAACTGG + Intronic
1076509681 10:131003906-131003928 ACGGGGCTGCAGAGAGAAGCAGG - Intergenic
1076539944 10:131207491-131207513 GGAGAGCTGCAGGGAGAAGCCGG - Intronic
1076590374 10:131578314-131578336 CCAGGGATGCAGAGAGAAGCGGG + Intergenic
1076948222 10:133665732-133665754 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076949211 10:133669042-133669064 GCAGAGATGGAGAGAGGAACGGG + Intronic
1076950195 10:133672341-133672363 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076951180 10:133675640-133675662 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076952170 10:133678950-133678972 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076953158 10:133682260-133682282 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076955126 10:133741911-133741933 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076956116 10:133745221-133745243 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076957104 10:133748530-133748552 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076958093 10:133751840-133751862 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076959077 10:133755139-133755161 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1076960066 10:133758449-133758471 GCAGAGATGGAGAGAGGAACGGG + Intergenic
1077326858 11:1967703-1967725 GCTGAGATGGGAAGAGCAGCTGG - Intronic
1077374013 11:2197237-2197259 ACAGAGATGCAGAGAGATGGAGG - Intergenic
1077873298 11:6281455-6281477 GCTGAAATGCAGGGAGCAGCCGG + Intergenic
1078095489 11:8293873-8293895 GCTGCTATGGAGAGAGGAGCGGG - Intergenic
1080418460 11:32090948-32090970 GCTGAGCTGCCGGGGGAAGCCGG - Exonic
1080455147 11:32412004-32412026 CCTGAGATGCAAAGTGAAGGTGG - Intronic
1080752740 11:35165830-35165852 GCTGACATGCTGAGATAAGCCGG - Intronic
1081548735 11:44092830-44092852 GCAGAGGTGGAAAGAGAAGCTGG + Intergenic
1081633573 11:44705575-44705597 ACTGTGATGAAAAGAGAAGCGGG - Intergenic
1081660078 11:44882702-44882724 TCTGAGATGGAGAGAGACGGAGG + Intronic
1082129073 11:48465515-48465537 GCTGAGATCCAGTAAGGAGCTGG + Intergenic
1082248339 11:49951876-49951898 GCTGAGATCCAGTAAGGAGCTGG - Intergenic
1082562610 11:54636484-54636506 GCTGAGATCCAGTAAGGAGCTGG + Intergenic
1083103255 11:60332481-60332503 GCTGAGATGCAGATGGGACCTGG - Intergenic
1083103357 11:60333606-60333628 GCTGAGATGCAGATGGGACCTGG + Intergenic
1083334558 11:61915113-61915135 GATGAGGGGCAGTGAGAAGCTGG - Intronic
1083571611 11:63764513-63764535 GCTGAGATCCTGAGAGGAGGGGG + Exonic
1084000578 11:66293391-66293413 GGTGCCATGGAGAGAGAAGCAGG - Intronic
1084214912 11:67641932-67641954 GCAGAGATGCAGGGAGGAGGTGG - Intergenic
1084359899 11:68662447-68662469 GCTGAGATCCAGAGGGAAGTGGG + Intergenic
1084472334 11:69370273-69370295 GGTGATGTGGAGAGAGAAGCAGG + Intergenic
1084484396 11:69439357-69439379 GCTCAGATGCAGGGAGGTGCAGG - Intergenic
1084700691 11:70784725-70784747 GCTGAGGTCCAGGGAGATGCTGG + Intronic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085025318 11:73233074-73233096 GACGATATGCAGAGAGAAACTGG + Intronic
1085389749 11:76176359-76176381 GCTTGGGTGCAGAGAGGAGCAGG + Intergenic
1085390160 11:76178172-76178194 TCTGGGATGTTGAGAGAAGCAGG - Intergenic
1085400372 11:76232425-76232447 GCTGTGATGCAGAGAGGAGAGGG - Intergenic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085523914 11:77153515-77153537 GCTGAGACGCTGTGAGAAGCTGG - Intronic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1086452032 11:86926633-86926655 TAAGAGATGCATAGAGAAGCAGG - Intronic
1086855751 11:91863336-91863358 ACAAAGATGCAGAGAGAAACAGG - Intergenic
1086945883 11:92843674-92843696 GCTGGGGTGAAGAGAGAAGGAGG - Intronic
1087002049 11:93431147-93431169 GCTGTGATGAAAAGAAAAGCAGG + Intronic
1088162274 11:106886942-106886964 GCAGAGATGCAGGGTGAGGCTGG - Intronic
1088503821 11:110510061-110510083 TTTGAGATGCAAAGAGAAGATGG - Intergenic
1088986939 11:114917581-114917603 GCTGAGCAGCAGAGAGCAGGGGG - Intergenic
1089296824 11:117474341-117474363 GCACAGAGACAGAGAGAAGCTGG - Intronic
1089346305 11:117793924-117793946 GCTGAGTGGCAGAGAGACCCCGG - Intronic
1089492529 11:118892805-118892827 GCCCAGAGGCAGAGAGAGGCAGG - Intronic
1090072631 11:123557581-123557603 TGTCAGATGCAGTGAGAAGCAGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1202809839 11_KI270721v1_random:22883-22905 GCTGAGATGGGAAGAGCAGCTGG - Intergenic
1091601021 12:1917863-1917885 GCTGCGATGCTGAGATAACCCGG + Intronic
1091788411 12:3256941-3256963 GCTTAGATCCAGGGAGAACCTGG + Intronic
1092041047 12:5384672-5384694 CATGGGATACAGAGAGAAGCAGG - Intergenic
1092126297 12:6077325-6077347 CCTAAGGTGCAGAGAGAACCCGG - Intronic
1092288099 12:7141503-7141525 GCACAGCTGCAGAGAGATGCAGG - Intronic
1093997986 12:25663021-25663043 CCAGAGGTACAGAGAGAAGCTGG - Intergenic
1094813061 12:34160901-34160923 GCTGAGCTGGAGAGATGAGCTGG + Intergenic
1096226408 12:49869324-49869346 GGAGAGATGCAGAGATAAGTGGG + Exonic
1096685146 12:53283422-53283444 GCTGAGCTGCTCAGAGAAGCTGG + Exonic
1096808398 12:54154529-54154551 ACTGGGAAGCAGAGAGAAGGTGG - Intergenic
1096879771 12:54658282-54658304 GCTGAGTGGCTGAGAGAACCTGG + Intergenic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1097903636 12:64898109-64898131 GCTGCAAGGCACAGAGAAGCTGG - Intergenic
1098041037 12:66354227-66354249 CCTTAGATGCAGAGAGACCCGGG - Intronic
1098234526 12:68406100-68406122 GGGGAAATGCAGAGAGAGGCAGG - Intergenic
1098304631 12:69090248-69090270 GGAGAGATGCAGAGACAAGATGG + Intergenic
1099331515 12:81294929-81294951 ACTGAGATCCAGAGAGAAATTGG - Exonic
1100085763 12:90908431-90908453 GCTGACGTGCAGAGAAAAGCAGG - Intronic
1100777706 12:97990641-97990663 GCTGAAATGCAGTTTGAAGCAGG - Intergenic
1101821970 12:108191373-108191395 ACAGAGATGGAGAGAGAGGCAGG + Intronic
1101835862 12:108295071-108295093 ACTGGAATGCAGAGAGAAGATGG + Intronic
1102131154 12:110529804-110529826 GCTGGGATGCAGAGATAGGGAGG + Intronic
1102831078 12:116000398-116000420 GCTGAAGTGCAGAGATAGGCAGG - Intronic
1103173754 12:118844181-118844203 GGTGAGAAGGAGAGAAAAGCTGG + Intergenic
1103443746 12:120980806-120980828 GGGGAGATGGACAGAGAAGCTGG + Intronic
1103741688 12:123095668-123095690 GCTGAGCTGCAGGGAGGACCAGG - Intronic
1103855480 12:123966509-123966531 GCTGAACTGCAGAGTGAACCTGG - Intronic
1104053793 12:125214277-125214299 GCTGAGAGACAGAGGGAGGCTGG - Intronic
1104079056 12:125414553-125414575 TCTGGGAAGCAGAGAGGAGCTGG + Intronic
1104349061 12:128029142-128029164 GCTGAGATGGAGCGGGAAGGAGG + Intergenic
1104416111 12:128597862-128597884 GCAAACATGCAGAGAGTAGCTGG + Intronic
1104467747 12:129004553-129004575 GCGGGGATGCAGAGAGACGTGGG + Intergenic
1104690931 12:130825998-130826020 GCTGAGCTGGGGAGATAAGCAGG + Intronic
1104763131 12:131309986-131310008 GCTGGGCTGCTGACAGAAGCTGG + Intergenic
1104778795 12:131406471-131406493 GCTGAGATGCACTAAGATGCAGG + Intergenic
1104950621 12:132438252-132438274 GCAGAGCTCCAGAGAGAAGCTGG - Intergenic
1105256025 13:18744544-18744566 GCTGGGGTGCAGGGAGAGGCAGG + Intergenic
1106183495 13:27387872-27387894 ACAGAGATGCAGAGAGGAACAGG + Intergenic
1106920835 13:34561681-34561703 GCTGAGAAGGAACGAGAAGCAGG + Intergenic
1107069724 13:36256796-36256818 GATGACATGCAGTGAGAAGAAGG - Intronic
1107396676 13:40025251-40025273 GCTGATATCCAGAGAGAAGTGGG + Intergenic
1107602451 13:42027524-42027546 GCTGTGATGCAGGGAGTACCAGG - Intergenic
1107726307 13:43303337-43303359 GCAGAGAAGCAGATAGAAGCTGG - Intronic
1108180239 13:47833545-47833567 GCTGGTGTGCAGAGAGAAACAGG - Intergenic
1108868926 13:54958567-54958589 ACAGAGATGCAGAGAGCAGCAGG + Intergenic
1109122002 13:58469562-58469584 GCTGATGTGCAGAGACCAGCTGG + Intergenic
1110322046 13:74171546-74171568 GCTGAGCTGCAGGGAGAACCGGG - Intergenic
1110619140 13:77576091-77576113 GCTGAGATGGAAAGAGAGGAAGG - Intronic
1110634414 13:77749611-77749633 GCTGAGATGCAGCAGGAAACTGG - Intronic
1111334030 13:86798182-86798204 TCTGAAATTCAGAGAGAAACTGG - Intergenic
1112069130 13:95828732-95828754 CCAGAGGTGCAAAGAGAAGCTGG + Intronic
1112520565 13:100091086-100091108 GCTCTGATGCAGAGAGTAGATGG + Intronic
1113029595 13:105978416-105978438 GCTGAGATTCAGAGACAGGAGGG - Intergenic
1113295485 13:108954990-108955012 GCTGCGGAGCAGAGAGCAGCAGG - Intronic
1113767538 13:112890488-112890510 GCTGAGAAGCAGAGACAGACAGG - Intergenic
1114270323 14:21097174-21097196 GGTGAGCTGCAGAGTGGAGCGGG - Intronic
1115184253 14:30666968-30666990 CCAGAGATACAAAGAGAAGCTGG + Intronic
1115438637 14:33406344-33406366 ACTAAGAAGCAGAGAGATGCAGG + Intronic
1115457667 14:33623449-33623471 GCTGAGAAGCAGTGAGACTCTGG - Intronic
1115496208 14:34007280-34007302 GCTGAGATGTAAAGATATGCAGG + Intronic
1117305726 14:54471395-54471417 GCAGGCATGCAGAGAGTAGCTGG - Intergenic
1117410845 14:55449608-55449630 ACTGAGACACAGAGAGAAGAAGG + Intronic
1117782167 14:59244436-59244458 GCTGAGATGGCTTGAGAAGCCGG + Intronic
1117998771 14:61503602-61503624 GCTGAAATGCCGAGAAATGCTGG - Intronic
1118238225 14:64031258-64031280 TCTGCCAGGCAGAGAGAAGCAGG + Exonic
1118246320 14:64114579-64114601 GCCGAGATGCACAGAAAAGGAGG - Intronic
1118907879 14:70036028-70036050 ACTGAGAAGGAGAGAGAATCAGG - Intergenic
1119235766 14:73017967-73017989 GAAGAGGTGCAGAGGGAAGCAGG - Intronic
1119618651 14:76115071-76115093 GCAGAGATGCAGAGAGATGTCGG + Intergenic
1119878961 14:78085045-78085067 GCTGAGATGCAGAGAGAGTAAGG - Intergenic
1119887152 14:78152655-78152677 GCTGAGAGGCAGGAAGAAGGAGG - Intergenic
1120559333 14:85971616-85971638 CCAGAGGTGCAAAGAGAAGCTGG - Intergenic
1121229127 14:92343473-92343495 TCTGGGAGGCAGAGAGAAGCTGG - Intronic
1122631868 14:103111004-103111026 GCAGCTTTGCAGAGAGAAGCGGG - Intergenic
1123051711 14:105547229-105547251 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123077125 14:105672932-105672954 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1124080191 15:26486981-26487003 GCTGAGGTGCAGCGAGAAGATGG + Intergenic
1125530698 15:40411653-40411675 GCTGTGATGCCCCGAGAAGCTGG - Exonic
1126725989 15:51632963-51632985 GCTGTGCTGCAGAGAGAAGCAGG + Intergenic
1126750615 15:51873136-51873158 GATGAGATGAAGAGAGAGGAAGG - Intronic
1127400849 15:58584490-58584512 TCTGAGATGAAGAGAGAGACTGG - Intergenic
1127956607 15:63859298-63859320 GCAGAGAAGAAGACAGAAGCAGG - Intergenic
1127958207 15:63871326-63871348 TCTGAGCTGGATAGAGAAGCAGG + Intergenic
1128043633 15:64597404-64597426 GCTGAGAAGGAGGGAGAAGGAGG - Intronic
1128458245 15:67845323-67845345 ACTGAGAGCTAGAGAGAAGCTGG - Intergenic
1128949778 15:71865641-71865663 GCTCAGAGGAAGAGAGAAGAGGG + Intronic
1129155510 15:73714846-73714868 GCTGAGACCCAGTAAGAAGCTGG + Intergenic
1129185297 15:73902467-73902489 GCTGAGAGGCAGAGAAAAGAGGG - Intergenic
1130912929 15:88283360-88283382 ACTGAGGTCCTGAGAGAAGCTGG - Intergenic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131158264 15:90088300-90088322 ACAGAGATGAAGAGACAAGCTGG + Intronic
1131425636 15:92343567-92343589 GCTGAAATACACAGGGAAGCAGG + Intergenic
1131442249 15:92467830-92467852 GCTGGGTTGCAGAGAGGAGCTGG - Exonic
1132011364 15:98279477-98279499 TCTGATCTGCAGAGAGAAGGTGG + Intergenic
1132416606 15:101624784-101624806 ACTGAGAGGCAGAGAAAAGAAGG + Intronic
1132515387 16:363576-363598 GCTCAGGTGCACAGAGCAGCAGG - Intergenic
1132703807 16:1232596-1232618 CCGGAGATGCAGAGAGACGTGGG + Intergenic
1132707711 16:1253799-1253821 CCGGAGATGCAGAGAGACGTGGG - Intergenic
1133100408 16:3475932-3475954 GCTCAGATGGGGAGAGAGGCTGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133683165 16:8139844-8139866 GCTGAAATGCAAATCGAAGCTGG - Intergenic
1134322578 16:13177038-13177060 AATGAAATGCAGAGAGAATCAGG - Intronic
1134610601 16:15605329-15605351 TCTGAGAGGCAGAGAGAGGTGGG + Intronic
1136141344 16:28290939-28290961 GATGATATTCAAAGAGAAGCAGG - Intergenic
1136453720 16:30369290-30369312 GCTCAGATTCAGAGATAAACGGG - Exonic
1136508359 16:30720899-30720921 GCCGAGATGCAGGAATAAGCGGG - Exonic
1137503735 16:49032250-49032272 CCAGAGATACAGAGAGGAGCTGG + Intergenic
1137891107 16:52162795-52162817 GCTGTTATTCAGAGAGAAGCAGG - Intergenic
1138031334 16:53561862-53561884 GCTGAGGTGGGGAGAGAAGCAGG - Intergenic
1138095670 16:54209481-54209503 GGTGAGATGGAGAGAGAGGCTGG + Intergenic
1139133357 16:64172658-64172680 GCAGAGAGACAGAGAGAGGCAGG + Intergenic
1139470796 16:67177193-67177215 GCTGGGCTGGAGAGAGAAGTGGG - Intronic
1139586969 16:67910224-67910246 GCAGAGAAGCAGAGAGATGCAGG + Intronic
1139777873 16:69328436-69328458 GCTGAGATCCCTAGAGCAGCTGG - Exonic
1139877510 16:70157944-70157966 GCTGAGTTCCAGAGAGCTGCCGG + Exonic
1140256838 16:73344952-73344974 GGGGAGCTGCAGAGAGAACCTGG + Intergenic
1140312097 16:73859406-73859428 GCTGATAGGCAGAGAGAGACAGG - Intergenic
1141884424 16:86881995-86882017 TCTGCTGTGCAGAGAGAAGCTGG - Intergenic
1142187714 16:88702304-88702326 GCTGAGCTGCGGCGAGGAGCTGG + Intronic
1142313345 16:89326937-89326959 GCGGAGACGCAGAGAAAAGCAGG + Intronic
1142561115 17:809517-809539 CCTGGGAGGCAGAGAGGAGCGGG + Intronic
1142856729 17:2734837-2734859 GGTGAGATGGACAGAGAAGTTGG - Intergenic
1143204302 17:5131861-5131883 GCTCAGATGCAGGGAGAGGCAGG + Intronic
1143291927 17:5837968-5837990 GCTGAGAAGCAGAGAGACCCAGG + Intronic
1143324086 17:6087197-6087219 CCAGAGATGCACAGAGAAGTTGG - Intronic
1143735728 17:8910955-8910977 GCAGAGCTGCAGAGAGCAGGAGG - Intronic
1144126874 17:12211026-12211048 TCTGAGAAGCAGAGAGAAAATGG + Intergenic
1144639755 17:16930906-16930928 GCCGGGATGCAGGGAGAGGCAGG - Intronic
1144810104 17:17993603-17993625 GCTGAGCTCCAGAGGGAACCAGG + Intronic
1144875370 17:18394551-18394573 GCTCAGATGCAGGGAGAGGCAGG + Intergenic
1145065660 17:19759759-19759781 GCAGATGTGCAGAGACAAGCAGG - Intergenic
1145156855 17:20549870-20549892 GCTCAGATGCAGGGAGAGGCAGG - Intergenic
1146160040 17:30554849-30554871 GCTCAGGTGCAGGGAGAGGCAGG + Intergenic
1146547536 17:33751862-33751884 GCTGAGAGGCAGCGGGAGGCTGG + Intronic
1146668924 17:34723464-34723486 ACTGAGGTGCAGAGAAGAGCAGG + Intergenic
1146798294 17:35798430-35798452 GCTGGGATGCAGAGAGAGTCAGG - Intronic
1147045321 17:37746941-37746963 GCTGAGAGCCAGAAGGAAGCGGG + Intergenic
1147587999 17:41663939-41663961 GCAGAGCTGGAGAGAGAAGGGGG + Intergenic
1148563485 17:48619676-48619698 AGTGCGAGGCAGAGAGAAGCCGG - Intronic
1148787431 17:50152161-50152183 CCTGAGATGCAGGAAGCAGCTGG - Intergenic
1148996485 17:51714702-51714724 GCTCAGATGGAGAGAGAAGAAGG + Intronic
1151373213 17:73663652-73663674 TCTGAGATACAGAGCAAAGCAGG - Intergenic
1151882309 17:76903095-76903117 GTTCAGATGCAGTGAGGAGCTGG - Intronic
1151887751 17:76933130-76933152 GATTAGAGGCAGAGAGAAGCAGG + Intronic
1152012413 17:77726709-77726731 TTTGAGGTGCAGAGTGAAGCTGG - Intergenic
1152956083 18:43461-43483 GCTGAGCTGGAGAGATGAGCTGG + Intergenic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1153519454 18:5938134-5938156 ACTGAGATGGAGCGAGGAGCAGG + Intergenic
1153597359 18:6741371-6741393 GCTGAGTTGCAGAAAGCTGCAGG + Intronic
1153942755 18:9991701-9991723 GCTGAGAAGGGAAGAGAAGCCGG - Intergenic
1155165892 18:23232213-23232235 GCTGAAATTAAGAGAGAAGTAGG - Intronic
1155264429 18:24077132-24077154 GCTTGGAGGCAGAGTGAAGCAGG - Intronic
1157185646 18:45538174-45538196 GCTGACATGGAGATAGAGGCAGG - Intronic
1157189283 18:45567296-45567318 GCTGAGATAGACAGAGACGCTGG + Intronic
1157190893 18:45580769-45580791 GCTGAGATTCAGACTGAGGCTGG + Intronic
1157787093 18:50493720-50493742 GCTGGGATGGGCAGAGAAGCTGG + Intergenic
1158878724 18:61755830-61755852 GCAGAGCTGCAGAGGTAAGCTGG + Intergenic
1159158594 18:64614820-64614842 GTTGTAATGCAGATAGAAGCTGG - Intergenic
1159753546 18:72333862-72333884 GCAGAGAAGTAGAGAGCAGCAGG + Intergenic
1160299589 18:77668196-77668218 GCTGAGACCCAGGGAGAAGGAGG - Intergenic
1160569491 18:79807148-79807170 CCTGAGGTGCAGACAGATGCAGG - Intergenic
1160690521 19:459013-459035 ACTCAGATGCACAGAGGAGCGGG - Intronic
1160722196 19:602653-602675 GCAGAGGAGCAGAGAGGAGCCGG - Intronic
1161227867 19:3155609-3155631 CCTGAGATCCAGGGAGGAGCGGG - Intronic
1161242020 19:3227987-3228009 GCTGAGACTCAGAGAAAGGCAGG + Intronic
1161569566 19:5023137-5023159 GGTGAGAGTCAGAGAGAGGCTGG + Intronic
1161599296 19:5171092-5171114 GCTAACATGCACAGAGAAGCCGG - Intronic
1162725013 19:12684991-12685013 GCTGAGATGCAGAAAGATCAGGG - Intergenic
1162764374 19:12909490-12909512 GCAGAGGGACAGAGAGAAGCTGG - Intronic
1163200953 19:15768674-15768696 GCAAAGATGCAGAAAGAAGCAGG - Intergenic
1163430340 19:17263514-17263536 GCTGAGAAACAGAGTGAAGTTGG + Intronic
1164760136 19:30722465-30722487 ACTGAAGTGCAGAGAGAAGGAGG - Intergenic
1164998285 19:32739669-32739691 CAGGAGATGCAGAGAGCAGCAGG - Intronic
1165060237 19:33201560-33201582 GCTGAGAACCAGAGAGAACTTGG + Intronic
1165391522 19:35541928-35541950 GCTGGGAAGCAGAAAGCAGCCGG + Intronic
1165420287 19:35718814-35718836 CCTGAGATGCCAAGAGAAACTGG - Intronic
1165487951 19:36106725-36106747 GCTGAGGTGCAAGGAGGAGCAGG + Intergenic
1165741954 19:38210047-38210069 GCAGAGATGGGGAGAGACGCGGG - Intergenic
1166224905 19:41388879-41388901 GCTGATGTGCAGAGAAAGGCAGG + Intronic
1166329093 19:42068567-42068589 GCTCAGAGGCAGAGAGAGGGAGG + Intronic
1166340717 19:42135060-42135082 GCAGACATTCAGAGAGAGGCTGG - Intronic
1167269832 19:48500535-48500557 GCAGAGATCCAGGGAGAAGAGGG + Intronic
1167609050 19:50497453-50497475 GGAGAGAGGCAGAGAGAAGTGGG + Intergenic
1167644964 19:50700557-50700579 GCTGTGATTCTGAGAGTAGCAGG + Intronic
1167698164 19:51026791-51026813 GCTGAGACACAGGGAGAAGAGGG - Intronic
1167909354 19:52689585-52689607 GCAGAAATGTAGAGAAAAGCTGG - Intronic
1167999452 19:53432829-53432851 GCAGAAATGTAGAGAAAAGCTGG + Intronic
1168689240 19:58366920-58366942 GATGAAATGCAGGGAGAAACTGG + Intergenic
925036565 2:691976-691998 ACTGAGCTGGAGAGAGATGCGGG - Intergenic
925139583 2:1540654-1540676 GCTGAGATGCGGAAAGCACCAGG + Exonic
925882072 2:8361225-8361247 GCAGAGCTGGAGAGTGAAGCAGG - Intergenic
927178026 2:20424050-20424072 ACTGACTTGCAGAGAGATGCAGG + Intergenic
927209815 2:20632198-20632220 GCAAAGATGCAAAGAGAGGCAGG - Intronic
928296704 2:30090047-30090069 GCTGAGCTGAATGGAGAAGCTGG - Intergenic
928314086 2:30232466-30232488 GGAGGGATGCAGAGAGAGGCAGG + Intronic
928365257 2:30695615-30695637 GCTGAGTTACAGACAGATGCTGG + Intergenic
929766535 2:44848390-44848412 GATGAGATGCAGCAAGAATCTGG + Intergenic
929788412 2:45007808-45007830 GCTGAGAGGCACAGAGGGGCTGG - Intronic
930318941 2:49830299-49830321 GCTGAGATGGACAGCAAAGCCGG - Intergenic
931040082 2:58287595-58287617 ACTGAGCCCCAGAGAGAAGCTGG - Intergenic
931120774 2:59216995-59217017 GCTAAGGTACAAAGAGAAGCTGG + Intergenic
931141425 2:59462606-59462628 CCTGAAATTCAGAGAGGAGCCGG - Intergenic
931431417 2:62211815-62211837 TCAGAAATGTAGAGAGAAGCAGG - Intronic
931707443 2:64958821-64958843 GTTGAAATGAAGAGAGAACCAGG + Intergenic
932037074 2:68256225-68256247 CCTGAGATGCCAAGAGAAGTGGG + Intronic
933164929 2:79065420-79065442 ACTGAGATCCAGAGAGTGGCTGG - Intergenic
933710275 2:85320155-85320177 GTTGGGATGCAGAGAAAAACAGG + Intronic
933813545 2:86048266-86048288 GCAGAAAGGCAGAGAAAAGCAGG + Intronic
935332174 2:101985336-101985358 GGAGACGTGCAGAGAGAAGCAGG - Intergenic
935486634 2:103664029-103664051 TCTGAGATGAACAGAGAAGTGGG + Intergenic
935638422 2:105268589-105268611 GCTGGGAAGCAGAGAGAGGTGGG + Intronic
936046539 2:109192599-109192621 TATGAGATAAAGAGAGAAGCTGG + Intronic
936372864 2:111917545-111917567 TCTGAAAGGTAGAGAGAAGCAGG - Intronic
937020942 2:118654437-118654459 GGCGATATGCTGAGAGAAGCAGG + Intergenic
937047547 2:118859613-118859635 GCAGGTGTGCAGAGAGAAGCGGG + Intergenic
937341027 2:121090617-121090639 GGGGAGAGGCAGAGAGAAGGGGG + Intergenic
937740841 2:125351335-125351357 ACTGAGAAGCATAGAGAAGAGGG + Intergenic
937939744 2:127275807-127275829 GCTGAAAAGCAGACAGATGCAGG + Intronic
938278952 2:130051325-130051347 GCTGGGGTGCAGGGAGAGGCAGG + Intergenic
938312995 2:130306508-130306530 GCTGAAATACAGTGAGAAACTGG + Intergenic
938329934 2:130442200-130442222 GCTGGGGTGCAGGGAGAGGCAGG + Intergenic
938360011 2:130679303-130679325 GCTGGGGTGCAGGGAGAGGCAGG - Intergenic
938436419 2:131286024-131286046 GCTGGGGTGCAGGGAGAGGCAGG - Intronic
939429374 2:142083227-142083249 AGTGAGATGAAGAGAGAAGATGG - Intronic
944975137 2:205041485-205041507 GCAGAAATGGAGAGAGAACCTGG - Intronic
945921809 2:215762557-215762579 GCAGAAATGCCGAGAGAAGGTGG - Intergenic
946195885 2:218032965-218032987 GCTGTGATGGAGGGAGGAGCCGG - Intergenic
946339674 2:219059409-219059431 GCTGAGATGCCGAGGGAGGCAGG - Intronic
946347670 2:219124273-219124295 GCTGGGAAGCAGAGGAAAGCGGG + Intronic
946747343 2:222859786-222859808 GCAGCTCTGCAGAGAGAAGCAGG - Intergenic
947391345 2:229642739-229642761 GGTGTGATGTAGAGAGAAGCTGG - Intronic
947746664 2:232511510-232511532 GCAGTGATGCAGAGCCAAGCTGG + Intergenic
947919095 2:233854235-233854257 GCTTGGATGCGGAGAGAAGGTGG - Intronic
947981996 2:234418535-234418557 AATGAGATGAAGAAAGAAGCAGG - Intergenic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948234636 2:236379191-236379213 GCTGGGACACAGGGAGAAGCAGG + Intronic
948608009 2:239148146-239148168 GCAGAACTGCAGAGAGAAGGAGG + Intronic
1168811470 20:707442-707464 ACTGAGACTCAGAGAGGAGCAGG + Intergenic
1169268957 20:4184679-4184701 GCTCAGATGGAGAGAGAAAAGGG + Intronic
1169451229 20:5713377-5713399 TCTGCCATGCAGAGAGAAGGTGG + Intergenic
1169669727 20:8083323-8083345 GCTCACAGGCAGAGAGCAGCAGG - Intergenic
1169675206 20:8145224-8145246 GTGAAGATGCAGGGAGAAGCAGG - Intronic
1169730779 20:8783686-8783708 ACTAATATGCAGAGAAAAGCAGG - Intronic
1171014607 20:21528865-21528887 GTAGAGATACAGAGAGAAGATGG - Intergenic
1171041814 20:21771105-21771127 TCTGAGTTGGAAAGAGAAGCTGG + Intergenic
1171882787 20:30630809-30630831 GCTGGGGTGCAGGGAGAGGCAGG + Intergenic
1172245275 20:33441768-33441790 ACTGAGACTCAGAGAGGAGCAGG - Intronic
1172619135 20:36307782-36307804 GCTCAGAGGCAGAGAGAGCCAGG - Intronic
1173075024 20:39810129-39810151 TGTGGGATGCAGAGAGAAGGTGG + Intergenic
1174039518 20:47688981-47689003 GGTCTGAGGCAGAGAGAAGCAGG + Intronic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1174859698 20:54079238-54079260 TCTGAGGTTCAGAGAGAAGTAGG - Intergenic
1175153336 20:56952811-56952833 GCTGAGACGTAGTGAGAATCTGG + Intergenic
1175179166 20:57132839-57132861 GGAGAGCTTCAGAGAGAAGCGGG + Intergenic
1175222437 20:57425220-57425242 GCAGGGAAGCAGTGAGAAGCTGG + Intergenic
1175227076 20:57450963-57450985 GCTGAGGTGCTGGGAGCAGCAGG + Intergenic
1175717912 20:61267765-61267787 GGAGGGATGCAGAGAGGAGCTGG + Intronic
1175964660 20:62654503-62654525 GCAGAGATGCACGGAGATGCAGG - Intronic
1176521691 21:7829522-7829544 TCTGAGATGCCGAGAGAGCCGGG + Intronic
1177072096 21:16523182-16523204 GATGGGATTGAGAGAGAAGCAGG - Intergenic
1177144766 21:17395540-17395562 GCTGGAATGCAGTGAGTAGCTGG + Intergenic
1177891463 21:26808928-26808950 TCTGAAATGCTGAGAGAAACTGG + Intergenic
1178328773 21:31667571-31667593 GCTAAGATGCAGTAAAAAGCAGG + Intronic
1178655711 21:34459534-34459556 TCTGAGATGCCGAGAGAGCCGGG + Intergenic
1178824162 21:36001633-36001655 GCGAAGATGCAGCGAGAAGGTGG - Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179317244 21:40254687-40254709 GCTGGGATGCAGATGCAAGCAGG - Intronic
1179520332 21:41939544-41939566 GCTGAGGTGCAGAGAGCCGTGGG - Intronic
1180098603 21:45573860-45573882 GCTGAGTTCCAGAGAAATGCAGG - Intergenic
1181032326 22:20154586-20154608 TCAGAGATGCAGAGAGCAGGGGG - Intergenic
1181340797 22:22178472-22178494 GGTGAGCTGCAGAGATCAGCTGG + Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183050082 22:35253801-35253823 ACTCAGAGCCAGAGAGAAGCAGG - Intergenic
1183252094 22:36737420-36737442 GAGGAGAAGCAGAGAGAAGGAGG + Intergenic
1183329629 22:37212365-37212387 GGAGAGATGCAGAGAGAGGCAGG + Intergenic
1183897810 22:40983181-40983203 GCTGAGAAGCAGAGAGATGGGGG + Intergenic
1183985010 22:41564766-41564788 GGTGAGGTCCAGAGAGGAGCAGG + Intronic
949403789 3:3693694-3693716 GCAGAGAAGCAGAGAGATGCAGG + Intergenic
950190067 3:10970471-10970493 GGTGGGATGGAGAGAGAGGCTGG + Intergenic
950192857 3:10990206-10990228 GCAGAGATGCAGACATACGCTGG + Intergenic
950292371 3:11795669-11795691 GATCAGATGGAGAGATAAGCAGG - Intronic
950576515 3:13835297-13835319 CCTGCGATGCAGGAAGAAGCAGG + Intronic
950995471 3:17491873-17491895 TCAGAGGTGCAGAAAGAAGCTGG - Intronic
951000387 3:17552698-17552720 GATGAGATGGAGAGAGAATGGGG + Intronic
951098428 3:18658350-18658372 GGTGAGATGAAGCGATAAGCAGG + Intergenic
951897454 3:27623742-27623764 GCTGAGAGGCAGAGGGACACTGG - Intergenic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952458513 3:33499184-33499206 GGAGAGCTGCAGAGCGAAGCGGG - Intronic
952480253 3:33753952-33753974 GGGGAGCTGCATAGAGAAGCGGG + Intergenic
952633656 3:35501241-35501263 GATGAGATGAAGAGCAAAGCTGG + Intergenic
952730144 3:36629900-36629922 CCTGAGAAGAAGAGAGCAGCTGG + Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
952760383 3:36908413-36908435 GCTGAGCTGCTGAAAGAATCCGG - Intronic
953115719 3:39990282-39990304 GCTGTGATCCACAGAGAAGAAGG - Intronic
953241941 3:41157494-41157516 GGTGGGAGGTAGAGAGAAGCTGG - Intergenic
953358389 3:42273709-42273731 CCTCAGCTTCAGAGAGAAGCTGG - Intergenic
953720071 3:45347526-45347548 ACTGAGAAGCAGGGAGCAGCAGG + Intergenic
953916136 3:46922318-46922340 GCAGGGAGGCAGGGAGAAGCAGG + Intronic
954106140 3:48410743-48410765 GCTGGGAGGCAGGCAGAAGCTGG - Intronic
954625502 3:52019978-52020000 GTGGAGGGGCAGAGAGAAGCGGG + Intergenic
954873284 3:53784172-53784194 GCTGAGAGGCAGAGATGAGGCGG - Intronic
955579193 3:60400595-60400617 GCTGGCATGCACACAGAAGCAGG + Intronic
955756227 3:62227752-62227774 CCTGAGAGGAAGAGAGGAGCAGG + Intronic
956048310 3:65220254-65220276 TCTGAGATTCAAAGAGGAGCTGG - Intergenic
957491418 3:80932308-80932330 CCAGAGGTGCAAAGAGAAGCTGG + Intergenic
959560708 3:107777330-107777352 GTTGAGAAGCAGAGATAAGAGGG - Intronic
959894951 3:111594960-111594982 GCTGGGATGCACAGAGGAGAAGG + Exonic
960050975 3:113239323-113239345 GCGGAGAAGCAGGGAGAAGCAGG + Intronic
961112537 3:124297297-124297319 GCCCAGTTGCAGAGTGAAGCAGG - Intronic
961484461 3:127207319-127207341 GCTGAGCTGCAGGGCGGAGCAGG + Intergenic
961597718 3:128032124-128032146 GCTGGGGTGCAGAGTGAGGCAGG - Intergenic
962957187 3:140276910-140276932 GCAGAGAAGCAGGGAGAGGCAGG + Intronic
963065664 3:141261721-141261743 CCTGGGATACAGAGAGAAACAGG - Intronic
963772953 3:149407910-149407932 GCAGAAATGCAGAGAGAAAATGG + Intergenic
967194968 3:187018120-187018142 GCTGAGATGGAGAGGCAGGCTGG + Intronic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
967654858 3:192034831-192034853 GCAGAGATGCACGGAGCAGCAGG + Intergenic
968073086 3:195799959-195799981 GCTGTGAAGCAAAGAGCAGCAGG - Intronic
968350003 3:198046125-198046147 GCTGGGGTGCAGGGAGAGGCAGG + Intergenic
968358256 3:198124779-198124801 GCTGAGCTGGAGAGATGAGCTGG - Intergenic
968662867 4:1805984-1806006 CCTGAGATGCTGGGAGCAGCGGG + Intronic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
969414705 4:7050789-7050811 GATGAGAGGCAGAGCGAAGCCGG - Intronic
969943539 4:10759504-10759526 GCTAAGATGCAGGGAGAAGATGG + Intergenic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
975227840 4:71895038-71895060 CCAGAGATGCAAAGAGGAGCTGG + Intergenic
975453734 4:74564583-74564605 CCAGAGATGCAAAGAGGAGCTGG + Intergenic
977319168 4:95489376-95489398 CCTGGGAGGCAGAGAGAAGTGGG + Intronic
977999032 4:103533573-103533595 GTAGACATGCAGAGAGAAGCAGG + Intergenic
979557124 4:122061856-122061878 GCTGAGAAGGAGAAAGAAGAGGG - Intergenic
980219979 4:129901762-129901784 GGGGAGAGGCAGAGAGAAGGAGG - Intergenic
981321045 4:143391597-143391619 ACAGAGAAGCACAGAGAAGCGGG + Intronic
981783552 4:148452663-148452685 GCTGGGAGTCAGGGAGAAGCAGG + Intergenic
982825324 4:159996899-159996921 CCAGAGATACAAAGAGAAGCTGG + Intergenic
983950695 4:173637557-173637579 GCAGAGATACAGAGAGGAGAGGG - Intergenic
984153080 4:176158783-176158805 GCTAAGAGGCAGAGAAAATCAGG - Intronic
984530784 4:180913761-180913783 GCTGAGATGGAAAAAGAAACTGG - Intergenic
985167213 4:187109513-187109535 GCTTAAATGCTGAGACAAGCTGG + Intergenic
985169617 4:187135142-187135164 GCTGGAATGCTGGGAGAAGCAGG - Intergenic
985440190 4:189978286-189978308 GCTGAGCTGGAGAGATGAGCTGG + Intergenic
985451678 4:190066540-190066562 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985452666 4:190069832-190069854 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985453652 4:190073129-190073151 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985454642 4:190076422-190076444 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985455630 4:190079715-190079737 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985456614 4:190083009-190083031 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985457602 4:190086309-190086331 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985458589 4:190089602-190089624 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985459578 4:190092902-190092924 GCAGAGATGGAGAGAGGAACGGG + Intergenic
985747031 5:1653516-1653538 GCTCAGATGCAGAAACAGGCTGG - Intergenic
985747874 5:1657387-1657409 GAAGAGATGCAGGGAGAAGGAGG - Intergenic
986158292 5:5198935-5198957 GGTGAGATGCAGAGAAAAGGGGG - Intronic
987033143 5:13994145-13994167 GCTGAGAGGCAGAGAGGTGGAGG - Intergenic
987061017 5:14243998-14244020 GCTGAGCTGCACAGCCAAGCAGG - Intronic
987395585 5:17420024-17420046 GATGAGCTGCTGAGAGAGGCTGG - Intergenic
990262646 5:54041817-54041839 TCTGAGTTGCAGAGAAAAGGCGG + Intronic
990524100 5:56607941-56607963 TTTGAGATGCAGGGAGGAGCGGG + Intergenic
992038537 5:72805748-72805770 CCAGGGATGCAGAGAGGAGCTGG - Intergenic
992336966 5:75781399-75781421 CCAGAGATGCAAAGAGGAGCTGG + Intergenic
992756796 5:79914514-79914536 CCAGAGATACAAAGAGAAGCTGG + Intergenic
993060265 5:83030166-83030188 GGTGAGATTCAGAGACATGCTGG + Intergenic
993462341 5:88199007-88199029 GATCAGATGAAGAAAGAAGCGGG - Exonic
994533220 5:100993000-100993022 GCTGAGAAGGAGAGAAAAGAAGG - Intergenic
994533338 5:100994124-100994146 GCTGAGATGGAGAGAAAAGAAGG + Intergenic
994599937 5:101889808-101889830 CCAGAGATACAAAGAGAAGCTGG - Intergenic
995310634 5:110706672-110706694 GCTGAGATGCCTTGAGGAGCTGG - Intronic
995421179 5:111968753-111968775 GCCCAGATGCTGAAAGAAGCTGG - Intronic
995736810 5:115310472-115310494 GGAAAGATGGAGAGAGAAGCAGG - Intergenic
995789548 5:115870604-115870626 GCTCAAAGGCAGAAAGAAGCAGG - Intronic
995807259 5:116067034-116067056 TCTGAAAGGCAGAGAGAAGGAGG - Intergenic
997442133 5:133916252-133916274 GCTGAGATGCATAGGGATGAGGG + Intergenic
997444726 5:133932895-133932917 ACTGAAACTCAGAGAGAAGCAGG - Intergenic
997447196 5:133949790-133949812 GCAAAGATGCAGAGAGCAACAGG + Intergenic
997695454 5:135857641-135857663 GCTGAGAGCCAGAGAGGAACTGG + Intronic
998656943 5:144191749-144191771 CCTGAGATGCATAGAAAAACAGG - Intronic
999250792 5:150181115-150181137 GCTGAGGTGCAGTGAGAAGGGGG - Intronic
999454336 5:151702546-151702568 GCTGAGCGGCTGAGGGAAGCTGG - Intergenic
999468417 5:151829169-151829191 GCTGAGAAGCAGACAGCAGTGGG - Intronic
999597237 5:153218434-153218456 CCAGAGATGCAAAGAGGAGCTGG + Intergenic
999749408 5:154615747-154615769 ACTGGGACCCAGAGAGAAGCAGG - Intergenic
999770819 5:154774287-154774309 GCAGTGATGCAGAGAAAGGCTGG - Intronic
999907840 5:156163035-156163057 GAAAAGATGTAGAGAGAAGCTGG - Intronic
1001159905 5:169303543-169303565 GCTGAGTTTCAGAGAAAGGCGGG + Intergenic
1001837773 5:174846126-174846148 ACTGGGATGCAAAGAGAAGAAGG + Intergenic
1002087502 5:176785226-176785248 GCCGAGACGCAGCGTGAAGCGGG + Intergenic
1002758240 6:181081-181103 GCAGAGATCCCAAGAGAAGCAGG + Intergenic
1003011775 6:2433665-2433687 GCTGAGATACAGAGGGCAGCGGG - Intergenic
1003467043 6:6390841-6390863 GCTGAGGAGCTGAGAAAAGCTGG - Intergenic
1003803129 6:9694119-9694141 GCTGAAATACAAAGAGGAGCTGG + Intronic
1004557892 6:16717353-16717375 CCTGAGATGAACAGAGAGGCAGG + Intronic
1005861297 6:29904352-29904374 GGAGATATGCAAAGAGAAGCAGG - Intergenic
1006145600 6:31957608-31957630 GCAAAGATGCAGAGATAAGAAGG + Intronic
1006341214 6:33448170-33448192 CCTGAGATGCAGAGAGGAGTGGG - Intronic
1006371926 6:33650150-33650172 GCTGAAGGGCAGAGAGAAGGAGG - Intronic
1008139355 6:47814073-47814095 ATTGAGTTGCAGAGTGAAGCAGG + Intronic
1009943153 6:70312975-70312997 AATTAGATGCAGAGTGAAGCGGG - Intergenic
1013442968 6:110190432-110190454 GCTGGGATGCAAAGAGAGGAGGG + Intronic
1013460755 6:110372831-110372853 GCTCAGATGCTGAGGGAAACAGG - Intergenic
1013608942 6:111776002-111776024 GCTGAGATGAAGAGTGAAAATGG - Intronic
1013637001 6:112038480-112038502 ACTGAGATGAAGTAAGAAGCAGG - Intergenic
1014012383 6:116491258-116491280 CCTGAGATGAAAAGAGGAGCCGG + Intergenic
1014258074 6:119184133-119184155 GTTGAGATGCTGATAGAATCAGG - Intronic
1014374556 6:120657016-120657038 GGTAAGATGGTGAGAGAAGCTGG - Intergenic
1014421366 6:121250150-121250172 CCAGAGATACAAAGAGAAGCTGG + Intronic
1014632968 6:123810226-123810248 GCTGAGATTCAGACAGACCCGGG - Intronic
1014815211 6:125927941-125927963 GCTGGGATCCAGAGAGTCGCAGG + Intronic
1014830402 6:126096425-126096447 GCTGAGAGTTAGAGACAAGCTGG - Intergenic
1015971911 6:138750987-138751009 CCTGAGACACAGAGAGCAGCGGG - Intronic
1017200880 6:151753825-151753847 GGTAAGAGGAAGAGAGAAGCTGG - Intronic
1018176053 6:161180272-161180294 GATGGGCTGCAGAGAGGAGCTGG - Intronic
1018414415 6:163588934-163588956 GCCGGGATGCAGACAGAGGCTGG + Intergenic
1018433624 6:163742647-163742669 GCCCAGATGCATAGAGAAGGAGG - Intergenic
1018703030 6:166442265-166442287 TCTGAGATGCATAGAGCATCTGG + Intronic
1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG + Intergenic
1019074908 6:169379327-169379349 GCAGGGATGCAGAGAGACACGGG - Intergenic
1019428576 7:988402-988424 GCTGACCTGCAGAGAAAGGCAGG - Exonic
1019607902 7:1919198-1919220 GCTGAGATGCAGAGAGAAAAGGG + Intronic
1019988865 7:4678670-4678692 GCAGAGAAGCAGAGGGATGCAGG - Intergenic
1019998934 7:4743752-4743774 CCTCAGGTCCAGAGAGAAGCAGG + Intronic
1021214613 7:17900931-17900953 GGTGAGATTCAGAGACATGCTGG - Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022510551 7:30932594-30932616 CCAGAGAGACAGAGAGAAGCAGG + Intergenic
1022860986 7:34366690-34366712 GCAGATGTGCAGTGAGAAGCAGG - Intergenic
1023049076 7:36235515-36235537 ACAGAGATGCAGAGGGGAGCCGG - Intronic
1023365441 7:39458829-39458851 GCAGAAATGCAGGGAGGAGCAGG - Intronic
1024052123 7:45631806-45631828 TCTGAGATGCAGAGATATGCAGG - Intronic
1024147688 7:46534044-46534066 GGTGAGATGGAGAAAGAAGTGGG + Intergenic
1026026995 7:66753556-66753578 ACAGAGATGCAGAGAGACCCTGG - Intronic
1026321330 7:69269935-69269957 GCTGAGTTGAAGAGAGAACGAGG + Intergenic
1026385543 7:69843815-69843837 ACTGAGATTCAGAGAGATGAAGG + Intronic
1027180799 7:75937980-75938002 GCAGAGATGCTGCTAGAAGCAGG + Intronic
1027868692 7:83678780-83678802 GCTGAGATGCAGAAAGCAGTAGG + Intergenic
1028080621 7:86570742-86570764 CCAGAGATACAAAGAGAAGCTGG + Intergenic
1028433685 7:90777413-90777435 GAAGAGAGGCAGTGAGAAGCTGG + Intronic
1028459504 7:91075054-91075076 CCAGAGATACAGAGAGGAGCTGG + Intronic
1029692572 7:102191960-102191982 GCAGAAATGCAGTGACAAGCGGG - Intronic
1030088801 7:105839582-105839604 GCAGAGATGCAGGGAGAAAAGGG - Intronic
1030474924 7:110019407-110019429 GCTGAGATACTGATGGAAGCTGG + Intergenic
1030977294 7:116142710-116142732 GCAGAGATGCAGACAGAGGAAGG + Intronic
1031913910 7:127544847-127544869 CCTGAAAGGCAGGGAGAAGCGGG + Intergenic
1032465832 7:132144251-132144273 GATGAGATGCAGAGCCAAGGTGG - Intronic
1032528209 7:132596290-132596312 GCTGAGATTAAGAGAGAAGCAGG + Intronic
1033599178 7:142876710-142876732 GCTGAGATGGGGAGGGGAGCTGG - Intronic
1034444994 7:151109480-151109502 GAAGAGATGCAGGGAGAAGACGG - Intronic
1035089259 7:156293175-156293197 GCTAAGAGTCAGAGAGAAGAGGG - Intergenic
1035492613 7:159293536-159293558 GCTGGCATGCAGAGAGAGGCTGG + Intergenic
1035814874 8:2528289-2528311 GCTGAGATGAAGACAGATCCGGG - Intergenic
1036184206 8:6610246-6610268 GCTGGGATGCAGACAGAAGGCGG + Intronic
1038181505 8:25233046-25233068 GCAGAGAACCAGAGAGAAGAGGG - Intronic
1038271807 8:26081595-26081617 GTGTAGATGCACAGAGAAGCAGG - Intergenic
1038400163 8:27278498-27278520 GCTTTGATGCTGAGAGAGGCTGG - Intergenic
1038416381 8:27399210-27399232 GCTGAAAAACAGAGAGCAGCAGG + Intronic
1038426655 8:27468324-27468346 GCTGAGGGCCAGAGGGAAGCAGG - Intronic
1038676944 8:29631464-29631486 GCTGAGAGGCCGAGGGAGGCAGG + Intergenic
1039410414 8:37350178-37350200 GCTGGGATGCAGAGAGAGGTGGG - Intergenic
1040104931 8:43536154-43536176 GCTGGGATGCAGGGAGAGGCAGG + Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1043140500 8:76582968-76582990 GCTGAAATGGAAAGAAAAGCTGG - Intergenic
1045376378 8:101578488-101578510 TCTGAGATGCAGAGCAAAGTAGG + Intronic
1045518816 8:102885181-102885203 GCTGAGAAGCAAAGACAAGGGGG + Intronic
1046021376 8:108669440-108669462 GCTGAAATGCAGAGAAAATTTGG + Intronic
1046605318 8:116365358-116365380 GATGAGATGGAAAAAGAAGCAGG - Intergenic
1046653665 8:116869766-116869788 GCTGAAAGACACAGAGAAGCTGG + Intronic
1046723642 8:117651323-117651345 GCTGAGAGAGAGAGAGAAGATGG + Intergenic
1046969472 8:120205355-120205377 GCTGAAAAGTAGAGAGAAGAAGG - Intronic
1047555316 8:125923165-125923187 GCTGAGATTCAGAGAGGACATGG + Intergenic
1047793060 8:128225040-128225062 TCTGTGATGCACAGAGAAGATGG - Intergenic
1047861539 8:128972560-128972582 GCTGAAATGAAGAGAGTGGCAGG - Intergenic
1047941054 8:129827563-129827585 GCAGAAGTGCAGAGAGAAGGTGG + Intergenic
1048862528 8:138734512-138734534 GCTGAGATGCATAGAAACCCAGG + Intronic
1049154232 8:141057096-141057118 GCTGTGGGGCAGAGAGAAGGGGG - Intergenic
1049562841 8:143320682-143320704 GCAGAGATGCAGGGAGAAGATGG + Intronic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1050204537 9:3182702-3182724 GATGAGAGACAGAGAGAAGGAGG - Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1051378740 9:16433057-16433079 GCTGAGCTGCAGGAAGAGGCAGG + Intronic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1052250983 9:26397117-26397139 GCAGAGCTTCAGGGAGAAGCTGG - Intergenic
1052479274 9:29001927-29001949 CCAGTGATGAAGAGAGAAGCAGG - Intergenic
1052622139 9:30926085-30926107 GCTGAGATGAAAAGACAAACAGG - Intergenic
1055985781 9:82055923-82055945 GCTGGGGTGCAGGGAGAGGCAGG + Intergenic
1056585555 9:87925196-87925218 GCTGGGGTGCAGGGAGAGGCAGG - Intergenic
1056611323 9:88127748-88127770 GCTGGGGTGCAGGGAGAGGCAGG + Intergenic
1056778921 9:89534693-89534715 GCTGAGATGCTGACAGCAGGGGG + Intergenic
1057471496 9:95360991-95361013 GCAGGGATGCTGAGAGAAGCTGG - Intergenic
1057481440 9:95448201-95448223 GCTGAGCTGCAGTGTGAATCTGG - Intronic
1057675335 9:97132734-97132756 GCTGGGGTGCAGGGAGAGGCAGG - Intergenic
1057745800 9:97750010-97750032 TCTGAGACCCAGAGAGTAGCAGG + Intergenic
1058354010 9:104061228-104061250 CCTGAGAAGCAGAGAAAAGAGGG + Intergenic
1058959271 9:109977767-109977789 GCTGATACCCAGAGAGAGGCAGG - Intronic
1059475292 9:114541729-114541751 GTTGAGATGCAGGGCAAAGCAGG + Intergenic
1060280462 9:122212700-122212722 GCGGAGATGCAGGGGCAAGCGGG - Intronic
1060493440 9:124101281-124101303 GCAGTGATGGAGAGAGAAGGGGG + Intergenic
1060754945 9:126205926-126205948 GCTGAGTCCCACAGAGAAGCTGG + Intergenic
1060884246 9:127139439-127139461 GCTGAGATGCCCAGACAAACAGG + Intronic
1061634760 9:131900493-131900515 GCTGAGAAGGTGAGAGGAGCTGG + Intronic
1062207073 9:135343103-135343125 GCTGAGAGGCAGGAGGAAGCTGG - Intergenic
1062375460 9:136259952-136259974 GCTGAGATGCAGAAACAGGGAGG + Intergenic
1062525381 9:136976181-136976203 CCTGAGAGGCAGGGAGAAGGAGG - Intergenic
1062742128 9:138181312-138181334 GCTGAGCTGGAGAGATGAGCTGG - Intergenic
1185731256 X:2463700-2463722 GGTGACGTGCAGAGAGGAGCAGG + Intronic
1185732689 X:2473999-2474021 GGCGAGGTGCAGAGAGGAGCAGG + Intronic
1185733288 X:2478221-2478243 GGCGAGGTGCAGAGAGGAGCAGG + Intronic
1186175581 X:6922782-6922804 GTAGAGAAGGAGAGAGAAGCTGG - Intergenic
1190810477 X:53878698-53878720 GCCAAGAGCCAGAGAGAAGCTGG + Intergenic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1192766131 X:74141348-74141370 ACTGAGGTACAAAGAGAAGCTGG + Intergenic
1193059855 X:77194065-77194087 GCAGAGGTGCAAAGAGGAGCTGG - Intergenic
1193068904 X:77286405-77286427 CCAGAGGTGCAGAGAGGAGCTGG + Intergenic
1193191141 X:78572645-78572667 GGTGAGACTCAGAGAGATGCTGG - Intergenic
1194065749 X:89259891-89259913 GCTAAGATGCAGGGAATAGCAGG - Intergenic
1195622361 X:106969890-106969912 CCAGAGATACAAAGAGAAGCTGG + Intronic
1195857871 X:109350095-109350117 GGTAAGCTGGAGAGAGAAGCTGG + Intergenic
1195920095 X:109975050-109975072 TCTGAGATCCAGAGAGAAGCTGG - Intergenic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1197689020 X:129477221-129477243 GCTGCGATGCAGAGAATGGCAGG - Intronic
1199495793 X:148451020-148451042 GTGAAGATGCAGAGAGAAGGTGG - Intergenic
1199800436 X:151246164-151246186 GATGAGAAGGAGAGAGAAGAAGG + Intergenic
1199817392 X:151411045-151411067 GGTGAGATGCACACAGATGCAGG - Intergenic
1200719917 Y:6594017-6594039 GCTAAGATGCAGGGAATAGCAGG - Intergenic
1201405818 Y:13649022-13649044 CCAGAGATACAAAGAGAAGCCGG - Intergenic