ID: 1179050886

View in Genome Browser
Species Human (GRCh38)
Location 21:37887843-37887865
Sequence CCTATCCTGCAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179050880_1179050886 26 Left 1179050880 21:37887794-37887816 CCCTTCACCATGAAAAATGCCTC 0: 1
1: 0
2: 0
3: 30
4: 223
Right 1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 294
1179050881_1179050886 25 Left 1179050881 21:37887795-37887817 CCTTCACCATGAAAAATGCCTCA 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 294
1179050883_1179050886 7 Left 1179050883 21:37887813-37887835 CCTCAATGATTGAATATAGCTTC 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 294
1179050879_1179050886 30 Left 1179050879 21:37887790-37887812 CCAGCCCTTCACCATGAAAAATG 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 294
1179050882_1179050886 19 Left 1179050882 21:37887801-37887823 CCATGAAAAATGCCTCAATGATT 0: 1
1: 0
2: 2
3: 28
4: 257
Right 1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179050886 Original CRISPR CCTATCCTGCAGAATGTGGA AGG Intronic
900511466 1:3062968-3062990 CAAATCCTGCAGAGTGTGGAGGG - Intergenic
900722126 1:4183725-4183747 CCTTTCCTGAAGATTGAGGACGG + Intergenic
900841193 1:5049888-5049910 CCTTTCCTGAAGATTGAGGACGG - Intergenic
904851975 1:33466447-33466469 ACTGTGCTGCAGAACGTGGAGGG + Intergenic
905156060 1:35983135-35983157 ATTATCCTGAATAATGTGGATGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906481684 1:46203454-46203476 CCTGACCTGCGGGATGTGGAGGG + Exonic
908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG + Intronic
909789371 1:79654786-79654808 GCTATTCTGCAGCATATGGAGGG + Intergenic
910002367 1:82355772-82355794 CCTTTCCTGAAGATTGAGGACGG + Intergenic
910645467 1:89509374-89509396 CCTATGCTCCAGAATGGGCAAGG + Intergenic
911071590 1:93836020-93836042 CCTTTCCTGAAGATTGAGGATGG - Intronic
911576560 1:99585300-99585322 ACTATCCTGTAGCATGTGGAAGG - Intergenic
913681283 1:121188274-121188296 CCTCTCCTGAAAAATGTGAAGGG + Intronic
914033114 1:143975914-143975936 CCTCTCCTGAAAAATGTGAAGGG + Intergenic
914156331 1:145092052-145092074 CCTCTCCTGAAAAATGTGAAGGG - Intronic
915226443 1:154415137-154415159 CCTGTCCTGCAGGCTGAGGACGG - Intronic
915629933 1:157145238-157145260 CCTATTCTGTAGAACATGGAAGG + Intergenic
916329207 1:163595599-163595621 CCTTTCCTGAAGATTGAGGATGG - Intergenic
917872729 1:179256356-179256378 GCTATCCTGCAGGATGAGGTGGG - Intergenic
917982373 1:180278446-180278468 CCTACCAAGCAGAGTGTGGATGG - Exonic
918703039 1:187629567-187629589 CCTTTACTGAAGAATGGGGATGG + Intergenic
920468599 1:206206799-206206821 CCTCTCCTGAAAAATGTGAAGGG + Intronic
920908470 1:210192526-210192548 CCTTTCCTGAAGATTGAGGACGG - Intergenic
921520395 1:216149422-216149444 CCTTTCCTGAAGATTGAGGACGG - Intronic
922363137 1:224841121-224841143 CCTTTCCTGAAGACTGAGGATGG + Intergenic
922368921 1:224890460-224890482 CCTTTCCTGAAGATTGAGGACGG - Intergenic
923075557 1:230605879-230605901 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1065952725 10:30666647-30666669 GATATCGTGCAAAATGTGGAAGG - Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067703171 10:48588258-48588280 CCTATCCTGCAGGGTGGGGCAGG - Intronic
1068325358 10:55478344-55478366 CGTATCCTGCAGATGTTGGATGG - Intronic
1069956238 10:72053726-72053748 CCTATCCTGCAGCAGTTAGAGGG - Intergenic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1073130507 10:101185896-101185918 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1075178311 10:120186146-120186168 CCTATTCTGCTGAAGGGGGATGG + Intergenic
1076025987 10:127113858-127113880 TCCATCCTGCAGAGTGTGGGTGG - Intronic
1076900883 10:133336797-133336819 CATTTCTTGCAGAATGTGGGCGG - Intronic
1077872949 11:6278865-6278887 CCCAGCCTTCAGCATGTGGATGG - Intergenic
1079227870 11:18623581-18623603 ACTACCCTCCATAATGTGGATGG + Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1080197944 11:29633511-29633533 ACTTTTCTGCAAAATGTGGAAGG + Intergenic
1086550642 11:88048415-88048437 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1087197319 11:95314547-95314569 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1087631194 11:100652519-100652541 CCTGTCCTGCATAATGTTGGTGG - Intergenic
1087637593 11:100719943-100719965 CCTCCCCTGCTGAATGTGGCTGG + Intronic
1089310593 11:117555857-117555879 CCTCTCCTGCAGAGTATGGAGGG + Intronic
1089368073 11:117933101-117933123 AATATCCTGCAGAAAGTAGAAGG - Intergenic
1089953774 11:122552367-122552389 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1090864117 11:130681250-130681272 TCTATCCTGGAGAATGTTGCAGG - Intronic
1090878710 11:130814638-130814660 TCTATCCTGCAGAATCAGGGTGG + Intergenic
1092850676 12:12623812-12623834 CTTATCCTCCATTATGTGGATGG + Intronic
1093302984 12:17477465-17477487 CCTTTCCTGAAGAATGAGGACGG - Intergenic
1093358900 12:18200439-18200461 CCTTTCCTGAAGATTGGGGATGG - Intronic
1093641466 12:21531603-21531625 CCCATCCCCAAGAATGTGGAAGG + Exonic
1093970054 12:25368313-25368335 CCTATTCTGCAGAAACTGGAAGG + Intergenic
1095042881 12:37463702-37463724 TCTATCCTGGAGAATGTGTCAGG + Intergenic
1096107907 12:49008726-49008748 GTTTTCCTGCAGAATGTTGAAGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1101259545 12:103014093-103014115 CATTTCCAGCAGAATGTGCACGG + Intergenic
1101403368 12:104407365-104407387 CATATCCTGCAGGAAATGGAGGG - Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103994040 12:124817662-124817684 CCTGTCCTTCAACATGTGGAAGG - Exonic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1106137831 13:26987508-26987530 CTTATCCTGCAGCATATGGTAGG - Intergenic
1107856995 13:44626081-44626103 CCTATCCTGAAGAAAGAGCAGGG - Intergenic
1108996326 13:56738557-56738579 CCTATCCAGCAGAATGAGCGAGG + Intergenic
1110871111 13:80452924-80452946 TCTATCCTGGAGAATGTTTATGG - Intergenic
1111443586 13:88314284-88314306 GATATCCTTCAAAATGTGGATGG - Intergenic
1113756749 13:112817616-112817638 CCTTCCCTGCAGACTGTGGCTGG + Intronic
1114234950 14:20815454-20815476 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1117732826 14:58740957-58740979 CCTATTCTACATCATGTGGATGG + Intergenic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1118936872 14:70296650-70296672 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1119173450 14:72552069-72552091 CCTATCTTGCAGAATATTGTTGG - Intronic
1120618570 14:86735838-86735860 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1121192843 14:92045236-92045258 CCTTTCCTGAAGATTGAGGACGG + Exonic
1121389559 14:93562587-93562609 CCTTTCCTGAAGATTGAGGACGG + Intronic
1122041329 14:98989678-98989700 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1122380926 14:101306470-101306492 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1122508084 14:102244869-102244891 CCTTTCCTGAAGATTGAGGATGG - Intronic
1202941422 14_KI270725v1_random:151305-151327 TCTATCCTGGAGAATGTGTCAGG + Intergenic
1123882139 15:24686552-24686574 CCTCTCCTGAAGACTGAGGACGG + Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1125188535 15:36962241-36962263 CATATCCAGCATAATGTGAATGG + Intronic
1125212886 15:37237420-37237442 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1125849488 15:42889498-42889520 CCTTTCCTGAAGATTGAGGACGG - Intronic
1126292055 15:47092103-47092125 TCTATCCTGGAGAATGTGTCAGG - Intergenic
1129765377 15:78162222-78162244 CCTGTCTTGCAGATTGTTGATGG + Exonic
1131165142 15:90136713-90136735 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1131503902 15:92998665-92998687 CCTACCCTGCAGAATTAGGTAGG + Intronic
1132224798 15:100132097-100132119 CCCATCCCGGAGCATGTGGACGG - Exonic
1133919637 16:10140686-10140708 CCTATCCTGAACAATGTGATTGG + Intronic
1134439016 16:14286359-14286381 CCTGTGCAGAAGAATGTGGATGG - Intergenic
1136126217 16:28183267-28183289 CAGTTCCTGCAGAAAGTGGAAGG + Intronic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1138248707 16:55485851-55485873 CCAGTCCTGGAGAGTGTGGAGGG - Intronic
1138758671 16:59518180-59518202 CCTTTCCTGAAGACTGAGGATGG + Intergenic
1138852954 16:60652065-60652087 GCTCTCCTACAGAAAGTGGAAGG - Intergenic
1139192233 16:64878151-64878173 CATATCGTGCAGAATGAAGAGGG - Intergenic
1140779792 16:78284237-78284259 ACTATCCTGCAAAAAGTAGACGG - Intronic
1144713028 17:17414831-17414853 CAGGTCCTGCAGACTGTGGAGGG + Intergenic
1144781043 17:17808766-17808788 CCTATCATGGAGATTGAGGATGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148728836 17:49817917-49817939 CATATCCTGAAGAATATGCACGG + Exonic
1153978744 18:10291585-10291607 CCTATCCAGCAGAATGAGGCCGG - Intergenic
1155993823 18:32308935-32308957 CCTTTCCTGAAGAGTGTGGGTGG + Intronic
1156923705 18:42553589-42553611 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1157111893 18:44828553-44828575 CCTATCCTGTATAATATGAAGGG + Intronic
1157162214 18:45324507-45324529 CCTATCCTGCAGAAGCTAGGAGG - Intronic
1158140443 18:54249977-54249999 CCAAGTATGCAGAATGTGGAAGG - Intergenic
1158846081 18:61444168-61444190 TCTATGGTGCAGAATGGGGAGGG - Intronic
1159950059 18:74476358-74476380 CCCATCCTGCAGTATCCGGAAGG - Intergenic
1161827168 19:6575786-6575808 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1162500475 19:11050715-11050737 CCTCTCCTGCAGAATGTTTCAGG - Intronic
1163210136 19:15834201-15834223 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1163655279 19:18542274-18542296 CCTGTTCTGCAAAATGTTGAGGG - Intronic
1163899745 19:20090918-20090940 CCTTTCCTGAAGATTGAGGATGG + Intronic
1164153382 19:22573279-22573301 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1166368484 19:42289169-42289191 CCTATCCTGCAGATGGTGTCTGG + Exonic
1166905326 19:46104363-46104385 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1167774367 19:51545055-51545077 CCCATTCAGAAGAATGTGGAGGG + Intergenic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
925246496 2:2388298-2388320 CCAATCCTGCAGAAAGTGAAGGG + Intergenic
925767881 2:7254583-7254605 CCAGTCTTGAAGAATGTGGAAGG - Intergenic
928595345 2:32854718-32854740 CATTTCCTGCACACTGTGGAAGG - Intergenic
929789977 2:45014874-45014896 TCTTTCCTGCAGAAAGTGGTGGG - Intergenic
930689050 2:54340202-54340224 CATATCTTGCAGATTGTAGAGGG - Intronic
931847032 2:66214559-66214581 CCTCTCTCACAGAATGTGGAGGG + Intergenic
933138356 2:78762903-78762925 CCTTTCCTGAAGATTGAGGACGG - Intergenic
934141754 2:89053748-89053770 CCTTTCCTGAAGACTGAGGATGG - Intergenic
934227489 2:90146798-90146820 CCTTTCCTGAAGACTGAGGATGG + Intergenic
934612489 2:95751558-95751580 CCCATCCTCAAGAATGTGGCTGG - Intergenic
934648433 2:96072862-96072884 CCCATCCTCAAGAATGTGGCTGG + Intergenic
934841663 2:97627886-97627908 CCCATCCTCAAGAATGTGGCTGG + Intergenic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
937237161 2:120437835-120437857 GCTATCCTTCAGTATGTGGTGGG - Intergenic
937346341 2:121128117-121128139 CCTAGGCAGCAGCATGTGGAAGG - Intergenic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
938370790 2:130767215-130767237 CTAATCTTGGAGAATGTGGATGG - Exonic
941455729 2:165710793-165710815 CCTTTCCTGAAGATTGAGGACGG + Intergenic
942367084 2:175239208-175239230 CCTACATTTCAGAATGTGGATGG - Intergenic
943061964 2:183048811-183048833 CCTTTCCTGAAGATTGAGGATGG - Intergenic
943412525 2:187561153-187561175 CCTTTCCTGAAGATTGAGGATGG + Intronic
943450509 2:188037913-188037935 CCTTTCCTGAAGATTGAGGATGG - Intergenic
944251494 2:197583524-197583546 CCTTTCCTGAAGACTGAGGATGG - Intronic
947454099 2:230237362-230237384 CCTAACCTACAGAATGGTGAAGG - Intronic
947747812 2:232518166-232518188 CCTATGTTGCAGGATGTTGATGG - Intergenic
1168782933 20:510033-510055 CCCATACTGCAGGAGGTGGAGGG + Intronic
1172190065 20:33056568-33056590 CCCATTCTGCAGAATGTGCTGGG + Exonic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1172935588 20:38617708-38617730 CCTGTCCTGCAGAGTGGGCAGGG - Intronic
1175692628 20:61076463-61076485 TCTAGCCTCCAGAATGCGGAGGG - Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176581739 21:8535629-8535651 TCTATCCTGGAGAATGTGTCAGG - Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179558438 21:42195348-42195370 CGTGTCCTGCTGGATGTGGATGG + Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180264574 22:10512701-10512723 TCTATCCTGGAGAATGTGTCAGG - Intergenic
1182686523 22:32124356-32124378 CCACTTCTGCAGAATCTGGAGGG + Intergenic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1183191711 22:36325789-36325811 CAGCTCCTGCAGAATGGGGACGG - Intronic
1183257311 22:36770834-36770856 CCTCCCCTGCACACTGTGGAAGG - Intronic
1183479566 22:38056164-38056186 CCTTGCCTGCACAATGTGGCTGG + Intergenic
1183680820 22:39328227-39328249 CCTGTCCTGGAGACTGTGCATGG + Intergenic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184923391 22:47621326-47621348 CACATCCTCCAGAGTGTGGAGGG + Intergenic
949671496 3:6402161-6402183 CCTTTCCTGAAGATTGAGGATGG - Intergenic
949867342 3:8557130-8557152 CCTATGGTGCAGAATGGGCAGGG - Intronic
950445082 3:13032425-13032447 CCGAACCTGCAGGATGCGGATGG + Intronic
952117339 3:30198583-30198605 CCTATCCTAGTGAATGTGAAAGG + Intergenic
952297342 3:32072992-32073014 CCTTTCCTGAAGATTGAGGACGG - Intronic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
953656082 3:44855981-44856003 CCTTTCCTGAAGATTGAGGATGG + Intronic
954161279 3:48724471-48724493 CCTTTCCTGAAGATTGAGGACGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954698755 3:52441038-52441060 CTTATCCTGCAGAATGATGCTGG - Exonic
954916579 3:54153092-54153114 CCCATGGTGCAGAATGTGCAGGG + Intronic
955401186 3:58592663-58592685 CCTTTCCTGAAGATTGAGGATGG - Intronic
957451860 3:80389902-80389924 CCTTTCCTGAAGATTGAGGATGG - Intergenic
957734484 3:84188629-84188651 CCTTTCCTGAAGATTGAGGATGG + Intergenic
960584446 3:119308011-119308033 CCAGTCCTGAAGAGTGTGGATGG - Intronic
960718393 3:120600893-120600915 CAAATCCTTCAGAATGTAGAAGG - Intronic
962341705 3:134591176-134591198 ATTATTCTGCAGAATGTTGAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963445741 3:145405222-145405244 CCTATCCTGCAAAATATGTAAGG - Intergenic
964299830 3:155275639-155275661 CCTTTCCTGAAGATTGAGGACGG + Intergenic
965436166 3:168654743-168654765 TCTATCTTGCAGAATGAGAAAGG + Intergenic
968072038 3:195790093-195790115 CCTTTGCTGGAGAATGAGGAAGG + Exonic
968412575 4:402765-402787 CCTTTCCTGAAGATTGAGGACGG + Intergenic
970325821 4:14924730-14924752 ATTATCCTCCATAATGTGGATGG - Intergenic
971066678 4:23040725-23040747 CCTACCCAGCAGAAAGTAGATGG - Intergenic
972669314 4:41198765-41198787 CCTCTCCTGAAGACTTTGGAGGG - Intronic
973676481 4:53268577-53268599 CAGAGCCTGCAGAATGAGGAGGG + Intronic
973702517 4:53551143-53551165 CCCTTCCTGCAAAATGTGGTAGG - Intronic
976719162 4:88153521-88153543 CCTTTCCTGAAGATTGAGGATGG + Intronic
978302888 4:107291525-107291547 CCTTTCCTGAAGATTGAGGACGG + Intergenic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
980714870 4:136615681-136615703 CCTTTCCTGAAGATTGAGGATGG - Intergenic
981564103 4:146080096-146080118 CTTACCCTCCACAATGTGGATGG - Intergenic
983056211 4:163101543-163101565 CCTTTCCTGAAGATTGAGGATGG + Intergenic
983711887 4:170728245-170728267 CCTTTCCTGTATAATGAGGAAGG - Intergenic
984322588 4:178212116-178212138 CCTTTCCTGAAGATTGAGGATGG - Intergenic
984412166 4:179408400-179408422 CCTTTCCTGAAGATTGAGGATGG - Intergenic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
985078585 4:186242828-186242850 CCTTTCCTGAAGATTGAGGATGG + Intronic
985991263 5:3563852-3563874 CCTCTCCAGCAGACTCTGGAAGG - Intergenic
987522660 5:19006805-19006827 ACCATCCTGCAGGATGTTGAAGG - Intergenic
987756158 5:22099324-22099346 CCTTTCCTGAAGATTGAGGATGG - Intronic
988945400 5:36191640-36191662 TGTATCCTGCACATTGTGGATGG - Intergenic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
993595852 5:89854179-89854201 ACATTCCTTCAGAATGTGGAAGG - Intergenic
994529756 5:100954499-100954521 CCTGTCATTCACAATGTGGATGG + Intergenic
997280633 5:132642039-132642061 GCTACCCTGCAGGAAGTGGAGGG - Intronic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
998469714 5:142374339-142374361 CCAATCCTGAAGGATGTGGTGGG - Intergenic
1001327858 5:170742501-170742523 GCTATCCTCCATAATGTGGGTGG + Intergenic
1001353832 5:171001688-171001710 CCTTTCCTGAAGATTGAGGATGG + Intronic
1002171147 5:177375224-177375246 TCTATCCTGGAGAACATGGAAGG - Intergenic
1003100468 6:3172638-3172660 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1003487972 6:6595872-6595894 CCTATTCAGCAGTGTGTGGAGGG + Intronic
1004518264 6:16339097-16339119 CCTTCCCTGCGGGATGTGGAAGG - Intronic
1004953042 6:20695690-20695712 GCCATTCTGCAGAATGTTGAAGG + Intronic
1007084299 6:39132437-39132459 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1009343660 6:62588543-62588565 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1009379522 6:63010208-63010230 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1009749855 6:67869341-67869363 CCTTTCCTGAAGACTGAGGATGG + Intergenic
1009876489 6:69511929-69511951 CATATAATGCAGAATCTGGATGG + Intergenic
1012671322 6:102051308-102051330 CCTAGCTTGCAGAGAGTGGAAGG - Intronic
1013807644 6:114012788-114012810 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1016204889 6:141457509-141457531 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1016786935 6:148021178-148021200 CCCCTCCTCCAGAATCTGGATGG - Intergenic
1017922414 6:158883867-158883889 CCTTTCCTGAAGATTGGGGATGG + Intronic
1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG + Intergenic
1019020484 6:168913771-168913793 CCTTGCCGGCAGATTGTGGATGG - Intergenic
1019356218 7:580934-580956 CCTATGCTGCAGAATCTGCCCGG - Intronic
1020111549 7:5450840-5450862 CAGAGCCTGCAGAATCTGGAAGG - Intronic
1021797174 7:24267747-24267769 CCTCTGCTGTAGAGTGTGGAAGG + Intergenic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023144738 7:37139107-37139129 CCTATTCAGTAGAATGTTGATGG - Intronic
1023538554 7:41240098-41240120 CCTGTCCTGCTGAGCGTGGATGG - Intergenic
1024421919 7:49178095-49178117 CCTATTCTTCACAATATGGAAGG - Intergenic
1024566319 7:50684006-50684028 CCAATCCTGCAGAACATGGCAGG + Intronic
1024904820 7:54365120-54365142 CCTATCAAGCAGAATGTGAGGGG - Intergenic
1025790622 7:64684070-64684092 CCTTTCCTGAGGAATGAGGATGG - Intronic
1026009841 7:66628474-66628496 CCTTTCCTGGAGGATGTGGCGGG - Intergenic
1027158786 7:75787302-75787324 CCTTTCCTGAAGATTGAGGATGG - Intronic
1027354764 7:77344269-77344291 CCTTTCCTGAAGATTGAGGATGG - Intronic
1030193952 7:106835082-106835104 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1030445462 7:109643304-109643326 CCTTTCCTGAAGACTGAGGATGG + Intergenic
1031704222 7:124961572-124961594 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1033609052 7:142947950-142947972 CTTGTCCAGCAGAATGTGGCTGG - Intronic
1035073155 7:156159409-156159431 CCACTCCTGCAGCATGGGGATGG + Intergenic
1035530825 8:349767-349789 CCGAGCCTGGAGGATGTGGACGG - Intergenic
1035663808 8:1365521-1365543 CAGGTCCGGCAGAATGTGGATGG + Intergenic
1035994235 8:4528060-4528082 CATATGCTGCTGAATGTGGTGGG - Intronic
1038441136 8:27571612-27571634 GCTATGCAGCAGAATGTGGCAGG + Intergenic
1041308367 8:56487333-56487355 TCTATCCTGAAGAATGCTGAAGG + Intergenic
1043721248 8:83548587-83548609 CCTTTCCTGGAGATTGAGGATGG - Intergenic
1044723681 8:95174722-95174744 GCTATCATGCAGAATGAAGAGGG - Intergenic
1045645117 8:104290415-104290437 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1047548253 8:125840376-125840398 CATATAATGCAGAATATGGATGG + Intergenic
1047653275 8:126947759-126947781 CTTTTCCTGAAGGATGTGGAGGG + Intergenic
1047710843 8:127550747-127550769 ACTACCCTGCAGAGAGTGGAGGG + Intergenic
1048500996 8:134974881-134974903 CCTGTCTTGCAGACTGGGGAAGG - Intergenic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1050140929 9:2514890-2514912 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1050624806 9:7491819-7491841 GTTATCCTCCAGAATGTGGCTGG + Intergenic
1050896431 9:10889497-10889519 CCTTTCCTGAAGATTGAGGACGG - Intergenic
1051296493 9:15601423-15601445 CCTCTTCTGTAGAATCTGGAAGG + Intronic
1052053323 9:23874538-23874560 CATATCAGGCAGAATGTGAATGG - Intergenic
1052610347 9:30764801-30764823 CTTATTCTTCAAAATGTGGAGGG - Intergenic
1052653749 9:31331430-31331452 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1052862096 9:33443494-33443516 CCTAGCCTGCCGACTGTGGCAGG - Intronic
1055469374 9:76595968-76595990 CCTATCCTTCAGGAAGTGGAAGG + Intergenic
1057899444 9:98936759-98936781 ACTCTCCTCCAGAATGTGGTTGG - Intergenic
1060226545 9:121794809-121794831 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1061271606 9:129546909-129546931 CCTAGACTGAAGGATGTGGAGGG + Intergenic
1061646269 9:132004611-132004633 CCCTTCCTGCAGAGTGAGGATGG - Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1062595825 9:137298727-137298749 CCTATCCTGCAGAATCGGCCTGG - Intergenic
1062692432 9:137849520-137849542 CCTTTCCTGAAGATTGAGGACGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1188200485 X:27289439-27289461 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1188254656 X:27946610-27946632 ACTATCCGGCAGAATGTGACTGG + Intergenic
1188300705 X:28503595-28503617 CCTTTCCTGAAGATTGAGGACGG + Intergenic
1189001327 X:36950253-36950275 GATATCCTTCAGAAGGTGGATGG - Intergenic
1189104903 X:38225396-38225418 CCTCTCCTGCAGTACGTAGATGG - Intronic
1189546019 X:42043358-42043380 CCTATTCTGAAAAATGAGGATGG - Intergenic
1191761749 X:64654377-64654399 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1191826010 X:65365137-65365159 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1192089755 X:68141110-68141132 CCCAGCCTGCAGTCTGTGGATGG - Intronic
1192455225 X:71270347-71270369 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1193406740 X:81109639-81109661 GCTATCCTGTAGGATGTTGAAGG + Intergenic
1194023517 X:88723428-88723450 CCTTTCCTTCATAAAGTGGATGG - Intergenic
1194605514 X:95974081-95974103 CATATCCTGAAGAATATGCACGG - Intergenic
1195016658 X:100787945-100787967 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1195290758 X:103430244-103430266 CCTTTCCTGAAGATTGAGGATGG + Intergenic
1195302006 X:103539150-103539172 CCTATACTGATGACTGTGGATGG - Intergenic
1196497228 X:116335607-116335629 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1197258337 X:124288519-124288541 CCTGTCATTCACAATGTGGATGG - Intronic
1197500156 X:127231822-127231844 CCTTTCCTGAAGATTGAGGATGG - Intergenic
1199282646 X:146020795-146020817 CCTGTCTTGCAGAATTTGCAGGG - Intergenic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic
1200136528 X:153877762-153877784 CCTAACCTGGAGCATCTGGAAGG - Intronic
1201233847 Y:11891596-11891618 CCTTTCCTGAAGACTGAGGATGG + Intergenic
1201437498 Y:13975229-13975251 CCCATGCGCCAGAATGTGGAGGG + Intergenic