ID: 1179051466

View in Genome Browser
Species Human (GRCh38)
Location 21:37892102-37892124
Sequence ATGTTTCAAAAGCTCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179051466_1179051471 27 Left 1179051466 21:37892102-37892124 CCATGTGGGAGCTTTTGAAACAT 0: 1
1: 0
2: 3
3: 21
4: 231
Right 1179051471 21:37892152-37892174 AATTCTGATTTAATCAGTCTAGG 0: 2
1: 2
2: 45
3: 217
4: 1027
1179051466_1179051472 28 Left 1179051466 21:37892102-37892124 CCATGTGGGAGCTTTTGAAACAT 0: 1
1: 0
2: 3
3: 21
4: 231
Right 1179051472 21:37892153-37892175 ATTCTGATTTAATCAGTCTAGGG 0: 1
1: 6
2: 40
3: 202
4: 804

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179051466 Original CRISPR ATGTTTCAAAAGCTCCCACA TGG (reversed) Intronic
903392154 1:22972255-22972277 ATGTGTCAGAAGCTGACACATGG + Intergenic
905015311 1:34774291-34774313 AGGCACCAAAAGCTCCCACATGG + Intronic
905623155 1:39466636-39466658 ATCTCTCAGAACCTCCCACAGGG + Intronic
905842544 1:41195192-41195214 ATGTTTCAATAGAGGCCACACGG - Intronic
906283260 1:44568306-44568328 ATGTTTGAGGAGCTGCCACACGG - Intronic
907657378 1:56358008-56358030 ATGTTTCAAAAGTTCCTCCTTGG + Intergenic
909084516 1:71155292-71155314 ATGTTTCTAAGTCTCCCCCAAGG + Intergenic
910391281 1:86747044-86747066 ATATTTAAAAAGCTGTCACATGG - Intronic
910802967 1:91163728-91163750 ATGTTTTAAAAAATACCACATGG + Intergenic
910865750 1:91786792-91786814 ATGGTTCAAAAGTTCCAAGATGG + Intronic
911608711 1:99937158-99937180 ATTATTCAAAAACACCCACATGG - Intergenic
911830022 1:102538372-102538394 ATGATTCAATACCTCCCACAAGG + Intergenic
913750363 1:121957829-121957851 GTGTTTCAAACGCTCCATCAAGG + Intergenic
915088453 1:153404928-153404950 CTGTTTCCCAAGCTTCCACACGG - Intergenic
915096434 1:153465896-153465918 CTGTTTCCCAAGCTTCCACACGG + Intergenic
917003379 1:170385569-170385591 AAGTTTCAGAAGCTCACCCAAGG + Intergenic
918457480 1:184737833-184737855 ATTTTTGAAAAGATTCCACAGGG - Intronic
919341768 1:196317925-196317947 ATAATTAAAAAGCTTCCACATGG - Intronic
919611990 1:199756854-199756876 ATATTTCCAAAGCTCCCCAAGGG + Intergenic
919757079 1:201073007-201073029 AACTTGCAAAAGCTCCCACGGGG + Intronic
921523350 1:216185456-216185478 ATGATTCAAATGCTTCCAAAAGG + Intronic
924015957 1:239723517-239723539 ATGTTTATTAAGCTCCCATATGG + Intronic
924194884 1:241596028-241596050 ATGTCTAACAAGCTCCCACATGG - Intronic
924654820 1:245964263-245964285 ATGATCCAAAACCTCCCACCAGG + Intronic
1065611551 10:27476191-27476213 ATGTTTCAAACGCTATTACAAGG + Intergenic
1066794300 10:39102011-39102033 ATGTGTCAATTCCTCCCACAGGG + Intergenic
1067327444 10:45282907-45282929 CTCTTTCATAAGCTGCCACAGGG - Intergenic
1067466635 10:46503847-46503869 ATATTTAAGAAGCTTCCACATGG - Intergenic
1067620553 10:47880758-47880780 ATATTTAAGAAGCTTCCACATGG + Intergenic
1069266349 10:66463184-66463206 ATGACTCAACACCTCCCACAAGG - Intronic
1069332588 10:67310789-67310811 ATGATTCAATACCTCCCACCGGG + Intronic
1072648972 10:97278165-97278187 ATCTTTCAAGATGTCCCACATGG + Intronic
1073329962 10:102663891-102663913 CTGTTTCTAAAGCTCCTCCAAGG - Intergenic
1073578796 10:104645264-104645286 GTGTTTCAAAAACACCCAGAGGG + Intronic
1073931898 10:108586040-108586062 TTTTTTCAAGAGCCCCCACAAGG + Intergenic
1074498655 10:114002445-114002467 ATTTTTCAGGAGCTGCCACATGG - Intergenic
1076933716 10:133553249-133553271 ATGTTTAAATAGTTCCCACCTGG + Intronic
1079724870 11:23868272-23868294 ATGACTTAAAAGCTCCCACTTGG - Intergenic
1081403361 11:42668051-42668073 ATTTTTTAAAATATCCCACATGG - Intergenic
1082742659 11:56927775-56927797 ATGTTAAGAAAGCTCCTACATGG - Intergenic
1085593818 11:77790363-77790385 ATGTTTCAATTACCCCCACAGGG + Intronic
1087777305 11:102268307-102268329 AAGCTTCAAAAGCTCCGACTTGG + Intergenic
1089307556 11:117536159-117536181 ATGTTGCACAAGCCCCCCCAAGG - Intronic
1090408105 11:126489478-126489500 ATGTTCCAAAAGCTTCCTGATGG + Intronic
1090632830 11:128665254-128665276 TTGTTTCATAAGCTCCAACTAGG - Intergenic
1091030225 11:132180072-132180094 ATATTTCAAAAGCTTTCAAACGG - Intronic
1091580709 12:1786974-1786996 ATGTTTCTAGAGCTCCTCCATGG - Exonic
1091983064 12:4882092-4882114 ATGTTTCAAAATTTCCCAAAAGG - Intergenic
1092007179 12:5079450-5079472 GTGTTTCAAAGCCTCCCAGATGG + Intergenic
1092773245 12:11917683-11917705 ATTTCTCCAGAGCTCCCACAGGG - Intergenic
1093054932 12:14546651-14546673 ATGCTGCTAAAGATCCCACAAGG + Intronic
1093820349 12:23609254-23609276 ATGTTTCAAAAGCTTCCATAAGG - Intronic
1094762028 12:33544973-33544995 ATGATCCAAAAACTCCCACCAGG + Intergenic
1095139288 12:38641839-38641861 ATGATTCAATTGCTCCCACTGGG - Intergenic
1095238707 12:39831636-39831658 ATGATTCAATACCTCCCACCAGG - Intronic
1098249736 12:68556987-68557009 ATCTTTCAAAAGGTCCTACTTGG - Intergenic
1098817521 12:75186212-75186234 ATGTTTCAAGAACTCCAAGAAGG - Intronic
1102077560 12:110072293-110072315 ATGTTACAACAGCTACAACATGG + Intronic
1107768309 13:43761352-43761374 ATGTTTCTAAATTTGCCACATGG + Intronic
1108731050 13:53236217-53236239 ATGATTCAATACCTCCCACTAGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110933777 13:81257351-81257373 ATGTCCCAACAGCTCCCACCAGG + Intergenic
1112959349 13:105103705-105103727 ATTTTTAACAAGCTCCCAGATGG - Intergenic
1114734056 14:25024946-25024968 ATGTTTCAAAAATACCCACATGG + Intronic
1115554471 14:34533496-34533518 AAGTTGCAACAGCTCCGACAAGG - Exonic
1116135102 14:40913181-40913203 ATTTTTCATAAGCCCCCACTTGG + Intergenic
1116364823 14:44046812-44046834 ATTTTTCAAAAGCTAGCAGAAGG - Intergenic
1116715132 14:48417269-48417291 ATGATTCAATACCTCCCACCAGG - Intergenic
1116871187 14:50070417-50070439 ATTTCTAACAAGCTCCCACATGG - Intergenic
1117285954 14:54286044-54286066 ATGTTTATGAAGCACCCACATGG + Intergenic
1117762439 14:59044584-59044606 CTGTTCCTAAAGCTCACACAGGG - Intergenic
1117988067 14:61408074-61408096 ATGTTTCAAAGTCTCCCCCAAGG - Intronic
1118595483 14:67431762-67431784 GTGTCCCAGAAGCTCCCACATGG + Intergenic
1119490768 14:75030787-75030809 GTTTTTCAAAAGCTGCCACAGGG + Intronic
1120048746 14:79840261-79840283 ATGTTTTAAAAGTTCCCCAAGGG - Intronic
1120597358 14:86457522-86457544 ATGTTTCAAGTGCTTCCACTGGG - Intergenic
1122570315 14:102694082-102694104 ATTTTTCAAGATCTCTCACATGG - Intronic
1122570606 14:102696903-102696925 ACTTTTCAAAACCTCCCACGTGG - Intronic
1123179254 14:106453098-106453120 ATGTCTCAAAACCTCCCAGTCGG + Intergenic
1123205387 14:106707694-106707716 CTTTTTCAAAAGCTTCTACATGG - Intergenic
1123210432 14:106754961-106754983 CTTTTTCAAAAGCTTCTACATGG - Intergenic
1124906055 15:33869563-33869585 ATGTTTCCAAAGAACCCCCAGGG + Intronic
1124988398 15:34645900-34645922 ATGTTTCAAAGTTTCCCAAATGG - Intergenic
1129137098 15:73564158-73564180 ATGTTTTAAAAAGACCCACAAGG + Intronic
1129184100 15:73895132-73895154 CTTTTTCAAAAGCTCCCAGGTGG + Intergenic
1130034855 15:80349549-80349571 ATTTTTAAAAAGCTGCCACGAGG - Intronic
1130812151 15:87391007-87391029 ATGTTACAAAACATCCCTCAAGG + Intergenic
1130814570 15:87417680-87417702 GTGTTTCAAAATGTCCCCCAGGG + Intergenic
1133280814 16:4664227-4664249 ATGTTTCCAAAGTTCACCCACGG - Intronic
1134872118 16:17661494-17661516 ATGTTTCCAAAGCTCTTAGATGG - Intergenic
1137062678 16:35806033-35806055 GTGTGTCAAAAGTCCCCACAGGG + Intergenic
1137409714 16:48217750-48217772 ATGTTTTAAAGGCTCCCACTAGG - Intronic
1138137050 16:54532222-54532244 GTGTTTCAAAATTCCCCACAAGG - Intergenic
1138146231 16:54614699-54614721 ATGATTCAAAACCTCCCACTAGG - Intergenic
1138910485 16:61391582-61391604 ATGTTTCAAAAGATTTCACTGGG + Intergenic
1139360995 16:66400118-66400140 ATGTTTTAAAAGCTCCCTGGGGG + Intronic
1139895137 16:70282494-70282516 AAGTTTCACAAGATCACACAGGG + Intronic
1140335485 16:74100937-74100959 ATCTTTAAAAATCTCTCACAGGG - Intergenic
1141553575 16:84822066-84822088 ACGTTAAAAAAACTCCCACATGG - Intronic
1142499223 17:323108-323130 ATCCTGCAAAAGCTCACACATGG - Intronic
1143339962 17:6203147-6203169 AATTTTCAAAAACTGCCACACGG + Intergenic
1144410989 17:15001628-15001650 ATGGCTCAACACCTCCCACAAGG - Intergenic
1145251083 17:21297405-21297427 ATGAGGCAGAAGCTCCCACAAGG + Intronic
1149157363 17:53647879-53647901 ATGTTTCAGAGGCTCACCCAAGG + Intergenic
1152419270 17:80183274-80183296 ATCTTTCAACAGCTCCTCCAGGG - Intronic
1158366705 18:56744758-56744780 AGGTTTCAAAGGTTCCCAGATGG + Intronic
1158730605 18:60018414-60018436 ATGCTGCAAAACATCCCACAAGG - Intergenic
1159495990 18:69205572-69205594 ATGGTTTAAAGGCTCCCACTAGG - Intergenic
1160233775 18:77069179-77069201 ATGTTTAAAAAGCTCTCTCTGGG - Intronic
1160363078 18:78300798-78300820 ATGCTTGATAATCTCCCACAGGG - Intergenic
1160628152 18:80227498-80227520 ATGTTTCAAATACTTGCACACGG + Intronic
1164512316 19:28907636-28907658 AGGTTTCTAAAACTTCCACATGG - Intergenic
1164790951 19:30980189-30980211 ATGTTTCAGAAGCAGTCACATGG + Intergenic
1165967607 19:39596355-39596377 CTGTTTCTAAAGTTCCCTCATGG - Intergenic
925682955 2:6442385-6442407 ATGTTGCAAAAGCTCCTTCTGGG - Intergenic
926843077 2:17104797-17104819 GTGTTTCACCACCTCCCACAAGG + Intergenic
926880746 2:17541083-17541105 ATATTCCAAAAGATCCCCCATGG - Intronic
930242748 2:48953235-48953257 CTGATTCAAAATCTCCCCCATGG - Intergenic
930822814 2:55664183-55664205 ATGTGTCATAAACCCCCACAAGG - Intronic
932097341 2:68863229-68863251 ATGCTGCAAACGCTCCTACATGG - Intergenic
933530698 2:83507228-83507250 ATGTTTCAAAATCTAACAAAAGG - Intergenic
934660997 2:96143683-96143705 GAGTTTCAGAAGCCCCCACATGG - Exonic
935338344 2:102037081-102037103 CTGATTTTAAAGCTCCCACAAGG - Intergenic
935554798 2:104497873-104497895 ATGATTCAAAAACTGCTACAGGG - Intergenic
936460765 2:112712504-112712526 ATGTTTCTAAAGCTGCCCCTGGG - Intergenic
939144515 2:138396375-138396397 ATGTCTCAAAATCTCGCTCAAGG - Intergenic
939864036 2:147452674-147452696 AAGTTTCACAAGGTTCCACAAGG - Intergenic
939958841 2:148548603-148548625 ATGTTTTAAAAGTTACCCCATGG + Intergenic
940033590 2:149290023-149290045 AGGTTTCACAAGCTCCCAGCTGG - Intergenic
942889549 2:180971620-180971642 ATGTTTACTAAGCTCCAACAGGG + Intronic
943932436 2:193871094-193871116 CTGTTTCAAAAGCTTTAACATGG + Intergenic
945336101 2:208594489-208594511 ATATATAAAAAGTTCCCACAAGG - Intronic
947936913 2:234013700-234013722 CTCTTTCAAAAGCTCCTATAGGG + Intronic
948753070 2:240143637-240143659 ACTATTCAAAAGCTCCCACGTGG - Intronic
948791474 2:240379853-240379875 CTTTTTCTAATGCTCCCACAAGG - Intergenic
1169539792 20:6586949-6586971 ATGTTTCAAAAACTACCGCAGGG + Intergenic
1170145212 20:13166066-13166088 ATCTTTAACAAGCTCCCAGAGGG + Exonic
1174542882 20:51303769-51303791 CTGTTCCAAAAGCTGGCACAGGG + Intergenic
1174628870 20:51939210-51939232 ATTTTTCAAAAGGTCACAGATGG - Intergenic
1175467177 20:59197308-59197330 TTGTTTCAGGAGATCCCACAAGG + Intronic
1177303671 21:19284408-19284430 ATTTTTCTAATGTTCCCACAAGG + Intergenic
1177543894 21:22531977-22531999 ATGATTCAACACCTCCCACCAGG - Intergenic
1179051466 21:37892102-37892124 ATGTTTCAAAAGCTCCCACATGG - Intronic
950180586 3:10910380-10910402 ATCTTTAAAATGCTACCACATGG + Intronic
951033791 3:17910831-17910853 ATGTGTCAGAATCACCCACAAGG + Intronic
953194130 3:40715960-40715982 ATGTACCAGAAGCCCCCACATGG + Intergenic
955071028 3:55572548-55572570 ATTTTACACAAGCTCCTACATGG + Intronic
956018538 3:64909797-64909819 ATGTTTAAAATGATCCCTCATGG - Intergenic
957118227 3:76055203-76055225 ATGATTCAATATCTCCCACGGGG + Intronic
957899253 3:86467209-86467231 ATCTTTCAAAAGCAACCAAATGG + Intergenic
958625570 3:96618499-96618521 AAATTTCATAAGCTCCCTCATGG + Intergenic
960136830 3:114114021-114114043 AAGTTTCAGAAGCTCCCACTTGG - Intergenic
960248437 3:115425458-115425480 ATGTCATAAAAGCTCCCACCCGG + Intergenic
962813364 3:138977582-138977604 GTGTTTGAAAAGCTCCAACAAGG - Intergenic
964552974 3:157905406-157905428 ATCTTTCAAAATCTCAGACAGGG - Intergenic
965278351 3:166717028-166717050 TTGTTTCAAAAGCTAGCAGAAGG + Intergenic
965794768 3:172428294-172428316 AGGTTTAAAAAGATCACACATGG - Intergenic
967980755 3:195063797-195063819 ATGTTTCAAATGCAGCCACTGGG - Intergenic
968194829 3:196697647-196697669 ATTATTTAAAAGCTTCCACAAGG - Intronic
970314024 4:14812114-14812136 AAGTTCCAAAATCTCTCACATGG - Intergenic
970898438 4:21130598-21130620 ATTTTTAAATAGCTCCTACATGG - Intronic
971330514 4:25677644-25677666 TTATTTCAAAAGATCCAACAGGG - Exonic
974219595 4:58949036-58949058 ATGATTCAATACCTCCCACCAGG + Intergenic
974483757 4:62479392-62479414 ATGTTTAAAATGCTACAACATGG - Intergenic
975740024 4:77420691-77420713 ATGTTTGAAAACCTGCCTCAAGG - Intronic
975741034 4:77429146-77429168 ATGTTCCAAAAGCTCCTAAAGGG + Intronic
977599717 4:98923177-98923199 ATGTATCAAAAGTTCCAACTGGG + Intronic
979149805 4:117297020-117297042 ATGATTCAATACCTCCCACTAGG - Intergenic
980702948 4:136456349-136456371 AGGTTTCATGAGCTCCCACCAGG + Intergenic
980853956 4:138416942-138416964 ATATTTTAAATGCTCCCCCAGGG + Intergenic
981441280 4:144785773-144785795 ATGTTTCAAAAGTTGCCAAAGGG + Intergenic
981725514 4:147843204-147843226 ATGGTTCAAAATCTCTGACACGG - Intronic
982195391 4:152906818-152906840 ATGTTTGAGAAGCACCAACAAGG - Intronic
982971452 4:161992994-161993016 ATGTTTCAATAGGTTGCACAAGG + Intronic
983227595 4:165099648-165099670 ATTTTTAAAAAGTTCCCACCAGG + Intronic
984445459 4:179830493-179830515 ATTTACCAAAAGCTCCAACAGGG - Intergenic
984483731 4:180338547-180338569 CTGTTTCAAAAGGTCTCAGAGGG + Intergenic
984509188 4:180658029-180658051 ATGTTTTAAAAGCTGGCACAAGG - Intergenic
984665625 4:182425561-182425583 ATGTTTCAAAAGTGCCCACAAGG + Intronic
986662284 5:10069874-10069896 ATGTATGCAAAGCTCCCAAAAGG - Intergenic
986847435 5:11771862-11771884 GTGTTTCAAAAGCCCTCACGTGG - Intronic
986923327 5:12715938-12715960 ATGTTTCACAAGCTCTCAACTGG + Intergenic
986935049 5:12873602-12873624 ATGATTCAATATCTCCCACCAGG + Intergenic
988474019 5:31566771-31566793 ATGTTTCAATACCTCCCACTGGG + Intergenic
990114962 5:52378629-52378651 GTGTTTTAAAAGGTCCCACAGGG - Intergenic
990799741 5:59587232-59587254 AAATATGAAAAGCTCCCACATGG - Intronic
994328706 5:98480753-98480775 ATGATTCAATACCTCCCACTGGG + Intergenic
995531851 5:113099373-113099395 ATGTTTGAAGAACTCCAACATGG - Intronic
995831077 5:116357072-116357094 CTGGGTCAAAAGCTCCCACCAGG + Intronic
996782745 5:127206423-127206445 CTGTTTCAAAACATCCCCCATGG - Intergenic
999092618 5:148950525-148950547 ATTTATCTAAAGCTCCCATAAGG - Intronic
1002450543 5:179316078-179316100 AAAGTTCAAAAGCTCCCAGAGGG + Intronic
1003389831 6:5703997-5704019 ATGTTTCTAAAGCTCACTAAAGG - Intronic
1004328568 6:14700181-14700203 ATGATTCAATACCTCCCACTAGG - Intergenic
1004525344 6:16402104-16402126 ATGATTCAATACCTCCCACCAGG + Intronic
1005379716 6:25220891-25220913 ATGGTTCAAAACTTCCTACAGGG - Intergenic
1008971121 6:57369438-57369460 ATGTTTCAAATGGTAGCACATGG - Intronic
1011148075 6:84240777-84240799 ATGATTCAACACCTCCCACCAGG - Intergenic
1011349144 6:86403056-86403078 ATGATTCAATATCTCCCACTGGG + Intergenic
1011460425 6:87597462-87597484 ATTTTTCAAAAGCTCCCCACAGG + Intronic
1012329871 6:97972028-97972050 AGGTTTAAAAAGCTCTCACAGGG - Intergenic
1012602830 6:101119147-101119169 ATGATTCAAAACCTCCCACAAGG - Intergenic
1013811978 6:114055171-114055193 ATGTTTCAAAAACTCAGACCAGG - Intergenic
1014694331 6:124599990-124600012 AGGTTTCCAGAGCTCCCAAATGG + Intronic
1015436422 6:133194768-133194790 ATGACTCCAAAGCTCACACAAGG - Intergenic
1015618339 6:135103226-135103248 AAGCTTCAAAATTTCCCACAAGG + Intergenic
1017350864 6:153440502-153440524 ACGTTTGGAAAGCTTCCACATGG + Intergenic
1018456196 6:163955028-163955050 ATGGTGTAAATGCTCCCACATGG - Intergenic
1019649588 7:2149533-2149555 ATGTTTAAAAAGCACCCGCCAGG + Intronic
1024343304 7:48288590-48288612 ATGGTGCAAAAGCTCCTGCATGG - Intronic
1024841868 7:53596094-53596116 ATGTTTCACAGGGTCACACAGGG - Intergenic
1026004353 7:66589466-66589488 ATTTTCCAAAAGCTCTCTCATGG - Intergenic
1028265468 7:88718677-88718699 ATGTATCAAAAGCCAACACAAGG - Intergenic
1028650924 7:93149969-93149991 ATGTTTCAAGAGCAGACACATGG - Intergenic
1030363380 7:108619171-108619193 AGCTTTCATAAGCTTCCACAGGG - Intergenic
1031299462 7:120046232-120046254 ATATTTAAAAAACTCTCACAAGG + Intergenic
1032713339 7:134482333-134482355 AATTTTAAAAAGCTGCCACAAGG + Intergenic
1032989473 7:137376257-137376279 AAGTTTCTAAAGCTTCCAAAAGG - Intergenic
1033018038 7:137691912-137691934 TACTTTCAAAAGCTCCCACTGGG + Intronic
1034603972 7:152293429-152293451 ATGGTTCAAAAGTTCCTAAAGGG + Intronic
1034745009 7:153516496-153516518 ATTTTTAACAAGCTCCCAGAAGG - Intergenic
1036531797 8:9596913-9596935 ATTTTTCAAGCGTTCCCACAGGG + Intronic
1036736768 8:11325944-11325966 ATGTTTAAAAATCCCCCATATGG - Exonic
1037354667 8:18005148-18005170 ATTTTTAAAAAGCACCCACTAGG - Intronic
1037747522 8:21658890-21658912 ATGTTTTAAAAGCACCGATATGG - Intergenic
1039684275 8:39780248-39780270 ATGATTCAATACCTCCCACCGGG + Intronic
1039910835 8:41825730-41825752 ATGATTCAATACCTCCCACCGGG - Intronic
1040861249 8:52001547-52001569 ATGTTTCAAAGGCTTCCACTAGG + Intergenic
1041061119 8:54035599-54035621 AAATTTAAAAAGCTACCACATGG - Intergenic
1041647602 8:60269540-60269562 ATCTTACAAAAGCTTCCTCAGGG - Intronic
1044959554 8:97516987-97517009 AAGTTGCAACAGATCCCACAAGG + Intergenic
1050177065 9:2879406-2879428 ATCTCTCAAATGCTTCCACATGG + Intergenic
1051207268 9:14701354-14701376 CTCTTTCAAAATCTCCCACTTGG - Intergenic
1052830949 9:33215051-33215073 ATTTTTAAAAAGATCCCAGAGGG - Intergenic
1052997840 9:34560731-34560753 GTGTCTCAAGAGCCCCCACAAGG - Intronic
1053557808 9:39156267-39156289 AAGTTACAAAAGCACACACAAGG + Intronic
1053821920 9:41976552-41976574 AAGTTACAAAAGCACACACAAGG + Intronic
1054608652 9:67210856-67210878 AAGTTACAAAAGCACACACAAGG - Intergenic
1057448585 9:95136998-95137020 AAGTTTGAAAAGCACCCACTGGG - Intronic
1057885989 9:98830187-98830209 ATGTTTCAAAAGCTCCCCAGGGG + Intronic
1058414098 9:104767131-104767153 ATTTTTATAAAGCTCCCAAATGG - Intronic
1058420184 9:104826152-104826174 ATGTTTCCAAAGATGCCCCAAGG + Intronic
1059082466 9:111265205-111265227 ATGATTCAATATCTCCCACCAGG + Intergenic
1062104973 9:134750377-134750399 ATGTTTCAGAAACCCCCACCCGG - Intronic
1203779047 EBV:90652-90674 ATGTTTCAACCGCTCCGACTGGG - Intergenic
1186399190 X:9241153-9241175 ATGTTTAACAAGCTCCCTGAGGG + Intergenic
1187058243 X:15761335-15761357 ATGTTTAATAAGATACCACAGGG + Intronic
1189799005 X:44674754-44674776 ATGATTTAAAATCTCCCACCAGG + Intergenic
1195606119 X:106807595-106807617 ATTTCTCAAAATCTCCTACAAGG + Intronic
1195606455 X:106810858-106810880 ATTTTTCAAAACCTCCTACAAGG - Intronic
1196215850 X:113050713-113050735 ATGTTTCAGAATCTCCCCCAAGG - Intergenic
1196251543 X:113465933-113465955 ATTTGTCCAAAGTTCCCACATGG - Intergenic
1197249706 X:124202263-124202285 ATGTTTTAGGTGCTCCCACATGG + Intronic
1197693336 X:129524882-129524904 ATCTTTCAATAGCTGCAACATGG - Intergenic
1197833595 X:130671646-130671668 ATCCCTGAAAAGCTCCCACAGGG + Intronic
1198426051 X:136521263-136521285 ATTTCTCAAAAGCTCCCAGGTGG + Intergenic