ID: 1179052672

View in Genome Browser
Species Human (GRCh38)
Location 21:37901788-37901810
Sequence CTACTCTTCTAGGACTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179052672_1179052675 20 Left 1179052672 21:37901788-37901810 CCTTTAAAGTCCTAGAAGAGTAG 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1179052675 21:37901831-37901853 TCTGAAGTAACACATATGCTTGG 0: 1
1: 0
2: 0
3: 18
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179052672 Original CRISPR CTACTCTTCTAGGACTTTAA AGG (reversed) Intronic
900654855 1:3751550-3751572 CTACTCTTCTAGGTATTTCTTGG + Intergenic
903139418 1:21330178-21330200 CTATTCCTCTGGGCCTTTAAAGG + Intronic
905133842 1:35782662-35782684 TTTTTCTTCTAGCACTTTAAAGG + Intergenic
905461385 1:38125116-38125138 CTACTCTTCTCAAGCTTTAATGG - Intergenic
906293311 1:44633786-44633808 CTACACTTCTAGAACTCTCAGGG + Intronic
906647194 1:47483713-47483735 CTACTCTTGTAGGCCCCTAATGG + Intergenic
906656244 1:47550276-47550298 CTACTCTGCTAAGACTCTTAGGG - Intergenic
912417415 1:109519283-109519305 GTGCTCTTCTGGGCCTTTAAAGG + Intergenic
913260417 1:116992588-116992610 GTTCTCTTCTAGGAGTTTATAGG - Intergenic
913676208 1:121143047-121143069 GTTCTCTTCTAGGAGTTTTATGG + Intergenic
914028103 1:143930991-143931013 GTTCTCTTCTAGGAGTTTTATGG + Intergenic
916925907 1:169520654-169520676 CTTTTCTTCTAGTATTTTAATGG - Exonic
917107035 1:171502702-171502724 CTACTCTAGTAGGCCTTAAAAGG + Intronic
919342607 1:196332418-196332440 CTACTCTTCAAAGACATTAATGG - Intronic
920463574 1:206161885-206161907 GTTCTCTTCTAGGAGTTTTATGG + Intergenic
1063136759 10:3223909-3223931 CCACTCTTATTGGCCTTTAATGG + Intergenic
1063292277 10:4761684-4761706 CTACTGTTCTTGCACTGTAAAGG - Intergenic
1063701863 10:8392894-8392916 CTACTCTTCTATTATTTTAGGGG + Intergenic
1064700671 10:18017246-18017268 CTAATCTTCTAGGATTTTTATGG + Intronic
1066965341 10:42258879-42258901 GTATTCTTCTAGGATTTTTATGG + Intergenic
1067491315 10:46706629-46706651 CTAAACTTCCAGGACTGTAAAGG - Intergenic
1067603349 10:47633749-47633771 CTAAACTTCCAGGACTGTAAAGG + Intergenic
1067741753 10:48900857-48900879 CTACTGATCTATAACTTTAATGG - Intronic
1068417455 10:56742707-56742729 TTACTCTTTTACTACTTTAAGGG - Intergenic
1068481606 10:57596269-57596291 ATTCTCTTCTGGGAGTTTAATGG + Intergenic
1068670866 10:59722136-59722158 CTTATCTTCTAGAACTTTTATGG + Intronic
1068971501 10:62962981-62963003 CTACTCCTCAAGGACTCTCATGG + Intergenic
1068979785 10:63050313-63050335 CTTTTCTTCTAGGATTTTTATGG + Intergenic
1069275177 10:66581748-66581770 GTACTCTTCTAGATCTTTTATGG + Intronic
1072407006 10:95164461-95164483 GTTTTCTTCTAGGACTTTTATGG - Intergenic
1075317223 10:121462586-121462608 CGACTTTTTTAGGACTATAATGG + Intergenic
1078137142 11:8661024-8661046 CTACACTTCTAGCTCTCTAAAGG - Intronic
1078392136 11:10944431-10944453 CTACTCTTCAACAACTTCAATGG - Intergenic
1079019642 11:16898891-16898913 ATACTCTGATAGGACTTTCATGG + Intronic
1082740479 11:56905371-56905393 CTACTTTTCTAGAACTTTCTAGG + Intergenic
1084855861 11:71985778-71985800 CTACTCTTGTAGCATTTAAAAGG + Intronic
1086022146 11:82243226-82243248 CTACTTTTCCAGGTCTTTGAGGG + Intergenic
1087226537 11:95607020-95607042 TGACTCTTTTTGGACTTTAACGG + Intergenic
1087523997 11:99284209-99284231 CTATTGTTCTAGAATTTTAAAGG - Intronic
1088038138 11:105343239-105343261 CTTTTCTTCTAGGATTTTTATGG - Intergenic
1091100758 11:132871022-132871044 CTACTCTTTTAGGAATTTTCAGG - Intronic
1093092849 12:14940578-14940600 GTTTTCTTCTAGGACTTTTATGG - Intergenic
1093237030 12:16622303-16622325 ATACTTTTCTAGGACCTTATGGG - Intergenic
1093564972 12:20591128-20591150 TTACTGTTTTAGGACTTTAGGGG - Intronic
1094005096 12:25740916-25740938 ATACTATTCTAGTACTTTACAGG + Intergenic
1094740823 12:33286671-33286693 GTACTTTTCTAGGACTGTAGTGG - Intergenic
1096340758 12:50796795-50796817 GTTCTCTTCTAGGATTTTTATGG - Intronic
1096766495 12:53894979-53895001 CTACTCTTCTACCACCTTCAAGG - Intergenic
1097838555 12:64298485-64298507 GTTTTCTTCTAGGACTTTTATGG + Intronic
1099182919 12:79488269-79488291 CTACTTTTTAAGGTCTTTAAGGG - Intergenic
1100878078 12:98984216-98984238 CTACCCTTCCAGGAGATTAAGGG - Intronic
1104162615 12:126194306-126194328 TTAGTCTGCTTGGACTTTAATGG + Intergenic
1105668787 13:22589252-22589274 TTATTCTTATGGGACTTTAAGGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107798743 13:44083061-44083083 CTTTTCTTCTAGGATTTTTATGG + Intergenic
1109153951 13:58880727-58880749 ATATTCTTCTAGGACTTTCATGG + Intergenic
1109389829 13:61678797-61678819 GTTTTCTTCTAGGATTTTAATGG + Intergenic
1109799036 13:67350433-67350455 CTTTTCTTCTAGGGCTTTTATGG + Intergenic
1114068016 14:19082457-19082479 GTTCTCTTCTAGGAGTTTTAAGG - Intergenic
1114094247 14:19317564-19317586 GTTCTCTTCTAGGAGTTTTAAGG + Intergenic
1116276401 14:42839109-42839131 CTACGATCCTAGGACTTTATAGG - Intergenic
1117976676 14:61304849-61304871 CTATTCTTTCAGTACTTTAATGG + Intronic
1120101990 14:80455334-80455356 CTACTCCTCTAGGTCATTAAAGG - Intergenic
1120293875 14:82613528-82613550 TAACTGTTCTAGCACTTTAATGG + Intergenic
1121017519 14:90557526-90557548 CTGTTCTTCTAGGACTTGAGTGG + Intronic
1122077359 14:99245136-99245158 CTGCTTTTCTGGGCCTTTAAGGG + Intronic
1123964399 15:25439969-25439991 GTACTCATCTAGTACTTCAAGGG - Intergenic
1124145821 15:27124309-27124331 CTAATCTTCTAGGATCTTCAGGG + Intronic
1126528154 15:49681261-49681283 GTTTTCTTCTAGGACTTTTATGG - Intergenic
1130513510 15:84608087-84608109 CTTGTCTTCTAGGATTTTACAGG - Intronic
1131592408 15:93763882-93763904 CTGGTCTTGTAGCACTTTAAGGG + Intergenic
1134986727 16:18659307-18659329 CTAACCTTGTAGGATTTTAAAGG + Intergenic
1136772299 16:32851556-32851578 GTTTTCTTCTAGGACTTTTATGG - Intergenic
1136898313 16:34009965-34009987 GTTTTCTTCTAGGACTTTTATGG + Intergenic
1139720386 16:68847691-68847713 ATATTCTTCTAGGACTTTCCAGG - Intronic
1203074722 16_KI270728v1_random:1113645-1113667 GTTTTCTTCTAGGACTTTTATGG - Intergenic
1147471838 17:40669652-40669674 CTTATCCTCTAGGAGTTTAATGG - Intergenic
1149253688 17:54800069-54800091 GTATTCTTCTAGGATTTTTATGG - Intergenic
1150649696 17:67001718-67001740 CTGCTCTTCCAGGACTTCAGGGG + Intronic
1153066889 18:1055989-1056011 CGTCTCTTCTAGGAGTTTTATGG + Intergenic
1154188887 18:12210959-12210981 CTACTCTTATAGGCTGTTAAAGG - Intergenic
1156037812 18:32785361-32785383 CTATTCTTCTAGGCCAGTAAGGG - Intergenic
1157406812 18:47428635-47428657 CCACTCCTCAAGGATTTTAAGGG + Intergenic
1158221611 18:55156847-55156869 GTTTTCTTCTAGGACTTTTATGG - Intergenic
1164954535 19:32370831-32370853 ATTCTCTTCTAGGAATTTGATGG + Intronic
925087727 2:1123593-1123615 GTTCTCTTCTAGGAGTTTTATGG - Intronic
925647882 2:6055426-6055448 CCCATCTTCTAAGACTTTAAAGG + Intergenic
930061189 2:47290290-47290312 CTATTCTCCTAGGACTTTTATGG + Intergenic
932931116 2:76040565-76040587 ATTTTCTTCTAGGACTTTTATGG - Intergenic
933487781 2:82945356-82945378 ATATTCTTCTAGGATTTTTATGG + Intergenic
934617521 2:95783490-95783512 GTATTCTTCTAGGGTTTTAATGG - Intergenic
934643372 2:96041069-96041091 GTATTCTTCTAGGGTTTTAATGG + Intergenic
935903930 2:107822859-107822881 CTACTCATCAAGGAATTTGAAGG + Intergenic
937405962 2:121629428-121629450 CTGTTCTTATTGGACTTTAAAGG + Intronic
937780445 2:125830555-125830577 GTTTTCTTCTAGGACTTTTATGG - Intergenic
938392804 2:130918166-130918188 GTTGTCTTCTAGTACTTTAATGG + Intronic
938804896 2:134796901-134796923 CTTCTCTTCTTTGCCTTTAATGG + Intergenic
940395667 2:153187725-153187747 CTACTCTTCTATTCCTTTATCGG + Intergenic
941409471 2:165135987-165136009 CTACAATTCTATGACTTTATGGG - Intronic
941968857 2:171328434-171328456 CTACTTTTCTAGAACTTTTCTGG + Intronic
942845632 2:180421304-180421326 GTTTTCTTCTAGGACTTTTATGG + Intergenic
943163567 2:184286165-184286187 CTACTCTTCTATCATTTTAGAGG + Intergenic
943246016 2:185451571-185451593 CTACTCCTCTGGGCCTGTAATGG + Intergenic
943684198 2:190799854-190799876 CTGCTATTCTAGGACTTTTAAGG - Intergenic
944305780 2:198177290-198177312 GTACTTTTCTAGGATTTTTATGG + Intronic
944529191 2:200650734-200650756 CTACTCTTGTGCAACTTTAAAGG - Intronic
945160015 2:206880221-206880243 GTTCTCTTCTAGGAGTTTTATGG + Intergenic
946378043 2:219325813-219325835 CTACTCTTAAAGGTCTTTGAGGG + Intergenic
948557404 2:238822706-238822728 CTAGTCTTCTAAGTCTTGAAGGG - Intergenic
1170381868 20:15769776-15769798 CTTCTCTTCGAAGAGTTTAAAGG + Intronic
1177918240 21:27117605-27117627 TTACTATTCTAGGCCCTTAAAGG - Intergenic
1178446962 21:32653914-32653936 TTACTCTTTTGGGACTTCAATGG + Intronic
1178535515 21:33406987-33407009 CTACTCTTACAGAACTCTAAGGG - Intronic
1179052672 21:37901788-37901810 CTACTCTTCTAGGACTTTAAAGG - Intronic
1179730535 21:43364928-43364950 CTACTTACCTTGGACTTTAAGGG + Intergenic
1180486490 22:15805024-15805046 GTTCTCTTCTAGGAGTTTTAAGG - Intergenic
1185112543 22:48909168-48909190 GTTCTCTTCTAGAAGTTTAATGG + Intergenic
949846555 3:8376915-8376937 GTTTTCTTCTAGGACTTTTATGG - Intergenic
950412168 3:12846139-12846161 CTAGGCCTCTAGGACTGTAATGG - Intronic
951434335 3:22643899-22643921 CACCTCTTCTAGAACTTTTATGG + Intergenic
952199273 3:31109532-31109554 GTAATCTTCTAGAATTTTAATGG + Intergenic
953036471 3:39215907-39215929 CTAGAATTCTAGAACTTTAAAGG + Intergenic
955353724 3:58213183-58213205 GAACTTTTCTAGGACTTTGATGG - Intronic
955554969 3:60127034-60127056 CTAGTATTCTAGGACTTTTCAGG + Intronic
956392449 3:68788070-68788092 GTACTCTTCTGGGGCTATAATGG - Intronic
956949895 3:74270308-74270330 ATACTCTTCAATGACTTTTATGG - Intronic
957261447 3:77907306-77907328 TTTCTCTTCTAGGAGTTTTACGG - Intergenic
957675442 3:83357903-83357925 CTACTCCTCCAGGCCTCTAATGG + Intergenic
958114994 3:89203822-89203844 CCACTCTTCTAGGAGCTTTAAGG - Intronic
959110531 3:102117159-102117181 CTAGTGTTCTAAGAATTTAAGGG + Intronic
960587492 3:119334055-119334077 CCACTCTTCTTTGTCTTTAAAGG - Intronic
962602363 3:137002874-137002896 GTTTTCTTCTAGGACTTTTATGG + Intronic
964744854 3:160002840-160002862 CTACTTTTCTTGGACTTTCACGG - Intergenic
965654607 3:170970560-170970582 GTTTTCTTCTAGGATTTTAATGG + Intergenic
966019471 3:175190092-175190114 GTACTCTTCCAGGAGTTTGATGG - Intronic
966346306 3:178984471-178984493 GTTTTCTTCTAGGGCTTTAATGG + Intergenic
967709843 3:192693780-192693802 GTATTCTTCTAGGAGTTTTACGG - Intronic
970038689 4:11770948-11770970 CCACTGTTCTAGAACTTAAACGG + Intergenic
970276287 4:14404691-14404713 CTAGTCTTCAAGGGCTTTAAGGG - Intergenic
971198337 4:24490342-24490364 GTACTCTTCTGGGACTTTTGAGG + Intergenic
972156229 4:36166199-36166221 CAATTGTTCTAGGCCTTTAAAGG - Intronic
973132343 4:46663258-46663280 GTTTTCTTCTAGGACTTTTATGG + Intergenic
973257371 4:48127086-48127108 CCACTGTTCTTGGACTTTGAGGG - Intronic
974745241 4:66064753-66064775 CTACTATTCTAGGTGATTAAGGG - Intergenic
975605674 4:76151786-76151808 CAAATCTTGAAGGACTTTAAAGG - Intergenic
977715541 4:100179182-100179204 CTACTCCTGTGGGACTTAAAGGG + Intergenic
978213901 4:106174105-106174127 CTGCTCTTCTCTCACTTTAATGG + Intronic
980075493 4:128288642-128288664 CTGCTCTTGTAGAATTTTAAAGG + Exonic
980926903 4:139146912-139146934 GTTATCTTCTAGGACTTTTATGG - Intronic
987859869 5:23470842-23470864 CTACTCTCCTAGGAATTCATTGG + Intergenic
989955057 5:50348862-50348884 CTACTCTTCTTGGGTTTTTATGG + Intergenic
990696082 5:58419251-58419273 CTTCTAATCTAGAACTTTAAAGG - Intergenic
990873348 5:60457657-60457679 CTAGGATTCTAGGACTTCAAGGG - Intronic
991059114 5:62352774-62352796 TTACTCTTTGAGGACTTAAAAGG - Intronic
991115633 5:62951409-62951431 GTTTTCTTCTAGGACTTTTATGG + Intergenic
991118986 5:62989038-62989060 GTTCTCTTCTAGGATTTTTAAGG - Intergenic
991637891 5:68724550-68724572 CTCCTCTGCCAGGATTTTAATGG - Intergenic
993173439 5:84451545-84451567 CTACTATTCTGGGACTCTACAGG + Intergenic
993295866 5:86138945-86138967 TTATTCTTCTGGGACTCTAATGG - Intergenic
994343195 5:98656025-98656047 CTATACTTCAAAGACTTTAAAGG - Intergenic
995468550 5:112476126-112476148 ATACTTTTCTAAGACTTTCATGG + Intergenic
995491530 5:112697418-112697440 GTATTCTTCTAGTACTTAAAGGG - Intergenic
996178854 5:120393973-120393995 ATTTTCTTCTAGGAGTTTAACGG - Intergenic
999682534 5:154073526-154073548 CAGCTCTTCTAGGACTTTTTAGG - Intronic
1000642189 5:163716105-163716127 CTACTCTTTCAAGACTTGAATGG + Intergenic
1001127605 5:169034354-169034376 GTTCTCTTCTAGGAGTTTTATGG + Intronic
1002257617 5:177970249-177970271 ATTCTCTTCTAGGAGTTTCATGG - Intergenic
1002352366 5:178592039-178592061 CTATTCTTCCAGGACCCTAATGG - Intergenic
1006339419 6:33438501-33438523 ATACTCTTCTATGGCTTTAGTGG - Exonic
1008144503 6:47875175-47875197 CTTCTCTTCTAGGAGTTGATTGG + Intergenic
1008495034 6:52124610-52124632 CCACTCTGCTAGGACTCTAGAGG - Intergenic
1009384935 6:63076617-63076639 CTACTCTACTATAACTTTAGTGG + Intergenic
1009560368 6:65233648-65233670 CTTCTCTTATTGTACTTTAAAGG + Intronic
1009756622 6:67948259-67948281 GTTTTCTTCTAGGACTTTTATGG + Intergenic
1009942827 6:70308741-70308763 CTACTATTCTATGAGTTTCATGG - Intergenic
1010036088 6:71327593-71327615 CTTTGCTTCTAGGACTTTCACGG + Intergenic
1010403292 6:75473219-75473241 ATAATATTATAGGACTTTAAAGG + Intronic
1010645646 6:78385329-78385351 CTAGTCTTCCAGTACTTTCAGGG - Intergenic
1011337694 6:86279252-86279274 CTTTTCTTCTAGGATTTTTATGG + Intergenic
1011409681 6:87055051-87055073 AAAGTCTTCAAGGACTTTAAGGG - Intergenic
1012364707 6:98424432-98424454 GTATTCTTCTAGGATTTTTATGG + Intergenic
1013643071 6:112107124-112107146 CTACTTTTTCAGGACTTAAAAGG + Intergenic
1014652442 6:124056617-124056639 ATAATCTTCTAAGACATTAATGG + Intronic
1015730675 6:136344745-136344767 CCACTTTTCTAGGATTTGAAGGG - Intronic
1016400708 6:143677755-143677777 CTACTCCTCTTTGACTTAAAAGG - Intronic
1017969135 6:159295882-159295904 TTACATTTCTAGGACTTTAAAGG - Intergenic
1020329904 7:7006912-7006934 CTTTTCTTCTAGGGCTTTTATGG + Intergenic
1021350120 7:19582216-19582238 CTTCTCTTCTAAAACTTTGAAGG - Intergenic
1023457091 7:40351509-40351531 CTACTCTTATAAGATTTTCAAGG + Intronic
1027457025 7:78404705-78404727 GTATTCTTCTAGGATTTTTATGG - Intronic
1027758429 7:82247062-82247084 CTACTTTTCTAGGTCTTTTGGGG + Intronic
1027802041 7:82766454-82766476 CTACTTTTCTATGGCTTTAAAGG - Intronic
1028784194 7:94773696-94773718 CTAGTCTTCCAGGTCTGTAATGG - Intergenic
1030411608 7:109188305-109188327 CGGCTCTTAAAGGACTTTAAGGG + Intergenic
1030501035 7:110358929-110358951 GTTCTCTTCTAGGAGTTTTATGG + Intergenic
1030853774 7:114524956-114524978 AATCTCCTCTAGGACTTTAAGGG - Intronic
1032289101 7:130571086-130571108 CCAGTGTTCTAGGATTTTAATGG - Intronic
1034065994 7:148137105-148137127 TAACTCTTCTACAACTTTAAAGG + Intronic
1038177804 8:25197109-25197131 CTACTCTCCGTGGACATTAAAGG + Intronic
1040004330 8:42605993-42606015 GTTCTCTTCTAGGAGTTTTATGG + Intergenic
1040747182 8:50659455-50659477 CTACTCTGCTAAGTCTTTAACGG - Intronic
1041694347 8:60720013-60720035 TTAATCTTCTAGGTTTTTAATGG + Intronic
1042148687 8:65758766-65758788 CTTCTGTTCTAGTTCTTTAATGG + Intronic
1043175764 8:77021747-77021769 CTTTTCTTCTAGGATTTTTATGG - Intergenic
1043618148 8:82153821-82153843 CTATTTTTCTAGGAGTTTTATGG + Intergenic
1043929741 8:86076977-86076999 GTTTTCTTCTAGGACTTTTATGG + Intronic
1045960456 8:107961962-107961984 CTACTCTTCAAGGAAAGTAAAGG + Intronic
1046474994 8:114730578-114730600 CAACTTTTATAGGGCTTTAAGGG - Intergenic
1046491229 8:114954623-114954645 CAACTCTTCTATCACTTTACTGG - Intergenic
1046697386 8:117357223-117357245 CTACTGTGCTTGGACTTTACAGG + Intergenic
1047551205 8:125874001-125874023 CTCTTCTCCTAGGAATTTAATGG + Intergenic
1050163340 9:2740347-2740369 CTACTCTTCAAGGAATTAGAGGG + Intronic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1054698107 9:68382396-68382418 GTTCTCTTCTAGGATTTTTATGG - Intronic
1055452092 9:76440300-76440322 ATAATCTTCAAGGAATTTAAAGG + Intronic
1058970272 9:110075202-110075224 CTACTCTTCTAAGGCTTGAATGG + Intronic
1187853252 X:23611834-23611856 CTAGTCTTTTAGTACTTTAAGGG + Intergenic
1188786955 X:34358624-34358646 CTAAACTTCTAGGACTTCAGAGG + Intergenic
1190358730 X:49629400-49629422 GTTTTCTTCTAGGACTTTTATGG + Intergenic
1195048314 X:101074772-101074794 CCAATCTTCTAGGACTCTCATGG + Intergenic
1195064917 X:101232041-101232063 ATACTCTTCTAGGACATTCCTGG - Intronic
1195138517 X:101934240-101934262 CTTCTGTCCTAGGACTTTACTGG - Intergenic
1195620029 X:106943586-106943608 ATACTCTTCTAGGCTTTTTATGG - Intronic
1197286499 X:124601383-124601405 GGACTCTTCGAGGACTGTAATGG + Intronic
1198108373 X:133481935-133481957 CTACTCTCCTAGGACTTCTAAGG - Intergenic
1199853879 X:151744200-151744222 CCTCTCTTCTAGGACTTTCTTGG - Exonic
1200825062 Y:7628885-7628907 GTTTTCTTCTAGGATTTTAAAGG + Intergenic
1201054264 Y:9973134-9973156 GTTTTCTTCTAGGATTTTAATGG - Intergenic
1202202764 Y:22371829-22371851 ATTTTCTTCTAGGATTTTAATGG - Intronic
1202234994 Y:22702202-22702224 GTTTTCTTCTAGGATTTTAAAGG - Intergenic
1202308165 Y:23493966-23493988 GTTTTCTTCTAGGATTTTAAAGG + Intergenic
1202562636 Y:26176620-26176642 GTTTTCTTCTAGGATTTTAAAGG - Intergenic