ID: 1179053220

View in Genome Browser
Species Human (GRCh38)
Location 21:37906981-37907003
Sequence TTGAAACTAGATTTCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179053217_1179053220 -6 Left 1179053217 21:37906964-37906986 CCCATTCGTTGCCATTATTGAAA 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1179053220 21:37906981-37907003 TTGAAACTAGATTTCTTGAGAGG 0: 1
1: 0
2: 4
3: 20
4: 225
1179053218_1179053220 -7 Left 1179053218 21:37906965-37906987 CCATTCGTTGCCATTATTGAAAC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1179053220 21:37906981-37907003 TTGAAACTAGATTTCTTGAGAGG 0: 1
1: 0
2: 4
3: 20
4: 225
1179053216_1179053220 -5 Left 1179053216 21:37906963-37906985 CCCCATTCGTTGCCATTATTGAA 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1179053220 21:37906981-37907003 TTGAAACTAGATTTCTTGAGAGG 0: 1
1: 0
2: 4
3: 20
4: 225
1179053214_1179053220 27 Left 1179053214 21:37906931-37906953 CCTTGGGAGACAGCTGAAGAGGA 0: 1
1: 0
2: 3
3: 30
4: 262
Right 1179053220 21:37906981-37907003 TTGAAACTAGATTTCTTGAGAGG 0: 1
1: 0
2: 4
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179053220 Original CRISPR TTGAAACTAGATTTCTTGAG AGG Intronic
903403137 1:23072464-23072486 TGGAAATTATCTTTCTTGAGAGG + Intronic
904201219 1:28820480-28820502 CTGGAACTAGAATTATTGAGTGG + Intronic
904245415 1:29184436-29184458 TTCAAAATAGATTTCTTGCCGGG - Intergenic
905842455 1:41194462-41194484 GTGAAATTAGATTTCATCAGAGG + Intronic
909105927 1:71408301-71408323 TTGAAACTAGACCTCTAGACAGG + Intronic
909546791 1:76857232-76857254 TTTAAACAAGCATTCTTGAGTGG - Intergenic
910496697 1:87837300-87837322 TTGAAACTACATCTCTTGTCTGG - Intergenic
910864399 1:91775101-91775123 TAGAAACTAGATTACTAGAGTGG - Intronic
911287195 1:96010215-96010237 TTGGAACCAGATTTTGTGAGGGG + Intergenic
911504452 1:98731100-98731122 TTAAAACTATTTTTCCTGAGAGG - Intronic
913503562 1:119494964-119494986 TTTAAAATAAATTTCTGGAGTGG + Intergenic
913660464 1:121002333-121002355 GTGAATCAAGATTTCTTCAGTGG + Intergenic
914011827 1:143785490-143785512 GTGAATCAAGATTTCTTCAGTGG + Intergenic
914166005 1:145175644-145175666 GTGAATCAAGATTTCTTCAGTGG - Intergenic
914650455 1:149694149-149694171 GTGAATCAAGATTTCTTCAGTGG + Intergenic
915231150 1:154446202-154446224 TTGAACCTAGAATTCATGGGAGG - Intronic
916321242 1:163506930-163506952 TAGAAACTAGATATATTCAGTGG - Intergenic
916427842 1:164698680-164698702 TTGAAATCAGAGGTCTTGAGTGG - Intronic
916907774 1:169307321-169307343 ATGAAACTTGATTTCCAGAGGGG + Intronic
917349698 1:174064182-174064204 TTGCAAATAGCTTTCTTGGGAGG - Intergenic
919434428 1:197539317-197539339 TTCAAAAAAGAATTCTTGAGTGG - Intronic
920921058 1:210297589-210297611 TAGAATCTGAATTTCTTGAGTGG - Intergenic
924900367 1:248391825-248391847 CTGATACTATATTTCTTGATTGG + Intergenic
1064450738 10:15440053-15440075 TTGAAAAAAAATTTCTTGAGCGG + Intergenic
1065680666 10:28228282-28228304 TTTAAACTGGATTCCTTGAGTGG + Intronic
1067133597 10:43588394-43588416 TTGGAATAATATTTCTTGAGTGG - Intergenic
1067144885 10:43687802-43687824 TTGTGACTAGATTCCTGGAGGGG + Intergenic
1069152416 10:64980690-64980712 TTGAAAAAAAATTTCATGAGTGG + Intergenic
1069324428 10:67215527-67215549 TTTAAACTAGATTTTTGGATGGG + Intronic
1069463636 10:68618186-68618208 TATAAACTAGATTTCATGAGTGG - Intronic
1071434952 10:85640137-85640159 CTCAAACTACATTTCTTGAATGG + Intronic
1072852739 10:98913796-98913818 TTAAAAGCAGATTTCTTGAAAGG + Intronic
1075366996 10:121900073-121900095 TTGAAACTTGGTTTCTTGGATGG - Intronic
1075927974 10:126268718-126268740 TTCAAACTCGTTATCTTGAGTGG - Intronic
1076049945 10:127324377-127324399 TGGAAAGTAGATTTCTTGCAGGG + Intronic
1078228805 11:9419784-9419806 CTGAAACTAGATTTCTGAAATGG + Intronic
1081250017 11:40818046-40818068 TTTAAACAAGATTTCTTAAGTGG + Intronic
1082205272 11:49425875-49425897 TTGAAACAAGTTTTCTTAGGAGG - Intergenic
1082278371 11:50245579-50245601 TGGAAACTAGTTTTCTTCAGAGG - Intergenic
1082284067 11:50301175-50301197 TTGAAAAAGGATTTCTTGACCGG + Intergenic
1085370725 11:76002378-76002400 TTGCAAGGAGTTTTCTTGAGGGG + Intronic
1085596164 11:77812232-77812254 TTAAAACTAGATTTCTAAAGAGG - Intronic
1085842690 11:80030834-80030856 TTGACAATAGTTTTCTTCAGGGG + Intergenic
1086649828 11:89274661-89274683 TTGAAACAAGTTTTCTTATGAGG + Intronic
1088294809 11:108281231-108281253 TTAAAGCTAGATTTTCTGAGTGG + Intronic
1090220346 11:125016240-125016262 GTGAAAATAGATTTCCTGTGAGG + Intronic
1090593607 11:128296986-128297008 TTCAAACAAGATCTCATGAGTGG + Intergenic
1092468074 12:8752603-8752625 TTCAAACTATATATCTTTAGAGG - Intronic
1094033975 12:26047390-26047412 TTTTAACTAGAATTCTTGAGAGG + Intronic
1094336750 12:29365844-29365866 TTCAAAATCGATTTTTTGAGTGG + Intronic
1095792905 12:46186692-46186714 TTTAAAATAGATTTATTTAGAGG - Intronic
1097605950 12:61754725-61754747 TTGAAACTAGAATATTTGGGTGG - Intronic
1097993602 12:65863137-65863159 ATGAAACTAGAATTCTTTTGGGG + Intronic
1098537884 12:71615908-71615930 TTTAAACTAGGTTTATTTAGAGG - Intronic
1100897246 12:99197363-99197385 TAGAAACTGGAGTTCTTGGGAGG - Intronic
1104230146 12:126876835-126876857 TTGAAACTGGATGAATTGAGGGG - Intergenic
1106580242 13:31011518-31011540 TTGAAATTCTGTTTCTTGAGTGG - Intergenic
1106830425 13:33575483-33575505 TTGAAACTTGATTTCTGCTGTGG + Intergenic
1107531136 13:41283325-41283347 TTGAAACTTGATGTCTTGGTCGG - Intergenic
1108926103 13:55747932-55747954 TTCAAACTGGATCTCTTGAATGG + Intergenic
1109628819 13:65015981-65016003 TTGAAATTATGTTTCTTTAGGGG - Intergenic
1111554652 13:89864731-89864753 TTGAAACTAGAAGTATTCAGAGG + Intergenic
1112222055 13:97500943-97500965 TAGAAGCTAGATCTCTTGAATGG - Intergenic
1113165509 13:107436302-107436324 TTGAATCTAGATTTTTTTAAAGG + Intronic
1114910385 14:27187499-27187521 TTGGCACAAGATTTCTTGGGAGG - Intergenic
1114918827 14:27300449-27300471 TTGAAAGTATATTTCATGAATGG + Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1116238402 14:42310741-42310763 TTGGAGCAATATTTCTTGAGTGG + Intergenic
1118771183 14:68943752-68943774 TTTAACCTAGAATTGTTGAGTGG - Intronic
1120330349 14:83085042-83085064 TTGACAATATATATCTTGAGGGG + Intergenic
1123678350 15:22735944-22735966 TGGAAGCTAGATTTCTTGATGGG + Intergenic
1124330540 15:28810213-28810235 TGGAAGCTAGAGTTCTTGATGGG + Intergenic
1126517407 15:49551952-49551974 TTGAAATTATAATTTTTGAGTGG + Intronic
1126770743 15:52053581-52053603 TTGAAACAAGATTGATTGATTGG + Intronic
1129973474 15:79801272-79801294 TTGATAATAGTTTTCATGAGAGG + Intergenic
1130010691 15:80151409-80151431 TTGAAACCAGACGGCTTGAGAGG - Intergenic
1133691593 16:8220867-8220889 TTGAATCCAGATTTCTTGAGTGG - Intergenic
1135433225 16:22405192-22405214 TGGAAACTAAATGTTTTGAGGGG + Intronic
1139122426 16:64036742-64036764 TGTAAACTAGATTTGTTGACAGG + Intergenic
1144289060 17:13807946-13807968 TTGATCATAGAATTCTTGAGAGG - Intergenic
1146101709 17:29989274-29989296 TTGGAATAATATTTCTTGAGTGG + Intronic
1149940267 17:60856781-60856803 TTTAAACCAGATTTCTTAAAAGG - Intronic
1150553471 17:66232331-66232353 TTGAAAGTGGCTTTCTTGACTGG + Intronic
1153587329 18:6636164-6636186 TTGAAACTTAACTACTTGAGTGG + Intergenic
1156687249 18:39665127-39665149 TTGAAAGCAGATTTTTTTAGAGG + Intergenic
1156979838 18:43272932-43272954 TTGAAACTCGATTTCAACAGTGG - Intronic
1163877689 19:19887978-19888000 TTGAAAGTATGTTTCTTGACTGG + Intronic
1163954821 19:20627624-20627646 TTGAAAGTATATCTCTTGATTGG - Intronic
1164306213 19:24005819-24005841 TTGGAATAATATTTCTTGAGTGG + Intergenic
1166259795 19:41629456-41629478 CTTAAACTAGATTTTTTGTGTGG + Intronic
925359001 2:3264265-3264287 ATGAACCTAGAGGTCTTGAGTGG - Intronic
926604428 2:14882997-14883019 CTAAAATTAGATTTCTTAAGGGG + Intergenic
926664399 2:15504687-15504709 TAGAAACTATATTTTTTCAGTGG + Intronic
926836502 2:17029434-17029456 TTGAGAATACATTTTTTGAGAGG + Intergenic
927042406 2:19242620-19242642 TTGAAATTTCATTTTTTGAGTGG - Intergenic
928883023 2:36118680-36118702 TTAAAAATACATTTTTTGAGTGG + Intergenic
928896445 2:36270330-36270352 TTGATTATAAATTTCTTGAGTGG + Intergenic
929396738 2:41532097-41532119 TTGAAAGAAGGTCTCTTGAGTGG + Intergenic
930507305 2:52299663-52299685 TAGAAATTAGATTTCTTGAGAGG + Intergenic
930580121 2:53201126-53201148 TTGACACTTGATTACTTGAAGGG - Intergenic
930817476 2:55613103-55613125 TTGAAAATAATTTTTTTGAGAGG - Intronic
932010593 2:67973823-67973845 CTGAACCTAGATTTCTTGACTGG + Intergenic
933510631 2:83237013-83237035 ATGAAACCAGACATCTTGAGAGG + Intergenic
933945476 2:87282790-87282812 TTGAAAATAGTTCTCTTAAGCGG + Intergenic
936334733 2:111578798-111578820 TTGAAAATAGTTCTCTTAAGCGG - Intergenic
936875195 2:117180673-117180695 TTTAAAATAGATTTCATCAGTGG - Intergenic
939584122 2:143986414-143986436 TAGAATTTAGATTCCTTGAGGGG - Intronic
940608319 2:155957127-155957149 TTGAACCTCGATTTCTTCATTGG - Intergenic
941256969 2:163243957-163243979 TTGAAAATAGATATTTGGAGAGG + Intergenic
941686157 2:168451219-168451241 TACAAAGTAGCTTTCTTGAGAGG + Intergenic
941723604 2:168837900-168837922 TTTAAATTAGATTTCTTTATGGG + Intronic
942277209 2:174332213-174332235 TAAAAACTAGATTTTTTTAGAGG + Intergenic
945695759 2:213102162-213102184 TTTAAACTAGAATTTGTGAGCGG + Intronic
947430016 2:230019662-230019684 TTGAAAATAACTTTCCTGAGTGG - Intergenic
947590374 2:231381781-231381803 TGGAAACTTGTTTTCCTGAGTGG - Intergenic
1174198139 20:48787715-48787737 TTGCAACCAGACTTCTTTAGGGG - Intronic
1174938337 20:54896689-54896711 CTGAAACAAAATATCTTGAGTGG - Intergenic
1176156694 20:63625908-63625930 TTTAAACTAGTATTCTTGACCGG + Intronic
1177405094 21:20656483-20656505 TAGAAACAAGATCTCTTAAGAGG + Intergenic
1177865667 21:26510072-26510094 TTGAAAATAGAGTTCCAGAGCGG - Intronic
1177927144 21:27232316-27232338 TTGAATGTAGGTTTATTGAGAGG + Intergenic
1178320784 21:31604021-31604043 TTGAGGCTTGATTTCTTGTGGGG - Intergenic
1179053220 21:37906981-37907003 TTGAAACTAGATTTCTTGAGAGG + Intronic
1182110060 22:27716835-27716857 TGGAAACTTGAGTTCCTGAGAGG - Intergenic
1184488680 22:44796557-44796579 TTGAAGCTTCATTTCTTCAGTGG - Intronic
950453018 3:13076104-13076126 TTGTAACCAGATGTCTGGAGTGG + Intergenic
951412827 3:22385979-22386001 ATGCAACTACATTTCTTCAGAGG - Intergenic
951866974 3:27319585-27319607 TTCATACTATATTTCTTGAAAGG - Intronic
953254182 3:41273660-41273682 TTGAAATTTGATTGCTAGAGTGG + Intronic
954232774 3:49230613-49230635 TTGGAGCAATATTTCTTGAGTGG - Intronic
955027947 3:55188564-55188586 TTTAAGATGGATTTCTTGAGAGG + Intergenic
955922020 3:63967113-63967135 TTGACAGTAGATTTGTTGATTGG + Intronic
956505139 3:69929876-69929898 TGGAAACAATATTTCTTGATGGG + Intronic
957951273 3:87130257-87130279 TTGAAACAAGATATACTGAGAGG + Intergenic
958129301 3:89397423-89397445 TTCAAACTAGATTTCAGGACTGG + Intronic
958255596 3:91321232-91321254 TTAAAAGTAGAATTCTTTAGAGG - Intergenic
958714950 3:97768900-97768922 TTGAAATGGGACTTCTTGAGGGG + Intronic
959643001 3:108662920-108662942 TTTAAACTAGACTTCTTGGATGG - Intronic
959861503 3:111221104-111221126 TTACAACTAGCTTTCTGGAGGGG + Intronic
960245088 3:115391498-115391520 TGGCAACTAGAATTCTTGATAGG - Intergenic
960250962 3:115452816-115452838 CTGAAACCAGATTTTTAGAGTGG + Intergenic
963871487 3:150419958-150419980 TTCAAATTTTATTTCTTGAGTGG + Intronic
964242030 3:154605989-154606011 CTGAAACTAGGTTTCTTTATTGG - Intergenic
964329217 3:155582731-155582753 TTTATATTAGACTTCTTGAGAGG - Intronic
965315002 3:167180531-167180553 TTGGAATAATATTTCTTGAGTGG + Intergenic
965327308 3:167323204-167323226 TTGAAACAAGATTTCTTGACAGG + Intronic
965758411 3:172049338-172049360 TTAAAAGTAGATCTCTGGAGGGG + Intronic
966046803 3:175561422-175561444 TTGAAACTAATTTTTTTTAGTGG + Intronic
970627532 4:17905113-17905135 TTAAAACTAGATTTTCTGATTGG + Intronic
973038442 4:45438617-45438639 TAGAAGCTTGATTTCTTTAGAGG + Intergenic
973829703 4:54746334-54746356 TTGAAATAAAAGTTCTTGAGTGG + Intergenic
974105544 4:57466031-57466053 TTGAACAAATATTTCTTGAGAGG + Intergenic
974844469 4:67334598-67334620 TTGAAAATAGGATTTTTGAGGGG - Intergenic
975985050 4:80194948-80194970 TTTAAACTATATTTCTTTTGAGG - Intronic
976471639 4:85435990-85436012 TTGAAAATAAATTGCTTTAGAGG + Intergenic
977142164 4:93387100-93387122 TTGGAGCTGGATTCCTTGAGAGG + Intronic
977237115 4:94521601-94521623 TACATACTAGATCTCTTGAGAGG - Intronic
977278880 4:95014328-95014350 TTGAATCTACAATTCTTCAGTGG - Intronic
979365659 4:119819798-119819820 TCCCAACTAGATTTCCTGAGAGG - Intergenic
980020055 4:127698118-127698140 TTTTAACTAGATTTCTTTTGTGG - Intronic
981969864 4:150654483-150654505 TTGAAAATAGACTTCTTGACTGG - Intronic
982860823 4:160446940-160446962 TTGAAAATACATTTTTTGGGGGG - Intergenic
983449607 4:167894446-167894468 TTTAATCCATATTTCTTGAGAGG + Intergenic
984123507 4:175776087-175776109 TTGAAACCAGATTTTTTTAAAGG + Intronic
984555040 4:181203330-181203352 TTAAAACTAGATGTCTTTGGAGG - Intergenic
990396849 5:55390888-55390910 TGGAAATCAGATTTTTTGAGGGG + Intronic
991201784 5:64003140-64003162 TTAATATTAAATTTCTTGAGTGG + Intergenic
991457089 5:66815776-66815798 TTGAATCCAGTTTTCTTTAGAGG + Intronic
991772523 5:70053016-70053038 TTGAAACTGCATTTATGGAGAGG + Intronic
991851816 5:70928440-70928462 TTGAAACTGCATTTATGGAGAGG + Intronic
992517816 5:77513293-77513315 ATGAAACTTGAATTCTTCAGTGG + Intronic
992541728 5:77772159-77772181 TTGAAACTAAATTTGGAGAGAGG + Intronic
993467954 5:88270526-88270548 TTTAAACTTGATTTTGTGAGGGG + Intergenic
993530132 5:89014193-89014215 TTGAAAAGTGATCTCTTGAGTGG + Intergenic
995078263 5:108013861-108013883 TTGAAAATAGATATCTTGAGTGG - Intronic
995580939 5:113601476-113601498 TTGAAAATAGATTTGTGTAGGGG - Intergenic
996019881 5:118579319-118579341 TAGAAACTAAATATCTTGGGGGG + Intergenic
996241058 5:121202525-121202547 TTGAAAGTGGATTCTTTGAGAGG + Intergenic
996421282 5:123265672-123265694 ATGAAACCAGATTCCTTCAGAGG - Intergenic
1000617493 5:163444402-163444424 TAGAAACTAGTTTTCTTGATGGG - Exonic
1002612215 5:180427891-180427913 CTGACACTAGATTTCTTGTCTGG - Intergenic
1002755267 6:153304-153326 CTGAAACTTGATATCTAGAGAGG - Intergenic
1003637684 6:7848147-7848169 TTGAAACTATATTTGTAAAGAGG + Intronic
1005341681 6:24849460-24849482 TTCAAATTAGTTTACTTGAGAGG + Intronic
1006206896 6:32353793-32353815 TTCCAACTAGATTTATTGACTGG - Intronic
1007864982 6:44958453-44958475 TTGAAAATAGCCTTCTTCAGAGG + Intronic
1008717645 6:54308205-54308227 AAGAACCTAGATTTTTTGAGAGG + Intronic
1009696570 6:67112799-67112821 ATGAAACTAAATTTGCTGAGTGG - Intergenic
1010568416 6:77447446-77447468 ATGAAACTAAAATTCCTGAGGGG - Intergenic
1010573471 6:77506018-77506040 TTGAAACTTCATTTGTTGGGTGG - Intergenic
1011227748 6:85126654-85126676 ATGAAACCAGATTTTTTAAGTGG - Intergenic
1012391836 6:98750212-98750234 TTGTAACTTGATATCTTGAAAGG - Intergenic
1012783452 6:103592178-103592200 TTGAAATTAGATGTCATTAGAGG - Intergenic
1014875314 6:126651678-126651700 TTGAAATGAGCTTTCTAGAGTGG - Intergenic
1015023631 6:128507110-128507132 TTGGAACTTGACTGCTTGAGTGG - Intronic
1017825624 6:158079789-158079811 TTTAACCAATATTTCTTGAGGGG + Intronic
1020630422 7:10632731-10632753 TTGAAATTATATGCCTTGAGGGG - Intergenic
1021428395 7:20530269-20530291 TTAAAAATAGCTTTATTGAGAGG - Intergenic
1023672757 7:42596323-42596345 TTGAAACTATAATTGTTTAGTGG - Intergenic
1025093266 7:56080085-56080107 TGGAAACTAGTTTCCTTCAGAGG - Exonic
1025216286 7:57059613-57059635 TGGAAACTAGTTTTCTTCAGAGG - Intergenic
1025627036 7:63232064-63232086 TGGAAACTAGTTTTCTTCAGAGG - Intergenic
1025655096 7:63511117-63511139 TGGAAACTAGTTTTCTTCAGAGG + Intergenic
1027574349 7:79913441-79913463 TTGACATCAGACTTCTTGAGAGG + Intergenic
1027590006 7:80106754-80106776 TTGAAACAAAACTTCTTGAAAGG - Intergenic
1028122914 7:87077481-87077503 TTGAAAATAGAAATCTAGAGAGG + Intergenic
1028242382 7:88437160-88437182 TTGAAAGTAGATATCATGAGAGG - Intergenic
1032601136 7:133296646-133296668 TAGAAACTAGATTGTTTGATAGG + Intronic
1033327292 7:140390330-140390352 ATGTAACTAGGTTTCTAGAGAGG - Intronic
1033469007 7:141626877-141626899 TTGATGTTAGATGTCTTGAGAGG + Intronic
1033633269 7:143182626-143182648 TTCAAAGTAGATTACTTGAGAGG - Intergenic
1034044053 7:147908785-147908807 TTGAAAATAGCTTTCTTAACTGG - Intronic
1034601686 7:152263413-152263435 TTTAAAATAGAATTTTTGAGAGG + Intronic
1035376426 7:158409862-158409884 TTAAAGCCAGATTTTTTGAGAGG - Intronic
1037206535 8:16327594-16327616 TTAAAACTATGTTTATTGAGAGG + Intronic
1039386132 8:37137366-37137388 TTGAAAATAAATTTCATGATTGG + Intergenic
1042403315 8:68374363-68374385 TTTAAACTGGATTTAATGAGAGG - Intronic
1045118591 8:99011872-99011894 CAGAAACTAGATTTCTTAAAAGG - Intergenic
1047101158 8:121677205-121677227 TTGAAAATTGATTTTTTGATTGG + Intergenic
1047566865 8:126054179-126054201 TTAAAATTAAATTTCTTGAGCGG + Intergenic
1048974672 8:139664519-139664541 GTGAAACTAGGTTTGTTGGGGGG - Intronic
1050369689 9:4908393-4908415 TTTAAAATAGATTTCATGGGCGG + Intergenic
1051119885 9:13741229-13741251 TTCAAAATATATTTTTTGAGGGG - Intergenic
1051567142 9:18513272-18513294 CTGAAACTAGACTCCTTGAATGG + Intronic
1051757288 9:20416684-20416706 TTGTACCAAGATTTATTGAGTGG - Intronic
1051994033 9:23192215-23192237 TTAAAACTTGATATCTTCAGAGG + Intergenic
1054357878 9:64080854-64080876 TTGATATTAAAGTTCTTGAGTGG + Intergenic
1054786170 9:69212222-69212244 TTGAAACTAGATATTTTTAAAGG + Intronic
1055535297 9:77236403-77236425 TTAAAACTTGATGTTTTGAGTGG + Intronic
1056697008 9:88867268-88867290 TTGAAAGTAGATTTCTGTAACGG + Intergenic
1058624336 9:106918947-106918969 ATGAAACTAGGTTTCTGGAGTGG + Intronic
1059115340 9:111596219-111596241 CAGAAAATAGATTTCTTGATGGG - Intronic
1059577983 9:115512329-115512351 TTGAAAATAGAATCTTTGAGAGG - Intergenic
1203560579 Un_KI270744v1:52656-52678 TTGATATTAAAGTTCTTGAGTGG - Intergenic
1185840809 X:3389716-3389738 TTGAAAAAAGATTTATTTAGTGG - Intergenic
1186179613 X:6960040-6960062 TTGAAGCTTGATTTCTTCTGAGG - Intergenic
1186968973 X:14819323-14819345 ATAAAAATAGATTTCTAGAGAGG + Intergenic
1187378016 X:18774713-18774735 TTGAACCAAGATTTCTACAGTGG - Intronic
1187690812 X:21864488-21864510 ATAAAACTAGATTTATTGGGAGG - Intronic
1187882180 X:23857580-23857602 TTGAATCCAGATTCCTTGATTGG - Intronic
1188406880 X:29822224-29822246 TTTAAACTAGATTTATTTAGAGG - Intronic
1189562977 X:42209930-42209952 TTGAATTTAGATTCCTAGAGGGG + Intergenic
1189731890 X:44029576-44029598 TTCAATCTCGACTTCTTGAGCGG - Intergenic
1193233795 X:79081402-79081424 GTGAAACTCTATTTCTTGTGTGG + Intergenic
1197419638 X:126222765-126222787 TTGATATTAGACTTCTTCAGTGG + Intergenic
1198411909 X:136379140-136379162 ATCAAACTAGATTTATTTAGTGG + Intronic
1198864167 X:141103420-141103442 TTGAAAATACATTTCTTGGCCGG - Intergenic
1198898522 X:141483996-141484018 TTGAAAATACATTTCTTGGCCGG + Intergenic
1201013819 Y:9577133-9577155 TTTAAAATACATTTCTTGACCGG - Intergenic
1201235174 Y:11902382-11902404 TTGAAAAAAGATTTATTTAGTGG + Intergenic