ID: 1179054066

View in Genome Browser
Species Human (GRCh38)
Location 21:37915647-37915669
Sequence AGCGACTGAAACTCGCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179054066_1179054071 22 Left 1179054066 21:37915647-37915669 CCCCCGTGCGAGTTTCAGTCGCT 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1179054071 21:37915692-37915714 TTCCCCTTCTGTTATGTAACCGG 0: 1
1: 0
2: 1
3: 11
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179054066 Original CRISPR AGCGACTGAAACTCGCACGG GGG (reversed) Intronic
902080892 1:13820060-13820082 AGAGACGGAAACTGACACGGAGG + Intronic
912553493 1:110499459-110499481 AGAGGCTGAAACTCGCAGGCAGG + Intergenic
924385529 1:243495594-243495616 AGCGACTGAAGTTCTCACTGAGG - Intronic
924419097 1:243890626-243890648 AGAGACTGTAACTCACACTGTGG - Intergenic
924503438 1:244658127-244658149 AGAGACTGAAACTCGTAAGGAGG - Intronic
1076006842 10:126954616-126954638 AGAGACAGAAAATAGCACGGCGG - Intronic
1080036805 11:27719602-27719624 AGCGCCCGAAACTCGCGGGGAGG + Intronic
1091647922 12:2287751-2287773 AGCCACTGAAACTCGGAAGCTGG - Intronic
1096798079 12:54090944-54090966 AGAGACTGAAAATTGCACTGGGG + Intergenic
1103476699 12:121223940-121223962 TGCGAGTGAAGCTGGCACGGCGG - Intronic
1131123692 15:89840016-89840038 AGAGACAGAAACTGGAACGGGGG + Intronic
1160531257 18:79566185-79566207 TGCGACTGAAGCTGACACGGCGG + Intergenic
1161052545 19:2172089-2172111 AGTGACTGAAACTCACTTGGAGG + Intronic
930246743 2:48991318-48991340 AGGGAGTGAAACTGGCAAGGAGG + Intronic
933251096 2:80029314-80029336 AGCAAGTGAAACTCTCACAGAGG - Intronic
937951434 2:127390861-127390883 GGCAACTGAAACTTGAACGGGGG + Intergenic
1173974038 20:47173823-47173845 AGCAACTGAAACTCCCTGGGTGG - Intronic
1179054066 21:37915647-37915669 AGCGACTGAAACTCGCACGGGGG - Intronic
957192145 3:77022976-77022998 AGAGACTGAAACTAGAATGGTGG - Intronic
968493894 4:904785-904807 AGAGAATGAAACTCACATGGAGG + Intronic
970152177 4:13101375-13101397 AGTGACTGCAACCTGCACGGTGG - Intergenic
988800196 5:34689448-34689470 AGCGACTTAAACTCGGACCTAGG + Intronic
992098304 5:73382030-73382052 AGCGACTGAATCTCGAAGGCAGG + Intergenic
1000241212 5:159409967-159409989 AGAGACTGAAAGTAGAACGGTGG + Intergenic
1041876236 8:62690553-62690575 AGAGACAGAAACTTCCACGGAGG - Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic