ID: 1179054131

View in Genome Browser
Species Human (GRCh38)
Location 21:37916073-37916095
Sequence CTCGCGGCTGCTCCGGCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 2, 2: 2, 3: 22, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179054127_1179054131 6 Left 1179054127 21:37916044-37916066 CCGAGAGGCTGTTAGGAGACTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG 0: 1
1: 2
2: 2
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179054131 Original CRISPR CTCGCGGCTGCTCCGGCTCC AGG Exonic
900162880 1:1232602-1232624 GCCGCGCCTGCTCCCGCTCCAGG - Exonic
900344488 1:2204604-2204626 CCTGCGGGTTCTCCGGCTCCCGG - Intronic
900380333 1:2380964-2380986 CTGGCGGCTGCTGCCTCTCCGGG + Intronic
900418777 1:2546718-2546740 CTCTCGGCGGCCCGGGCTCCGGG - Intergenic
900578037 1:3393998-3394020 CCCGCGGCGGCGGCGGCTCCAGG + Intronic
901435112 1:9242787-9242809 CTGGCGGCTCCTCCTTCTCCAGG + Intronic
901702936 1:11055051-11055073 TCAGCGGCTGCACCGGCTCCTGG + Exonic
903042633 1:20542793-20542815 CTCCATGCTGCTCCGGATCCTGG - Intergenic
903217040 1:21849001-21849023 CTCGAGGCTACGCCTGCTCCAGG - Exonic
904044852 1:27603101-27603123 CCCGCGGCTCCCCCGGCTCGGGG - Intronic
905416493 1:37808027-37808049 CGCCCGGCTGTTGCGGCTCCCGG - Exonic
905626180 1:39491810-39491832 CGCGCACCTGCCCCGGCTCCGGG - Exonic
906678336 1:47708981-47709003 CCCCCGCCTGCTGCGGCTCCCGG + Intergenic
906961324 1:50421013-50421035 CCCGCGGGCGCTCCCGCTCCAGG + Exonic
908132159 1:61083717-61083739 CGGGCCGCCGCTCCGGCTCCCGG - Intronic
911498966 1:98662229-98662251 CTCGCGGCAGCTCCCGAACCTGG + Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912580524 1:110717159-110717181 CTCAAGGCTGCTGCGGCTCTTGG - Intergenic
915085068 1:153380904-153380926 TCCTCGGCTGCTCCGGCTTCCGG + Intergenic
915629041 1:157138009-157138031 CCCGCAGCAGCTCCGGGTCCTGG + Intronic
918332368 1:183472416-183472438 CTCGCTGCTGCTCTGGCCCGTGG - Intronic
921217779 1:212951601-212951623 CGCGTGGCTGCTCCGGGACCGGG - Exonic
921947403 1:220895534-220895556 CGCGCCCCTGCTCCGGCGCCGGG + Intergenic
922809232 1:228406693-228406715 CTCCCGGGTGCTCGGGCTCCGGG + Exonic
924241416 1:242044751-242044773 CTGGCCACTGCTCCAGCTCCAGG + Intergenic
924800799 1:247328791-247328813 CCGGCAGCTGCTCCTGCTCCTGG + Exonic
1064984989 10:21200700-21200722 CTCGCCTCTGCTCTGACTCCAGG - Intergenic
1065054373 10:21829286-21829308 CTCACTGCAGCTCCGCCTCCCGG + Intronic
1067769867 10:49115430-49115452 CTGGCGCGGGCTCCGGCTCCGGG - Exonic
1067769943 10:49115642-49115664 CGCGCGGCGGCTCCCGCGCCCGG - Intergenic
1072591618 10:96832710-96832732 CCCGCCCCTGCTCCCGCTCCAGG + Intronic
1073245409 10:102086910-102086932 CTCACTGCAGCTCCGCCTCCCGG + Intergenic
1073412108 10:103350887-103350909 CTCCCGGCTGCTCCGGCTCCCGG - Exonic
1074413449 10:113247125-113247147 CTCAAAGCTTCTCCGGCTCCTGG + Intergenic
1074528088 10:114278625-114278647 CCAGCAGCTGCTCCCGCTCCTGG - Intronic
1076916678 10:133425885-133425907 CATGCGGCTCCTCCGGCTGCGGG + Intergenic
1076936782 10:133570680-133570702 CATGCGGCTCCTCCGGCTGCGGG + Intergenic
1076992274 11:281657-281679 CTCGCTGCAGCGCCAGCTCCGGG - Exonic
1077089769 11:773136-773158 CTGGCAGCTGCCCCGGCTCCGGG - Intronic
1079128434 11:17734590-17734612 CGCGCGGCTCCTGCTGCTCCCGG - Intergenic
1081995932 11:47364122-47364144 CTCACTGCAGCTCCGCCTCCTGG + Intronic
1084269120 11:68019744-68019766 CTAGCAGCTGCCCCGTCTCCTGG - Exonic
1088157628 11:106827949-106827971 CTCGCGGCTGCTTCCTCTCCTGG - Intronic
1088457736 11:110050262-110050284 CTCCCGGCTGCTCCTCCTCTGGG + Intergenic
1088462135 11:110093167-110093189 CCCGGGGCTGCCCCAGCTCCAGG + Intergenic
1089262388 11:117232075-117232097 GTCACTGCTCCTCCGGCTCCCGG - Exonic
1090268520 11:125370032-125370054 CTCGCAGCTGCTCAGACCCCTGG + Intronic
1091588862 12:1831281-1831303 CTCGCCGCTGCTCCGCCACCTGG + Exonic
1091718274 12:2795095-2795117 CTCGCGCCGGCACCAGCTCCCGG + Exonic
1092243800 12:6851862-6851884 TCCGCAGCTGCTCCGGCTCCGGG - Exonic
1092348097 12:7732872-7732894 CTCACTGCAGCTCCGCCTCCTGG - Intronic
1093633482 12:21437650-21437672 CTCGCGGCTGCTTCCTCTCCTGG + Intronic
1097053071 12:56235212-56235234 CCTGCTGCTGCTGCGGCTCCTGG + Exonic
1099202464 12:79691333-79691355 CTCCCGGCGCCTCCGACTCCGGG + Intergenic
1100565427 12:95790276-95790298 CGCGCGGCTGCTGCTGCTCTGGG - Exonic
1101592874 12:106139115-106139137 CTCACGGCGGCCCCGGCCCCGGG - Exonic
1102061482 12:109935474-109935496 CTCCTGGCTTCTCCGCCTCCCGG + Intronic
1102573235 12:113840413-113840435 CTCAGGGCTGCTCCTGCCCCCGG + Intronic
1102766828 12:115440634-115440656 CTCCCAGGTCCTCCGGCTCCAGG + Intergenic
1102813482 12:115843816-115843838 CTCGCAGCTTCTGTGGCTCCCGG - Intergenic
1103534742 12:121626765-121626787 CTCGGGACTGCTGCGGCTCGGGG - Exonic
1103736111 12:123061872-123061894 CTCATAGCTGCTCCGGCTCTTGG - Intronic
1103894942 12:124266706-124266728 CTCGGGGCTTCCCCTGCTCCAGG + Intronic
1104916407 12:132267154-132267176 CTCTCGGCTGCTCAAGCTCTGGG - Intronic
1105454257 13:20525831-20525853 CTCGCAGCTCCGCCGGCGCCTGG - Exonic
1105809330 13:23980339-23980361 CCCGCGGCTCCTCCGTCGCCCGG - Intronic
1108641224 13:52384108-52384130 CTCACGGCAACTCCGCCTCCCGG - Intronic
1108901567 13:55415401-55415423 CTCACTGCAGCTCCGCCTCCTGG - Intergenic
1113813900 13:113158816-113158838 CTCAGGGCTCCTCTGGCTCCTGG - Intronic
1113924133 13:113930856-113930878 CTGGCGGCCGCTCCTTCTCCAGG + Intergenic
1115120120 14:29928025-29928047 CTCGCGGAGGCTCAGGCCCCGGG - Intronic
1115320661 14:32076834-32076856 CTCGCGCCTTCCCAGGCTCCCGG + Intronic
1117520487 14:56546626-56546648 CTCTCTGCTGTTCAGGCTCCTGG - Intronic
1117963936 14:61188422-61188444 CTGGCTCCGGCTCCGGCTCCGGG + Intronic
1120933035 14:89867513-89867535 CTTACGGCTGCTCTGCCTCCAGG + Intronic
1122975214 14:105168220-105168242 CGCGCGGCGGCTGGGGCTCCGGG - Intronic
1124341109 15:28889540-28889562 CTCCAGGCTGCCCTGGCTCCAGG + Intronic
1124617820 15:31255238-31255260 CTCCTGGCTGCCCCTGCTCCTGG - Intergenic
1124684355 15:31768254-31768276 CTCGCCGCTGCCCGGGCTGCTGG - Intronic
1125806619 15:42498481-42498503 GTCCCAGCTGCTCCAGCTCCTGG - Intronic
1127262155 15:57334481-57334503 CTCCCGGCTCCTCCCTCTCCTGG - Intergenic
1127557487 15:60101700-60101722 CTTGCGGCTGCTCCAGCAGCTGG + Intergenic
1132365069 15:101251366-101251388 CTCGCGGCTCGTCCTGCCCCGGG - Exonic
1132375473 15:101325726-101325748 CACGGAGCTGCTCCAGCTCCTGG - Intronic
1132611379 16:817953-817975 CTCGGGGGTGCTCCAGCTGCGGG + Intergenic
1133440575 16:5817766-5817788 CTCACTGCAGCTCCGACTCCCGG + Intergenic
1134070292 16:11256145-11256167 CTCGCGCATGCTCCGGGGCCAGG + Exonic
1135314718 16:21434789-21434811 CTCACGGCTGCTCCGTCTATGGG + Intronic
1135367641 16:21867069-21867091 CTCACGGCTGCTCCGTCTATGGG + Intronic
1135444173 16:22504093-22504115 CTCACGGCTGCTCCGTCTATGGG - Intronic
1135461987 16:22652317-22652339 CTCGCTGCAACTCCGCCTCCCGG - Intergenic
1135743915 16:24999488-24999510 CTCACTGCAGCTCCGGCTCCTGG + Intronic
1136120487 16:28130015-28130037 CTCTGTGCTGCTCTGGCTCCTGG - Intronic
1136324830 16:29515264-29515286 CTCACGGCTGCTCCGTCTATGGG + Intergenic
1136439515 16:30255249-30255271 CTCACGGCTGCTCCGTCTATGGG + Intergenic
1139451365 16:67029891-67029913 GGCGCGGCTGCTGCGGCTCCCGG + Intronic
1141683062 16:85555297-85555319 CTCGCGGGGGCTCTGGCGCCTGG - Intergenic
1142653225 17:1370923-1370945 CTCACTGCAGCTCCGCCTCCCGG - Intronic
1147121034 17:38335195-38335217 CGGGCGGCTGCTGCGGCACCTGG - Exonic
1147284757 17:39392924-39392946 ATCTCGGCTCCTCCGCCTCCTGG - Intronic
1148323613 17:46771434-46771456 CTCGCGGCGGCAGCGGCGCCCGG + Intronic
1150754161 17:67896035-67896057 CTCACTGCAGCTCCGCCTCCCGG + Intronic
1150797157 17:68247775-68247797 CTCGCGGCGGCTCCGCGGCCCGG - Exonic
1151343018 17:73484092-73484114 CTCCCCGCTCCTCCGGCTCGGGG + Intronic
1151624436 17:75267811-75267833 CTCGCAGCTGCTCCCGAGCCTGG + Exonic
1151836468 17:76585760-76585782 CTGGCTGCTGCTCCTGCTCACGG - Exonic
1152362558 17:79839397-79839419 CCCGCGCCCGCCCCGGCTCCCGG + Exonic
1152540091 17:80970435-80970457 CCTGTGGCTGCTCCTGCTCCTGG - Intergenic
1152635770 17:81429951-81429973 CGGGCGGCTCCTCCAGCTCCGGG - Intronic
1152924164 17:83079902-83079924 CCCGCTGCTGCTCCTGCTCCTGG + Exonic
1152958171 18:57964-57986 CTGGCCACTGCTCCAGCTCCAGG - Intronic
1160041507 18:75349812-75349834 CTCGCTGCTGCTCCTGCTGGGGG - Intergenic
1161220682 19:3116714-3116736 CTCGCGGTGGCTCCGGTTGCGGG + Intronic
1162726297 19:12691401-12691423 ACCGCGTGTGCTCCGGCTCCTGG - Exonic
1162794910 19:13081957-13081979 CTCCCTGCTGCTCCAGCCCCAGG - Intronic
1162954361 19:14090210-14090232 CGCGCGTGCGCTCCGGCTCCGGG + Exonic
1163030002 19:14537818-14537840 CTCGCTGCACCTCCGCCTCCCGG + Intronic
1163186261 19:15641466-15641488 CCCGTGGCTGCTCCTGCTGCTGG + Exonic
1163202656 19:15779839-15779861 CCCGTGGCTGCTCCTGCTGCTGG - Intergenic
1164109132 19:22138088-22138110 CTCCCGGCTGCTCCGGCTCCCGG + Intergenic
1164715077 19:30385188-30385210 TTCAGGGCTGCTCCTGCTCCTGG - Intronic
1166524337 19:43501790-43501812 CCCGCAGCTGCTCCTCCTCCCGG + Exonic
1166524778 19:43504191-43504213 CTCGCGTCTGCTCCGGGGCGCGG + Intronic
1166702670 19:44891293-44891315 CTGGCGGCGGCGCCTGCTCCCGG - Exonic
1166931455 19:46303939-46303961 CTCCTGGCTGCGCCGGCTGCGGG - Exonic
1167175460 19:47861078-47861100 CTCAAGGCTGTCCCGGCTCCAGG + Intergenic
1167626781 19:50595564-50595586 CTCACTGCTGCTCCGCCTCCCGG + Intergenic
925146614 2:1586993-1587015 CTCGCTGCGGCCCCGGCTCCTGG + Intergenic
925361328 2:3282575-3282597 CGGGCTGCTGCGCCGGCTCCTGG + Intronic
926035117 2:9630510-9630532 CTCGAGGCTCCTCCCGCTGCGGG - Exonic
926267976 2:11344063-11344085 CTCGCGCCTGCCCCGTCCCCCGG + Exonic
930089459 2:47521164-47521186 CTCCCGGCTGCGCCGCCGCCTGG - Exonic
931711094 2:64989488-64989510 CTCGCACCTGCTCCTGCGCCAGG + Exonic
931867325 2:66426524-66426546 CGCGCTCCTGCTCCGGCTCCCGG + Intergenic
932356070 2:71069139-71069161 CTCGCAGCTGCTCCAGCTCCCGG - Intronic
933809932 2:86026895-86026917 CTTCCGGCTGCTCCAGCCCCTGG - Exonic
935397002 2:102619706-102619728 CCCGCCGCTGCTGCGGCACCGGG - Exonic
937895814 2:126976246-126976268 CTCCCAGCTGCTCCACCTCCTGG + Intergenic
940009617 2:149039368-149039390 CTGGAGGCTGCTCTGACTCCAGG + Intronic
946066222 2:216989562-216989584 CTTGCGGCTGCTCAGACTCTTGG + Intergenic
946622377 2:221573346-221573368 CGCCCGGCTGCTCCGGCCCCGGG + Intronic
946937942 2:224741056-224741078 CTCACTGCAGCTCCGCCTCCCGG + Intergenic
948438004 2:237967030-237967052 CTCACAGCCGCACCGGCTCCCGG - Intronic
948843685 2:240672767-240672789 CGCGCGGCTCCAGCGGCTCCGGG - Intergenic
948874465 2:240819565-240819587 CGGGCAGCTGCTCCGGTTCCCGG - Intronic
949001356 2:241616000-241616022 CTCTGGGCTGCTCCAGCTGCAGG - Intronic
1168831049 20:845434-845456 CTCTCGCCTCCTCCGGGTCCAGG - Exonic
1169136946 20:3203330-3203352 CTCTCGGCTCCTCAGGCTCCAGG + Exonic
1172791642 20:37510011-37510033 CTCACTGCAGCTCCGCCTCCCGG + Intronic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1175602708 20:60287837-60287859 ATCGCGGCTGCTCCTGTTCTGGG + Intergenic
1175954182 20:62599843-62599865 CGAGCGCCTGCTCCCGCTCCGGG - Intergenic
1176145078 20:63561907-63561929 CTCCGGGCTGCACCTGCTCCTGG + Exonic
1176194476 20:63831000-63831022 CTCGCAGCGGCCCCGGCTCCCGG + Intronic
1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG + Exonic
1179887166 21:44319103-44319125 CTCTCAGCAGCTCCAGCTCCAGG - Intronic
1180005404 21:45018480-45018502 CCCGCTGCCGCTCCTGCTCCAGG - Intergenic
1181108129 22:20586608-20586630 CTCCAGGCTGCTGCAGCTCCCGG + Exonic
1181521766 22:23452418-23452440 CTGGGGGCTGCTCCCTCTCCTGG - Intergenic
1181530573 22:23514790-23514812 CTTGCTGCAGCTCCAGCTCCTGG + Intergenic
1181566960 22:23744663-23744685 CTCGCACCTGCTCCGACACCTGG - Exonic
1181839829 22:25647206-25647228 GTCGCTGCTGCTGCAGCTCCGGG - Intronic
1181956273 22:26589908-26589930 GGCGCGACTGCTCGGGCTCCGGG - Intronic
1183258195 22:36776588-36776610 CTCGCGGCTTCCCCGGTTCCCGG + Intergenic
1185255159 22:49827640-49827662 CTCTCGGCCGCGGCGGCTCCGGG + Intergenic
949697965 3:6721106-6721128 CTCACTGCAGCTCCGCCTCCCGG - Intergenic
953209577 3:40863764-40863786 CTCACTGCAGCTCCGCCTCCCGG - Intergenic
955485731 3:59432980-59433002 CTCTCGGCTCCTCCTCCTCCCGG - Intergenic
956414679 3:69013573-69013595 TTCACGGCTGCCCCGGCTCCAGG - Exonic
961599910 3:128052529-128052551 GCGGCGGCTGCTCGGGCTCCGGG - Exonic
966696412 3:182793930-182793952 CACGGGGCTTCTCCGGCTCTGGG - Intronic
967685205 3:192409666-192409688 CTCGCGGCGGCTGAGGCTCCTGG + Intronic
967858521 3:194135115-194135137 CTGGCACGTGCTCCGGCTCCAGG + Intergenic
967928243 3:194669855-194669877 CTCACTGCAGCTCCGCCTCCTGG - Intronic
968727952 4:2256893-2256915 CACGTGCCTGCCCCGGCTCCTGG + Intronic
968756051 4:2417244-2417266 CTCCCCGCTGCGCCGGCCCCAGG + Intronic
968879568 4:3292324-3292346 CTCGCTGCTGCCCGCGCTCCGGG + Intergenic
972766034 4:42152613-42152635 CTCGAGGCTTCTGCGGCTGCGGG + Exonic
975401495 4:73944258-73944280 GGCGCTGCTGCTCCTGCTCCTGG - Intergenic
975409994 4:74038536-74038558 GGCGCTGCTGCTCCTGCTCCTGG - Exonic
975415382 4:74099045-74099067 GGCGCTGCTGCTCCTGCTCCTGG - Exonic
975883644 4:78939528-78939550 CTGGCGGCGGCCCGGGCTCCCGG + Intergenic
976431243 4:84966004-84966026 CTGGCGGCGGCGGCGGCTCCCGG + Intronic
976792470 4:88893751-88893773 CTCACTGCAGCTCCGCCTCCCGG - Intronic
978778921 4:112529761-112529783 GTCGCTGCTGCACCGTCTCCAGG - Intergenic
983185435 4:164695182-164695204 CTCACTGCCGCTCCGCCTCCCGG - Intergenic
985727448 5:1523664-1523686 CTGGCGTCCGCGCCGGCTCCCGG + Intronic
985855173 5:2418683-2418705 CTCTCGTCTGCTCCAGCGCCAGG + Intergenic
986132228 5:4942352-4942374 CGCGCGGCTGCCCAGGCTGCAGG + Intergenic
986299721 5:6468318-6468340 CGCGCCCCTGCTCCAGCTCCAGG - Intronic
988682948 5:33501948-33501970 CTGGCGGCGGCGCCTGCTCCGGG - Intergenic
988949326 5:36241639-36241661 CGCGCGGCTGCCCCTGCCCCAGG + Exonic
997582372 5:135026031-135026053 TTCCCCGCTGCTCCGGCTGCAGG - Intergenic
998406265 5:141876354-141876376 CTCGCGCCGGCTCCGGCTTGCGG - Intronic
1002058058 5:176610004-176610026 AGTGCCGCTGCTCCGGCTCCTGG + Exonic
1002508869 5:179699415-179699437 CTCGCGGCTGCCCAGGCAGCCGG - Intronic
1002919335 6:1555185-1555207 AACGCGGCTGCTCCAGCGCCGGG + Intergenic
1003074571 6:2971697-2971719 CTCGCGGCCCCTCCGGCTGGCGG - Intronic
1004850232 6:19691682-19691704 CTCGGGGCTGCTCCGCCATCTGG + Intergenic
1006052657 6:31356242-31356264 CTCTCCGCTGCTCCGCCTCACGG + Exonic
1006357390 6:33567943-33567965 CGCTCGGCTGCTCTGGCTCGGGG - Intergenic
1007400200 6:41598900-41598922 CTCCCGGCAGCTCCTCCTCCAGG - Exonic
1010062277 6:71636531-71636553 CACACAGCTGCTCCTGCTCCAGG + Intergenic
1014001634 6:116371338-116371360 CTCGAGGCTGCTCCGCCGCCGGG - Intronic
1015127751 6:129773206-129773228 ATCCTGGCTGCTCTGGCTCCTGG - Intergenic
1015965469 6:138692713-138692735 CGCGCGGCTGCGCCGGCCCGAGG - Intergenic
1017135299 6:151142508-151142530 CTCACTGCAGCTCCGCCTCCCGG - Intergenic
1019032390 6:169024403-169024425 CTCGGGGCTGCCCGGGCACCTGG + Intergenic
1020099897 7:5388860-5388882 CGCGCGGCTGCTGCGGCGCACGG - Exonic
1020106233 7:5423486-5423508 CCGGCGGCGGCCCCGGCTCCCGG + Exonic
1020445243 7:8261712-8261734 TTCCCGGCGGCTCCGGCCCCAGG - Intronic
1022103782 7:27184476-27184498 CTCGGGGCTGCTGCTGCTCTCGG + Exonic
1023418303 7:39951435-39951457 CTTGCGGCTGCTACTGCTGCTGG - Exonic
1026567838 7:71504151-71504173 CTCACTGCAGCTCCGCCTCCTGG - Intronic
1026678395 7:72447276-72447298 CTGGCTGCTGCTCCTGCTGCTGG + Intergenic
1028121381 7:87059565-87059587 GCGGCGGCAGCTCCGGCTCCCGG + Exonic
1032525584 7:132576738-132576760 GCCGCCGCTGCTCGGGCTCCGGG - Exonic
1033181184 7:139180260-139180282 CTCACTGCAGCTCCGCCTCCCGG - Intronic
1034347645 7:150397195-150397217 CCCGCGGCGGCCCCGGCTGCAGG - Exonic
1034924448 7:155110086-155110108 CTCCCGGCTGCACCTGCTTCAGG + Intergenic
1035108806 7:156463528-156463550 CTGGAGGCTTCTCCAGCTCCAGG + Intergenic
1035168305 7:157004256-157004278 ACCGCGGCTGCAGCGGCTCCGGG - Intronic
1035297222 7:157873989-157874011 CCCGAGGCTGCTCAGGGTCCTGG - Intronic
1035761559 8:2072469-2072491 CGCGCGGCTGCACCCGCTTCAGG - Exonic
1037865697 8:22440914-22440936 CTCTCGGCTCCTCCGGCTCCGGG - Intronic
1044729781 8:95220524-95220546 CTCCCTGCTCCTCCTGCTCCTGG + Intergenic
1044934195 8:97277622-97277644 CGCGCAGCTCCTCCGGCTCGGGG - Exonic
1048979065 8:139693469-139693491 CTCTCAGCTGCTCCTGCTCTCGG + Intronic
1049096186 8:140549598-140549620 CTCGCGGCTGTGGCGGCCCCAGG + Intronic
1049148529 8:141019637-141019659 CACCAGGCTGCTCCTGCTCCTGG + Intergenic
1049549798 8:143251932-143251954 CTCCCGGCTGCTCCTGCTGCTGG + Intronic
1049565259 8:143334831-143334853 GGTGCGGCTGCTGCGGCTCCGGG - Exonic
1049649987 8:143761311-143761333 CTGCCTGCTGCTCCGGCCCCGGG + Intergenic
1053603141 9:39631001-39631023 CTCGCGCCTGCGCCATCTCCCGG + Intergenic
1053860784 9:42384760-42384782 CTCGCGCCTGCGCCATCTCCCGG + Intergenic
1054250398 9:62711424-62711446 CTCGCGCCTGCGCCATCTCCCGG - Intergenic
1054564505 9:66745952-66745974 CTCGCGCCTGCGCCATCTCCCGG - Intergenic
1057139689 9:92718917-92718939 CTCGGGGCTGGTGCGGCCCCCGG + Exonic
1057366021 9:94421985-94422007 CTCACAGCAGCTCCGCCTCCTGG + Intronic
1057478652 9:95426827-95426849 CTCTGGGCGGCCCCGGCTCCCGG + Intergenic
1057657313 9:96966080-96966102 CTCACAGCAGCTCCGCCTCCTGG - Intronic
1058663101 9:107283709-107283731 CACGCGGCTGCCCCTGCCCCCGG - Intronic
1059387260 9:113974337-113974359 CTTGCTGCTACTCCAGCTCCAGG - Intronic
1060480259 9:124013234-124013256 GGCGCCGCTGCTCCTGCTCCCGG - Intronic
1061207987 9:129175333-129175355 CTCTCGGCCGCCCCCGCTCCAGG - Intergenic
1061222142 9:129258495-129258517 CTCCCGGCCCCTCCTGCTCCGGG + Intergenic
1061249780 9:129420036-129420058 CTCACCGCAGCTCCAGCTCCTGG - Intergenic
1061320338 9:129824123-129824145 CTGGCGGCTGCACCGGTTCGCGG - Exonic
1061369989 9:130192721-130192743 CTCACTGCAGCACCGGCTCCTGG - Intronic
1061992146 9:134165168-134165190 CTCGCGTGTCCTCCGGCTCCAGG + Intergenic
1062589308 9:137266345-137266367 CCTGCTGCTGCTCCGGCTGCTGG + Exonic
1062739992 9:138166636-138166658 CTGGCCACTGCTCCAGCTCCAGG + Intergenic
1186529614 X:10282113-10282135 CTCCAGGCTGCCCCAGCTCCTGG + Intergenic
1195306091 X:103585572-103585594 GTCTCGTCTGCTCCGGTTCCTGG + Exonic