ID: 1179054354

View in Genome Browser
Species Human (GRCh38)
Location 21:37916985-37917007
Sequence TGAGCTTTGCTTGCACCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179054336_1179054354 28 Left 1179054336 21:37916934-37916956 CCCAGAGGGGGCGCAGCGAGCGG No data
Right 1179054354 21:37916985-37917007 TGAGCTTTGCTTGCACCTGGTGG No data
1179054338_1179054354 27 Left 1179054338 21:37916935-37916957 CCAGAGGGGGCGCAGCGAGCGGC No data
Right 1179054354 21:37916985-37917007 TGAGCTTTGCTTGCACCTGGTGG No data
1179054348_1179054354 5 Left 1179054348 21:37916957-37916979 CCGGGACGGAGGGGAGGGGCCCT No data
Right 1179054354 21:37916985-37917007 TGAGCTTTGCTTGCACCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179054354 Original CRISPR TGAGCTTTGCTTGCACCTGG TGG Intergenic
No off target data available for this crispr