ID: 1179054529

View in Genome Browser
Species Human (GRCh38)
Location 21:37918806-37918828
Sequence GGCAAGGCCAGATCTACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179054529_1179054534 11 Left 1179054529 21:37918806-37918828 CCATGTGTAGATCTGGCCTTGCC No data
Right 1179054534 21:37918840-37918862 GACACCAGAACTAAGATGGTTGG No data
1179054529_1179054537 21 Left 1179054529 21:37918806-37918828 CCATGTGTAGATCTGGCCTTGCC No data
Right 1179054537 21:37918850-37918872 CTAAGATGGTTGGGAGTTTTTGG No data
1179054529_1179054533 7 Left 1179054529 21:37918806-37918828 CCATGTGTAGATCTGGCCTTGCC No data
Right 1179054533 21:37918836-37918858 GGCTGACACCAGAACTAAGATGG No data
1179054529_1179054535 12 Left 1179054529 21:37918806-37918828 CCATGTGTAGATCTGGCCTTGCC No data
Right 1179054535 21:37918841-37918863 ACACCAGAACTAAGATGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179054529 Original CRISPR GGCAAGGCCAGATCTACACA TGG (reversed) Intergenic
No off target data available for this crispr