ID: 1179060876

View in Genome Browser
Species Human (GRCh38)
Location 21:37978158-37978180
Sequence GGGTGTGAAATTGCATCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179060876_1179060879 28 Left 1179060876 21:37978158-37978180 CCACAAGATGCAATTTCACACCC 0: 1
1: 1
2: 4
3: 40
4: 220
Right 1179060879 21:37978209-37978231 GATAACATCAAATGTTTGTGAGG 0: 1
1: 3
2: 22
3: 167
4: 913

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179060876 Original CRISPR GGGTGTGAAATTGCATCTTG TGG (reversed) Intronic
902750315 1:18504163-18504185 GGATGTGAAGTAGTATCTTGTGG - Intergenic
905118039 1:35659564-35659586 GGGAGTGAGATTGTATCTGGAGG + Intergenic
905502473 1:38450596-38450618 CAGAGTGAAATTCCATCTTGGGG + Intergenic
905784688 1:40744967-40744989 GTGTGTAAAAGTGGATCTTGAGG - Intronic
906576538 1:46896117-46896139 GGATGTGAAATGGTATCTTATGG - Intergenic
906595380 1:47071468-47071490 GGATGTGAAATGGTATCTTATGG + Intronic
907315783 1:53571201-53571223 AGGTGTGAAATGGCATCTCGTGG - Intronic
908309839 1:62869672-62869694 GTGTGTGAAGTAGTATCTTGGGG + Intergenic
908462725 1:64361535-64361557 GGGTGTGAAGTGGCATCTTGTGG - Intergenic
909069269 1:70974793-70974815 GAGTTTGAAATTGCATCCCGAGG - Intronic
909502527 1:76351905-76351927 GGATGTGAAAATTCATGTTGAGG + Intronic
910148201 1:84107777-84107799 TGGTGTGAGATGGTATCTTGTGG - Intronic
911369231 1:96976619-96976641 GAGTTTGAAGTGGCATCTTGTGG - Intergenic
918958597 1:191241008-191241030 GGGTATGAAATGGTATCTTGTGG - Intergenic
919395241 1:197038035-197038057 GGGTATGAAATAGCTTCTTTTGG - Intergenic
919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG + Intronic
922294327 1:224236156-224236178 GGAGGTGAAAATGCATCCTGAGG + Intronic
922729779 1:227943530-227943552 GGGTGTGGAATGGCACCTTGTGG - Intronic
923384469 1:233452976-233452998 GGGTGTGTCATTGCATGTGGAGG - Intergenic
924588601 1:245381690-245381712 GGGTGTGGAGTTGCAGTTTGGGG - Intronic
1065200843 10:23311409-23311431 GAGTTTGAAATTCCAGCTTGGGG + Intronic
1065241061 10:23704995-23705017 GGATTTGAAATGGTATCTTGTGG + Intronic
1066121549 10:32293503-32293525 GAGTGTGAGATTGCAGGTTGGGG - Intronic
1066374824 10:34848446-34848468 GGATGAGGAATTGCTTCTTGTGG - Intergenic
1066647215 10:37622170-37622192 GGGTCTGAAATTCCATCATTAGG - Intergenic
1067673545 10:48348092-48348114 TGGCGTGAAATGGTATCTTGTGG + Intronic
1067841495 10:49683226-49683248 AGGTGTGAAATGGTAGCTTGTGG + Intronic
1067923766 10:50486602-50486624 TGGTGTGAGATGGCATCTAGTGG - Intronic
1070592849 10:77812692-77812714 GAGTTTGTAATTGCATATTGTGG - Intronic
1071353119 10:84766643-84766665 GGGTGTTAACTTGAGTCTTGAGG + Intergenic
1071418926 10:85469510-85469532 TGGTGTGAGATGGTATCTTGTGG - Intergenic
1072910475 10:99496620-99496642 GGGTGAGAAATTGGATTTTTTGG - Intergenic
1074982159 10:118628311-118628333 GAGAGTGAGATTCCATCTTGGGG + Intergenic
1076036567 10:127203192-127203214 GGGTGTGAAGTGGCCTCTTGTGG - Intronic
1076455607 10:130591713-130591735 GGATGTGAAATAGTATCTTGTGG + Intergenic
1076877154 10:133221495-133221517 GGGTGGGAGATTGTGTCTTGAGG - Intronic
1080691900 11:34565284-34565306 GGGTGTGAACTTGAATGTTGAGG - Intergenic
1081483596 11:43510536-43510558 GGGTGTGAAGTGGTATCTCGTGG - Intergenic
1082766042 11:57168894-57168916 GAGTGTGTAATTGAATCATGGGG - Intergenic
1082809281 11:57468934-57468956 GGGTGTGTTATTGCTTCCTGGGG - Intronic
1085781843 11:79416415-79416437 GGGTTTGAAGTGGTATCTTGTGG + Intronic
1087345991 11:96971667-96971689 AGGTGTCTAATTGCATCTGGGGG + Intergenic
1087976938 11:104562250-104562272 GGAGGTGATATTGGATCTTGAGG - Intergenic
1090217115 11:124978547-124978569 TGGTGTGAGATGGTATCTTGTGG + Intronic
1090525455 11:127529635-127529657 TGGTGTAAAATTGTATATTGTGG - Intergenic
1090539979 11:127690842-127690864 GGGGGTGAAATTCCAACATGAGG + Intergenic
1090596942 11:128330192-128330214 GGGAGGGAAAGTGCATCTGGGGG - Intergenic
1091681909 12:2533413-2533435 GGGTATGAATGAGCATCTTGGGG - Intronic
1092093474 12:5823015-5823037 GGGTGGGTAATTGAATCATGGGG - Intronic
1093470031 12:19490817-19490839 GAGTGTGAAGTGGTATCTTGTGG - Intronic
1096632568 12:52938104-52938126 GGGTGTGTAATGGTATCTTGTGG - Intronic
1100488109 12:95051210-95051232 AGGTGTGAAATTTCCACTTGTGG - Intronic
1101015144 12:100492611-100492633 GTGTCTGAAGTTTCATCTTGAGG - Intronic
1103686619 12:122737229-122737251 GTGTGTGAAGTGGTATCTTGTGG - Intergenic
1104880546 12:132067786-132067808 GGGGGTGCAATTGCATGATGGGG + Intronic
1105333867 13:19445395-19445417 GGGTGTGTGATGGCATCTTATGG - Intronic
1107731923 13:43357345-43357367 AGGTGTGAAGTGGCATCCTGGGG - Intronic
1107844441 13:44496858-44496880 GGGTGTGAAGTGGTATCTTGTGG - Intronic
1108795661 13:54026918-54026940 TGGTGTGAGATGGCATATTGTGG - Intergenic
1109575144 13:64246150-64246172 GGAGGGGAAATTGCATTTTGAGG + Intergenic
1109971564 13:69777038-69777060 GGGTGATAAATTGAATCATGGGG + Intronic
1110399884 13:75077545-75077567 GGGTTTGAAATAGCTGCTTGGGG - Intergenic
1110784837 13:79511577-79511599 GTGTGTGATACTGAATCTTGAGG + Intronic
1111311886 13:86500337-86500359 GTGTATGAAAATGTATCTTGGGG + Intergenic
1112428573 13:99328542-99328564 GGGTGTGTAGTGGTATCTTGTGG + Intronic
1112983648 13:105419235-105419257 TGGTGTGAAGTGGTATCTTGTGG + Intergenic
1115676636 14:35683042-35683064 TGGGGTGATTTTGCATCTTGTGG - Intronic
1116569843 14:46502431-46502453 GGTTGAGAAATTGTATCTTCAGG + Intergenic
1117572351 14:57060390-57060412 GTGTTTGAACTTTCATCTTGAGG - Intergenic
1117986611 14:61392454-61392476 GGGTATGAAATTATATCCTGTGG + Intronic
1119893450 14:78200337-78200359 GGTTGTGAATGTGCAACTTGGGG + Intergenic
1121324843 14:93013852-93013874 GGCTCTGAACTTGCATCTTATGG + Intronic
1121457407 14:94047164-94047186 GGGTGTGGAATTGCCCTTTGGGG + Exonic
1125074539 15:35598171-35598193 GGGTATGAAGTGGTATCTTGTGG + Intergenic
1125201561 15:37104643-37104665 GGCGGTAAAATTTCATCTTGCGG + Intergenic
1125303038 15:38277812-38277834 TGGTGTGAAATGGTATCTTTTGG + Intronic
1127390103 15:58498426-58498448 GAGGGTGAAATTGTATCTTGAGG + Intronic
1128035822 15:64525019-64525041 GGGTGTAAAGTGGTATCTTGTGG + Intronic
1128531996 15:68460305-68460327 GGGTGTAATTTTGTATCTTGTGG - Intergenic
1128986480 15:72225480-72225502 GGGTGTCAAAATGCATGATGTGG - Intronic
1129445386 15:75613723-75613745 GGGTGTGAAGTGGTTTCTTGTGG - Intronic
1131026186 15:89143817-89143839 GGGTGTGAAGTGGCATCTCTTGG - Intronic
1131219299 15:90568198-90568220 GGATGAGGAATTGCTTCTTGTGG + Intronic
1131398702 15:92107607-92107629 GGATGAGAAATTGCAACATGGGG - Intronic
1132242428 15:100268494-100268516 TGGTGTGAGATGGTATCTTGTGG + Intronic
1135749578 16:25046292-25046314 GGGTGTGAAATAGCATCTCATGG + Intergenic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1138998354 16:62478901-62478923 GGGTGTTAGAGTGTATCTTGGGG - Intergenic
1139201680 16:64984019-64984041 GGATGTGAAACTGCAGCATGAGG - Intronic
1139780338 16:69346090-69346112 GGGTGTGAAATGTTATCTTGTGG - Intronic
1140238811 16:73182902-73182924 GGGTGAAAAATTACCTCTTGGGG + Intergenic
1142932573 17:3299395-3299417 GGCACTGGAATTGCATCTTGGGG + Intergenic
1145271447 17:21406970-21406992 GGTGGGGAAATTGCATCTTTGGG + Intronic
1145309650 17:21694374-21694396 GGTGGGGAAATTGCATCTTTGGG + Intronic
1146626580 17:34439705-34439727 GGGTGTGAAGTTGCATGTCTAGG + Intergenic
1148331489 17:46816666-46816688 TGGTGTGAAATGGTATCTTGGGG - Intronic
1150214442 17:63458895-63458917 GCGTGTGAAATGGCAACATGAGG - Intergenic
1150514097 17:65789588-65789610 GGGTGTGAAATAGCATATTCAGG - Intronic
1150883335 17:69056960-69056982 TGGTGTGAAAATGCATTTTGGGG + Intronic
1153798320 18:8645988-8646010 GGGTGTGAAGTGGAATCTTGTGG - Intergenic
1157653816 18:49364763-49364785 AGGTGTGAAATGGCATGTAGTGG - Intronic
1158641003 18:59203396-59203418 GGTTGTGAAAAAGGATCTTGTGG + Intergenic
1159145325 18:64446749-64446771 TGCTTTGAAATTGTATCTTGTGG - Intergenic
1159923168 18:74244726-74244748 GGGTGTGAAATGGCATCTTGTGG + Intergenic
1160476151 18:79190114-79190136 GGGTTTGATACTGCATCTTCAGG + Intronic
1160492499 18:79349902-79349924 GGGTGTGAAGGTGCATGGTGGGG - Intronic
1160614547 18:80114835-80114857 GGGAGTGAAGATGCCTCTTGAGG - Intronic
1164284021 19:23794394-23794416 TGATGTGAGATGGCATCTTGTGG + Intronic
1165272075 19:34718575-34718597 GTGTGTGAGATGGCATCTTGTGG - Intergenic
1165311440 19:35031145-35031167 GGGTGTCACATTGCAGCCTGCGG - Intronic
1165703685 19:37958969-37958991 TGGTGTGAAATAGAATCTTGTGG - Intronic
1166143990 19:40821929-40821951 GGGTGTGGAACTTCATCTGGAGG - Intronic
925359941 2:3271082-3271104 GGATGAGAAATTGCTTCTTAAGG - Intronic
926922804 2:17955996-17956018 AGGTGAGAAATGGTATCTTGTGG - Intronic
927620491 2:24651822-24651844 GGGTGTGAAATGGTATCTCATGG - Intronic
929140887 2:38665852-38665874 GGAGGTGAAATTGCATTTTGGGG - Intergenic
930729748 2:54716712-54716734 GGGTGTGAAGTGGTATCTTGTGG + Intergenic
930748870 2:54913116-54913138 GGGTGTGAGACAGCATCTTGTGG + Intronic
931489596 2:62729890-62729912 AGGTGAGAAATGGTATCTTGGGG + Intronic
932371537 2:71193139-71193161 TGGTGTGAAATTGTATCTCATGG + Intronic
933048920 2:77576978-77577000 TGGTGTGAAATGGCATCTCATGG - Intronic
935234071 2:101123479-101123501 GCTTGAGAAGTTGCATCTTGGGG - Intronic
935457971 2:103292733-103292755 GGGGGTGAAATTGATTCTTGGGG - Intergenic
936386725 2:112036920-112036942 GGGTGTGAAGTGGTATCTTGTGG - Intergenic
941191958 2:162395751-162395773 GGGTATTAAATGGCATCTAGGGG + Intronic
942112246 2:172693906-172693928 AGGTCTGAAAATGGATCTTGAGG - Intergenic
942277586 2:174334360-174334382 GAGAGTGAAATTGAATCTAGTGG + Intergenic
942473305 2:176286063-176286085 GGGTGTGAAGTGGCATCTCATGG + Intronic
943111481 2:183611401-183611423 GGGTGAGAAAGTGCATCTAGGGG + Intergenic
946017997 2:216619661-216619683 GTCTGTGAAATTGCAGCATGTGG + Intergenic
946035886 2:216741951-216741973 TGTTGGGAAATTGGATCTTGGGG - Intergenic
946063269 2:216963899-216963921 GGATGAGAAGTTGCTTCTTGTGG + Intergenic
947540132 2:230971393-230971415 GGGTATGAAGTGGCATCTCGTGG - Intergenic
1171990395 20:31691842-31691864 GGGTGTGAGATGGTATCTTGCGG - Intronic
1172812962 20:37663328-37663350 GGGTGTGAAGTGGTATCTCGTGG + Intergenic
1172988859 20:39016717-39016739 GGGTGTGAAATGGTATCTCTTGG + Intronic
1173691382 20:44963917-44963939 AGGTGTGAGATTTCATTTTGGGG - Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1174636014 20:52000259-52000281 GGGTGAGAAATGGTATCTTATGG + Intergenic
1176961344 21:15162420-15162442 GGGTGTGAAATTTCTTTTTGGGG + Intergenic
1179060876 21:37978158-37978180 GGGTGTGAAATTGCATCTTGTGG - Intronic
1180660100 22:17459611-17459633 TAGTATGAAATTGCATCTTTGGG - Intronic
1181178752 22:21052908-21052930 GAGTGTGACATGCCATCTTGTGG - Intronic
1183617008 22:38951878-38951900 GGGGGTGAAATTTCTCCTTGTGG - Intergenic
1183787063 22:40035699-40035721 GGATGTGAAATTGCTTGCTGGGG - Exonic
1184598324 22:45527570-45527592 AGGGGTGCAATTGCATGTTGGGG + Intronic
1184898746 22:47430500-47430522 GGGTGTGAAATGGCATCTCATGG - Intergenic
1184968891 22:48001277-48001299 GTGTGTAAAATTGCATCATCAGG + Intergenic
1185073830 22:48671911-48671933 GGCTGTGAAACTGCATCCTTGGG + Intronic
950188088 3:10957693-10957715 GGGTTTGGAACTGCATCTGGTGG - Intergenic
950641118 3:14349069-14349091 GGGTGTGCACTGGCATCTCGTGG - Intergenic
951313909 3:21164724-21164746 GGGAATGAAATTGGTTCTTGTGG - Intergenic
952310145 3:32181119-32181141 AGGTGTCAAATCGCTTCTTGGGG + Intergenic
953423896 3:42776982-42777004 GGGTGTGAAATGGTATCTCGTGG - Intronic
954857255 3:53655515-53655537 TGGTGTGAAATGGTATCTCGTGG + Intronic
955623769 3:60894443-60894465 TGCTGTGAAATTGGATCCTGGGG - Intronic
956453502 3:69397352-69397374 GGGTATGAAATTTCTTTTTGAGG + Intronic
956456884 3:69430305-69430327 GGGTCTGAAAGGGCCTCTTGTGG - Intronic
957366517 3:79231504-79231526 GGGTGTGAGATTGTATCTCACGG - Intronic
957936509 3:86950853-86950875 GGGTGGTCAATTGCCTCTTGAGG + Intronic
957988042 3:87596449-87596471 GGGTGGGTAATTGAATCATGGGG - Intergenic
959695870 3:109247964-109247986 GGGGATGTAATTGAATCTTGGGG - Intergenic
960669448 3:120142338-120142360 GGGTGAGGAATTGCTTCTTATGG + Intergenic
962648812 3:137467289-137467311 GGGGGGGAAATTGCTTTTTGAGG - Intergenic
963008560 3:140749001-140749023 GGGAGTGGAATTGCATCTCCTGG - Intergenic
963199318 3:142569977-142569999 GGGTGTGAAACAGTATCCTGTGG + Intronic
965301624 3:167011865-167011887 TGGTTTGAAATTGCAACTTATGG - Intergenic
965885434 3:173440137-173440159 GGATGAGGAGTTGCATCTTGTGG - Intronic
965932274 3:174059493-174059515 GGGAGTGAAATTGGAAATTGAGG - Intronic
966424154 3:179762933-179762955 GGGTATGAAGTGGTATCTTGTGG + Intronic
967525592 3:190488825-190488847 GGTTGTGAACTTGCAGCCTGCGG - Intergenic
967609003 3:191482162-191482184 GGGAGAGAACTTGAATCTTGGGG + Intergenic
968268409 3:197380491-197380513 GAGTGTGAAGTGGTATCTTGTGG + Intergenic
970583551 4:17494485-17494507 GGGTGTGTCATTGCATGTGGAGG - Intronic
972617022 4:40709105-40709127 GGGTGTGAAATGGTATCTCATGG - Intergenic
973241461 4:47960205-47960227 AGGTGTGAAAAAGTATCTTGTGG - Intronic
975122102 4:70739645-70739667 GGTTGTGAAATCTCTTCTTGAGG - Intronic
975350258 4:73338474-73338496 GGGTGTGAAATGACATCTGGTGG + Intergenic
976345030 4:83990289-83990311 GGTTGTGAAAAAGGATCTTGTGG + Intergenic
979896853 4:126169317-126169339 TGGTGTGAAATGGTTTCTTGTGG - Intergenic
980030409 4:127822684-127822706 GAGTGTGAAGTGGTATCTTGTGG + Intronic
987852814 5:23379013-23379035 GGGTGTGAAATATCTTATTGTGG - Intergenic
991392784 5:66166485-66166507 CGGACTGAAACTGCATCTTGGGG - Intronic
991396324 5:66208650-66208672 GAGTGTGGAAGTGGATCTTGAGG + Intergenic
991959244 5:72027154-72027176 GGGTGTGAAGTCATATCTTGCGG - Intergenic
992362847 5:76059510-76059532 GGGTGAGGAATTGCTTCTTATGG - Intergenic
992478480 5:77127103-77127125 GCTTGTGAAAGTGGATCTTGAGG - Intergenic
992598523 5:78370874-78370896 GGGGGTGAAGTGGTATCTTGTGG + Intronic
993029048 5:82682844-82682866 GGGTGTGAAGTAGTATCATGTGG - Intergenic
995552204 5:113293074-113293096 CGGTTTGAAATAGCATTTTGAGG - Intronic
996495546 5:124150991-124151013 TGGTGTGAAATGGTATCTTGTGG - Intergenic
1000382606 5:160642531-160642553 GGGGGTGCTAATGCATCTTGTGG + Intronic
1000635214 5:163636309-163636331 GGGTTTGTAATTGCATCATTAGG + Intergenic
1002336371 5:178481664-178481686 GGGTATGAAGTGGTATCTTGTGG - Intronic
1002447603 5:179299007-179299029 GGTTGTGAACTTGCTTCTGGTGG - Intronic
1002870033 6:1158296-1158318 GGGTCTAAAATTTCCTCTTGGGG - Intergenic
1004487034 6:16076286-16076308 GTGAGTGAAATTCCATCTGGGGG + Intergenic
1005355062 6:24974461-24974483 GGGTGTGAAATACTCTCTTGTGG - Intronic
1006534724 6:34689067-34689089 GGGTGTAAAGTTTCATTTTGGGG + Intronic
1007163431 6:39811207-39811229 GTGTGTGATTTTCCATCTTGTGG + Intronic
1008125980 6:47668791-47668813 GGATGAGAAGTTGCATCTTATGG + Intronic
1008777416 6:55057502-55057524 TGGGGTGAGATGGCATCTTGTGG + Intergenic
1009748015 6:67845565-67845587 GGATGAGAAATTGCTTCTTATGG - Intergenic
1010265428 6:73860487-73860509 GGGTGTGAAGTGACATCTTGTGG + Intergenic
1010482299 6:76370128-76370150 TGGTGTGAGATTGAATCTCGTGG + Intergenic
1011044143 6:83063675-83063697 GTGTGTAAAATAGTATCTTGTGG - Intronic
1012236187 6:96818960-96818982 TGGTGTGAGATGGTATCTTGTGG - Intronic
1013497673 6:110714601-110714623 GGGTGTGAAGTAGTATCTTGTGG + Intronic
1014251576 6:119120699-119120721 GGGTGTGAAATAGGATCTAGTGG + Intronic
1015084088 6:129266170-129266192 TCCAGTGAAATTGCATCTTGTGG - Intronic
1016612057 6:146000780-146000802 GGGTGTGAAGTGGTATCTTATGG + Intergenic
1016791580 6:148071890-148071912 TGGTGTGAAATGGCATCTTATGG + Intergenic
1019347851 7:539370-539392 GGGTGTGTAACTGCCTCCTGAGG + Intergenic
1021310409 7:19088686-19088708 GGGTGAGAAGTGGAATCTTGTGG - Intronic
1022798796 7:33755296-33755318 GGGTCTGAAATTGAGCCTTGGGG + Intergenic
1023281393 7:38574402-38574424 GGGTGTTCATTTGCATCTTGAGG - Intronic
1023391842 7:39718427-39718449 GAGTGTGAAGTTGGGTCTTGAGG - Intergenic
1027589742 7:80102678-80102700 GGGTGTGAAGTGGCATCTTCCGG + Intergenic
1028629566 7:92919927-92919949 AGGTGTGAGATGGTATCTTGTGG + Intergenic
1028665048 7:93332434-93332456 GGGTGTCAACATGCATTTTGAGG + Intronic
1030470559 7:109957901-109957923 GGGTGTGAAATTCTATGTTATGG - Intergenic
1033058407 7:138081358-138081380 GTGTGTGAGAGTGGATCTTGGGG - Intronic
1033178845 7:139154035-139154057 TGGTGTGAAGTGGAATCTTGTGG + Intronic
1033668520 7:143466662-143466684 GGGTGTGAAATGGTATCTTGTGG + Intergenic
1035084463 7:156246623-156246645 GTGAGAAAAATTGCATCTTGTGG - Intergenic
1037155119 8:15690211-15690233 TGGTGTGAGGTAGCATCTTGTGG + Intronic
1037295328 8:17393994-17394016 GGGTGTGAAGCGGTATCTTGTGG - Intronic
1037568570 8:20139248-20139270 GGGTGTGAAATGGTCGCTTGTGG - Intergenic
1038738613 8:30196610-30196632 GGGTGTGAAATGGTATCTGGTGG - Intergenic
1041576132 8:59397677-59397699 TGGTGTGAAATGGTGTCTTGTGG - Intergenic
1045133705 8:99188769-99188791 GGGTATGAAGTGGTATCTTGTGG + Intronic
1046357419 8:113106987-113107009 AGGTGTGAGATTTCATTTTGGGG - Intronic
1046509660 8:115186192-115186214 GTGTGTGAAATTATATCTTTAGG - Intergenic
1047357389 8:124136079-124136101 GGGTGTGAAGTGCTATCTTGTGG + Intergenic
1048470796 8:134702448-134702470 GGGAGATAAATTGAATCTTGGGG + Intronic
1049175736 8:141191595-141191617 GGGAGTGAAGTGGCGTCTTGTGG + Intronic
1050590583 9:7156056-7156078 TGGTGTGAGATGGTATCTTGTGG + Intergenic
1050641458 9:7672214-7672236 GGGTGTGAAGTTTCAGTTTGGGG + Intergenic
1051481464 9:17566359-17566381 GGGTATGAAGTATCATCTTGTGG + Intergenic
1052120138 9:24704545-24704567 GGGTGTGAAGTTGTATCTTATGG - Intergenic
1052450457 9:28623504-28623526 GTGTGTGAATTTTCTTCTTGGGG + Intronic
1052476893 9:28971576-28971598 GAGTGGGAGACTGCATCTTGTGG + Intergenic
1058563453 9:106254695-106254717 GGGTGTGTAGTGGGATCTTGTGG + Intergenic
1059074343 9:111176239-111176261 TGGTGGGAAACTGCATATTGTGG - Intergenic
1062230923 9:135480737-135480759 GGTTGTAAAATTGCAGCTTCTGG + Intronic
1062403960 9:136385228-136385250 GGGTGTGAAGTGGTGTCTTGTGG - Intronic
1186128963 X:6445850-6445872 GGCTGTGAAATTGCAGTTTTGGG - Intergenic
1186860921 X:13671685-13671707 GGGTGTGAAATGGTTTCTCGTGG - Intronic
1187296983 X:18011717-18011739 GGTTGTGGAATTGCCTGTTGAGG + Intergenic
1187878042 X:23820593-23820615 GGGTATGAAATGACACCTTGTGG + Intergenic
1190095461 X:47476608-47476630 AGGTGTGAAGTGGTATCTTGTGG - Intronic
1191131672 X:57019757-57019779 TGGTGTGAGATGGTATCTTGTGG + Intergenic
1191769079 X:64735651-64735673 TGGTGGGAGATTGGATCTTGGGG - Intergenic
1191906450 X:66096301-66096323 TGGTGTGAGATGGTATCTTGTGG - Intergenic
1193371084 X:80698009-80698031 TGGTGTGAGATGGTATCTTGTGG + Intronic
1194836041 X:98684115-98684137 TGGTGTGAAATGGCATCTCACGG + Intergenic
1195828391 X:109028503-109028525 AGGTGTGAAGTGGTATCTTGTGG - Intergenic
1196036242 X:111148725-111148747 GGGTGGGTAATTGAATCATGGGG - Intronic
1196064726 X:111451095-111451117 TGGTGTGAAATTGTATCTTGTGG - Intergenic
1196520616 X:116667272-116667294 GGTTGTGAAAAAGGATCTTGTGG - Intergenic
1197414762 X:126161782-126161804 AAGTGAGAAATTGCATCCTGGGG + Intergenic
1197694648 X:129538046-129538068 GGTTGTGAAATGGTATCTCGTGG + Intergenic
1197908082 X:131448375-131448397 AGGTGTGAAGTGGTATCTTGTGG + Intergenic
1197979037 X:132196455-132196477 GGGTGTGTAATTTCAGCTTGGGG - Intergenic
1199790297 X:151148105-151148127 GGGTGGGTAATGGCATCTTGAGG + Intergenic
1201737604 Y:17286174-17286196 GGGTGTGCAATTGAATTATGAGG + Intergenic