ID: 1179061699

View in Genome Browser
Species Human (GRCh38)
Location 21:37985058-37985080
Sequence TGGGATTCTTGAGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179061699_1179061706 14 Left 1179061699 21:37985058-37985080 CCTGCAGCATCTCAAGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 291
Right 1179061706 21:37985095-37985117 ACACATGCCAAGGGTATTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 231
1179061699_1179061705 13 Left 1179061699 21:37985058-37985080 CCTGCAGCATCTCAAGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 291
Right 1179061705 21:37985094-37985116 CACACATGCCAAGGGTATTGAGG 0: 1
1: 0
2: 0
3: 11
4: 140
1179061699_1179061703 5 Left 1179061699 21:37985058-37985080 CCTGCAGCATCTCAAGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 291
Right 1179061703 21:37985086-37985108 ACTCTATCCACACATGCCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 138
1179061699_1179061702 4 Left 1179061699 21:37985058-37985080 CCTGCAGCATCTCAAGAATCCCA 0: 1
1: 0
2: 0
3: 16
4: 291
Right 1179061702 21:37985085-37985107 TACTCTATCCACACATGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179061699 Original CRISPR TGGGATTCTTGAGATGCTGC AGG (reversed) Intronic
900804859 1:4760878-4760900 TGGGATTCTTGGGGTCCTGTAGG + Intronic
901314550 1:8297300-8297322 CTGGATTCCTGAGTTGCTGCAGG - Intergenic
901413967 1:9104450-9104472 TGGGATTCCTGAGATTCTCCTGG + Exonic
902761966 1:18587131-18587153 TGGCATTGCTGAGCTGCTGCTGG - Intergenic
903915801 1:26763342-26763364 TCAGATTATTGAGATGCTTCTGG + Intronic
905199142 1:36304763-36304785 TGGGATACTGGAGCTGCTGGTGG - Exonic
906893296 1:49741673-49741695 TAAGATTTTTGATATGCTGCTGG - Intronic
907647985 1:56263322-56263344 TGGGATGCTTGAAAATCTGCAGG - Intergenic
909300156 1:74002674-74002696 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
910134458 1:83950988-83951010 AGGTATCTTTGAGATGCTGCAGG - Intronic
911089496 1:94007195-94007217 TGGGATTCAAGAGCTCCTGCAGG + Intronic
911147468 1:94566775-94566797 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
914980119 1:152407994-152408016 TAGGAATCTTGAGATGGTGGGGG - Intergenic
915029771 1:152868137-152868159 TGGGAGTCCTGAGCTTCTGCTGG + Intergenic
916460362 1:165017738-165017760 TGAGATTTTTGATGTGCTGCTGG + Intergenic
917002257 1:170373202-170373224 TAGGCTTCTTGATGTGCTGCTGG + Intergenic
917761796 1:178168603-178168625 TGCTATTGTTGAGATTCTGCAGG - Intronic
917871175 1:179243362-179243384 TTGGATTTTTGAGTTGATGCTGG + Intergenic
919091225 1:192980474-192980496 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
921559673 1:216642034-216642056 TGGGATTCTTCAGAGGCTATGGG - Intronic
922876930 1:228947491-228947513 TGGGATTCTTCAGTTACTTCAGG - Intergenic
923050904 1:230390681-230390703 TGGGCTTCTTGAGATGTCCCAGG - Intronic
923593567 1:235342105-235342127 TGGGATTCCATAGATGCTGTGGG - Exonic
1063655712 10:7986321-7986343 TGCTATTTTTGAGGTGCTGCTGG - Intronic
1064358861 10:14645167-14645189 TGTGATTCAGGACATGCTGCTGG + Intronic
1064812275 10:19213941-19213963 TGGGAATCTTGAGGTGTTTCTGG + Intronic
1065183401 10:23149211-23149233 TGGGAACTTTCAGATGCTGCTGG - Intergenic
1065392815 10:25201842-25201864 TGAGCTTCTTGATATGCTGCTGG + Intronic
1066230127 10:33424089-33424111 TGGGCATCTCTAGATGCTGCGGG + Intergenic
1066375736 10:34856483-34856505 AGGGGTTCTTATGATGCTGCAGG - Intergenic
1067353977 10:45506837-45506859 TGTGATTCTTCAGTTGCTTCAGG + Intronic
1068050485 10:51943822-51943844 TAAGCTTCTTGAGGTGCTGCTGG + Intronic
1068349392 10:55823312-55823334 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1068522645 10:58094392-58094414 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1070513844 10:77185431-77185453 TAGCTTTCTTGAGATGCTCCTGG - Intronic
1070567997 10:77618495-77618517 TGCATTTCTTGAGTTGCTGCAGG - Intronic
1072047560 10:91672058-91672080 TGAGTTTCTTGAGCTGCTGATGG - Intergenic
1072751296 10:97980998-97981020 TGTGATTCTTGACAAGGTGCAGG + Intronic
1072870799 10:99117991-99118013 TAAGATTTTTGATATGCTGCTGG - Intronic
1075290693 10:121228136-121228158 TTGGATTTTTGAGTTGATGCTGG - Intergenic
1075333769 10:121594509-121594531 TGGGATTCTTTTGATTTTGCTGG - Intronic
1076469125 10:130706375-130706397 TTGGACTTTTGAGTTGCTGCTGG + Intergenic
1076803012 10:132841165-132841187 TCGGACTTTTGAGTTGCTGCTGG - Intronic
1077678622 11:4219654-4219676 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1077679474 11:4225228-4225250 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1077682012 11:4250677-4250699 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1077688891 11:4321812-4321834 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1080925550 11:36752435-36752457 TGGGAGTCTGGAGATGCTGAGGG + Intergenic
1081189191 11:40081920-40081942 TTGGACTTTTGAGATGGTGCTGG + Intergenic
1081405380 11:42691771-42691793 TAGGGTTCTTGATGTGCTGCTGG - Intergenic
1081655951 11:44857662-44857684 TGGGCTTCCTGAGCTGCTGTGGG + Intronic
1082787056 11:57323049-57323071 TGGGATTATTGAGACCCTGAGGG + Intronic
1083716815 11:64582241-64582263 TGGGATGATTGAGATGGTGGTGG - Intergenic
1083953624 11:65970774-65970796 TGGAATTCATGAGCTGCTGAGGG + Intronic
1084308965 11:68304960-68304982 TGGGATTTTTGAGTTAATGCTGG + Intergenic
1085291123 11:75400222-75400244 TGGGATTCTTTAGACGGTGCAGG + Intronic
1089671163 11:120057953-120057975 TGTGGGACTTGAGATGCTGCCGG + Intergenic
1090898390 11:131001935-131001957 AGGGATTCATGAGAAGCTACTGG + Intergenic
1092071872 12:5637844-5637866 TGTGAATCTTGAGATGCTCTGGG - Intronic
1092148742 12:6232674-6232696 TGGGCTTCCTGGGCTGCTGCGGG + Exonic
1092327423 12:7547703-7547725 TAAGATTTTTGATATGCTGCTGG - Intergenic
1092627109 12:10338554-10338576 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1093407445 12:18822178-18822200 AGGTATTCTGGTGATGCTGCTGG - Intergenic
1099431246 12:82588949-82588971 TAAGATTTTTGATATGCTGCTGG - Intergenic
1100934102 12:99643622-99643644 TTGGATTCCTGAAATTCTGCAGG - Intronic
1101023733 12:100579743-100579765 TGGAATTCCTGAGGTGCTTCCGG + Intronic
1101845256 12:108358405-108358427 CTGGATACCTGAGATGCTGCTGG + Intergenic
1102012717 12:109628533-109628555 TGGGGCTCTGGAGATTCTGCAGG - Intergenic
1102531653 12:113551098-113551120 TGGGTTTCTTCATATGCTGATGG + Intergenic
1102738473 12:115184714-115184736 TTGGGTTCTGGAGATGCAGCAGG - Intergenic
1102928623 12:116845686-116845708 TGGGAATCTGTAGAAGCTGCAGG + Intronic
1106451791 13:29888920-29888942 TGGGATCCTTCCCATGCTGCTGG + Intergenic
1107254537 13:38407951-38407973 TGTGATTCCTGGGAAGCTGCTGG + Intergenic
1107458009 13:40572917-40572939 TGGGCTTCTGGTGATGCTGAGGG - Intronic
1109776674 13:67050038-67050060 TGGGATTCAGGAGAACCTGCAGG - Intronic
1111508637 13:89230430-89230452 TGAACTTCTTGATATGCTGCTGG + Intergenic
1112087702 13:96049104-96049126 TAAGCTTTTTGAGATGCTGCTGG - Intronic
1113480838 13:110619654-110619676 TGGGAGTGTTGAGATATTGCTGG + Intronic
1113574191 13:111382602-111382624 TGGGGTTGTGGAGATGCTGAGGG + Intergenic
1113986878 13:114324623-114324645 CGAGATTCTGGAGATGCAGCTGG - Exonic
1114197881 14:20495070-20495092 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1114338773 14:21721019-21721041 TGGAATTCTTTGGGTGCTGCTGG + Intergenic
1115460043 14:33650309-33650331 CAGGATGTTTGAGATGCTGCAGG + Intronic
1116317687 14:43418077-43418099 TTGGATTCTCCAAATGCTGCAGG + Intergenic
1119722596 14:76901264-76901286 TGGAATTCCTGAGATGCCTCTGG + Intergenic
1120213671 14:81659283-81659305 AGGGATTTTGGAGATGGTGCGGG - Intergenic
1121213675 14:92229804-92229826 TAAGATTTTTGATATGCTGCTGG + Intergenic
1122721226 14:103723729-103723751 TGGGACTCTGCAGATGCTTCTGG - Intronic
1123160637 14:106275251-106275273 TGGGATTCACCAGAAGCTGCTGG + Intergenic
1123481675 15:20638292-20638314 TGGGATTCACCAGAAGCTGCTGG + Intergenic
1123636338 15:22362073-22362095 TGGGATTCACCAGAAGCTGCTGG - Intergenic
1123924430 15:25093939-25093961 TGGGCTTCTTCAGGTGCTGGTGG + Intergenic
1124224087 15:27874464-27874486 TGGGATTCCTGAGGGCCTGCAGG - Intronic
1125293381 15:38174811-38174833 GGGGATGCTTGAGTTTCTGCAGG - Intergenic
1129203486 15:74020825-74020847 TGGGAATGTTGTGATGTTGCCGG - Intronic
1129233035 15:74207250-74207272 TGAGGTTCTGGGGATGCTGCTGG - Intronic
1129623221 15:77168847-77168869 TTGGATTCCTGAGATGATTCTGG + Intronic
1131117285 15:89803182-89803204 TTGGGGTCTTGAGATGCTGAAGG - Intronic
1131710011 15:95043375-95043397 TGTGATTCTTCACTTGCTGCGGG - Intergenic
1132320643 15:100922512-100922534 TTGGATTTTTGAAATGCTGTTGG + Intronic
1132397495 15:101485046-101485068 TGGGAACTTTCAGATGCTGCTGG - Intronic
1132489577 16:218979-219001 TCGGATTCCTGAGTAGCTGCGGG - Intronic
1132959448 16:2613808-2613830 GGGGTTTCCTGAGATGCCGCAGG + Intergenic
1132972509 16:2695783-2695805 GGGGTTTCCTGAGATGCCGCAGG + Intronic
1134633667 16:15776194-15776216 AGGGATTCTGGGGATACTGCGGG + Intronic
1135907000 16:26521338-26521360 TGGGTTTCTTCACATGCCGCAGG - Intergenic
1137223128 16:46475358-46475380 TGGGAAATTTGAGATGCTACAGG + Intergenic
1143617456 17:8061974-8061996 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1144385482 17:14745525-14745547 TGTGGTTCTTGAGATGAGGCTGG + Intergenic
1144427912 17:15161761-15161783 TGGGATTCTTCGGAGACTGCTGG - Intergenic
1146428968 17:32772964-32772986 TGTGATTCTTCAGTTGCTTCAGG - Intronic
1147610926 17:41801443-41801465 TGGGATTCTTGGGGTGCAGTGGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1149235366 17:54583833-54583855 TAGGCTTTTTGATATGCTGCTGG - Intergenic
1149771904 17:59329119-59329141 TGGGATTAGTGAGAGGTTGCTGG + Intergenic
1149890484 17:60385038-60385060 TGTGATTCTTCAGTTGCTTCAGG - Intronic
1150613668 17:66752795-66752817 TGAGCTTCTTGACATGGTGCTGG + Intronic
1151116464 17:71740877-71740899 TGTGATTCAGGAGAGGCTGCAGG - Intergenic
1152024400 17:77799253-77799275 TTGGATTCTTCACACGCTGCCGG + Intergenic
1152077048 17:78166332-78166354 TGGGATTCTTGGAGTGCTGGTGG + Intergenic
1154442329 18:14401986-14402008 TGACATTGTTGAGCTGCTGCAGG - Intergenic
1155943973 18:31826969-31826991 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1159928993 18:74293133-74293155 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1160144678 18:76353737-76353759 TGGGATTCTGGTGAGGCTTCAGG - Intergenic
1161827319 19:6576956-6576978 TGTGGTTCTTGAGTTGCTCCAGG - Intergenic
1161875611 19:6906711-6906733 TGGGAGTCTTGTGTTGATGCTGG - Intronic
1162078326 19:8203944-8203966 TGTGATTCTTCAGTTGCTTCAGG + Intronic
1162478814 19:10916192-10916214 TGGAATTCGTGAGCTGGTGCAGG + Intronic
1163050846 19:14682568-14682590 TGGGATTCTTGAGGTTTTGGGGG + Intronic
1165177078 19:33938348-33938370 TGGGGTTCCTGAGTTGCTGTTGG - Intergenic
1167847703 19:52178082-52178104 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
925334634 2:3086138-3086160 TGGGCTTTTTGATGTGCTGCTGG - Intergenic
929093389 2:38241344-38241366 TGGGTTGCCTGAGATGCTGTAGG - Intergenic
932354725 2:71059317-71059339 TGGGATTATTGAGCTGATACAGG + Intergenic
933329246 2:80876141-80876163 TGGGATTCTTCAGTTACTTCAGG + Intergenic
934888466 2:98045492-98045514 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
935598671 2:104899994-104900016 TGTGATTCTTGTGATCCTGGAGG - Intergenic
935672709 2:105569693-105569715 TGGTATTTTTGAAAGGCTGCCGG + Intergenic
937573896 2:123395755-123395777 TAAGATTTTTGATATGCTGCTGG - Intergenic
937594649 2:123659233-123659255 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
938631654 2:133174085-133174107 TGGGATTCTGGATAGGATGCTGG - Intronic
939101875 2:137904479-137904501 TGAAATTGTTGAGCTGCTGCAGG + Intergenic
940064139 2:149607893-149607915 TGGGACTTTTGAGTTGATGCTGG - Intergenic
940087624 2:149878956-149878978 TGAGCTTCTTGATGTGCTGCTGG + Intergenic
940183585 2:150959782-150959804 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
943421953 2:187676180-187676202 TGTGATTCTTGAGTTACTTCAGG + Intergenic
943460479 2:188166283-188166305 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
945491100 2:210456174-210456196 TGGGTTTCTGGATATGCTGCAGG - Intronic
945554406 2:211261851-211261873 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
945555194 2:211267323-211267345 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
947118974 2:226797862-226797884 GGGGATTGTTGAGATGGTGCCGG + Exonic
947497328 2:230647387-230647409 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
947914972 2:233825684-233825706 TGAGCTTTTTGATATGCTGCTGG + Intronic
948899073 2:240947024-240947046 TGGGTTTCTGCAGAGGCTGCAGG - Intronic
1169399136 20:5264997-5265019 TGGGAAGCATGAGAGGCTGCGGG - Intergenic
1171282067 20:23909644-23909666 TGGAATTGCTGAGTTGCTGCTGG + Intergenic
1173101513 20:40093177-40093199 TGTGATTCTTGAGTTACTTCAGG - Intergenic
1173102338 20:40098643-40098665 TGTGATTCTTGAGTTACTTCAGG - Intergenic
1173407463 20:42778950-42778972 TGGGAATGCTGAGATGCTACTGG - Intronic
1175591667 20:60197777-60197799 TGAGCTTTTTGATATGCTGCTGG + Intergenic
1176304908 21:5118266-5118288 GGGGCTTCCTGAGATGCTGGGGG - Intronic
1176930465 21:14803850-14803872 TAAGATTCTTGATGTGCTGCTGG - Intergenic
1178900720 21:36596344-36596366 TGGCATCCTTGAGGTGCAGCAGG - Intergenic
1179061699 21:37985058-37985080 TGGGATTCTTGAGATGCTGCAGG - Intronic
1179852146 21:44143764-44143786 GGGGCTTCCTGAGATGCTGGGGG + Intronic
1180019734 21:45114826-45114848 GGGAACGCTTGAGATGCTGCAGG + Intronic
1181077320 22:20389615-20389637 TTGGATTCATGTGATGTTGCAGG - Exonic
1181361326 22:22339503-22339525 TTGGATTGTTAGGATGCTGCAGG - Intergenic
1181766391 22:25095213-25095235 TGTGATTCTGGAGATTCTGTGGG + Intronic
1182936275 22:34225101-34225123 TAGGATGGCTGAGATGCTGCAGG + Intergenic
1183672543 22:39281574-39281596 AGGGATTCTTGTGATTGTGCTGG - Intergenic
1184940293 22:47760040-47760062 GGGTATTCTTGAGGAGCTGCAGG + Intergenic
1185072318 22:48663043-48663065 GGGGATGCTTGGGATGCTCCGGG + Intronic
950932817 3:16808060-16808082 TGGGAATTTTGAGAAACTGCTGG + Intronic
951120731 3:18924585-18924607 TAAGATTTTTGATATGCTGCTGG + Intergenic
951314284 3:21169344-21169366 TGGTATTCATGAGATCCTGCAGG - Intergenic
952503383 3:33985551-33985573 TAAGTTTTTTGAGATGCTGCTGG + Intergenic
953449217 3:42992144-42992166 TGGGAGTCTGGAGAGGCTCCTGG + Intronic
954929020 3:54264045-54264067 TGGCATTCAAGACATGCTGCTGG - Intronic
955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG + Intergenic
955769848 3:62375755-62375777 TTCGGGTCTTGAGATGCTGCAGG - Intergenic
955798011 3:62657980-62658002 TGGGCTTCTGGATAAGCTGCAGG + Intronic
959385139 3:105695054-105695076 TGGAATTCTTTGCATGCTGCAGG + Intronic
961174972 3:124827721-124827743 TGTGATTCTTCACTTGCTGCGGG - Intronic
962453455 3:135541709-135541731 TGGGACTATTAAGATGCTCCAGG + Intergenic
965450660 3:168833811-168833833 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
965458370 3:168931214-168931236 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
965458628 3:168933251-168933273 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
965844927 3:172950020-172950042 GGGTTTTCTTGAGAGGCTGCAGG + Intronic
966066273 3:175825588-175825610 TGTGATTCTTCACTTGCTGCAGG + Intergenic
967159412 3:186722226-186722248 TGATATTCATGAGATGCTGGAGG - Intronic
969138416 4:5049649-5049671 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
971237321 4:24854542-24854564 TGGGTTTCTTCAGCTGCAGCAGG - Intronic
972002029 4:34049591-34049613 TGTGATTCTTTAGTTGCTTCAGG + Intergenic
973604283 4:52571178-52571200 TGTGATGCTTGAGAGGCTGCAGG - Intergenic
974637100 4:64579587-64579609 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
975250508 4:72173286-72173308 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
976289377 4:83401651-83401673 TAAGCTTCTTGATATGCTGCTGG - Intergenic
976407833 4:84679597-84679619 TGAGCTTCTTCACATGCTGCTGG + Intronic
977009856 4:91623707-91623729 TGTGATTCTTCAGATACTTCAGG - Intergenic
977010728 4:91629315-91629337 TGTGATTCTTCAGATACTTCAGG - Intergenic
977998673 4:103528915-103528937 TAAGCTTCTTGATATGCTGCTGG - Intergenic
978244065 4:106551317-106551339 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
978302804 4:107290921-107290943 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
978303512 4:107295771-107295793 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
978945575 4:114491782-114491804 TGGGATTATTGAGAAGGTGCTGG + Intergenic
979943280 4:126790901-126790923 TGGAATTCATAAAATGCTGCTGG - Intergenic
980381428 4:132024378-132024400 TGGGATTCATGAGATGATATTGG + Intergenic
980927114 4:139148845-139148867 TGGGTATCTTCAAATGCTGCTGG - Intronic
981503500 4:145476703-145476725 TGGGATTGAAGAGATGCTGGAGG - Intergenic
982734228 4:158988511-158988533 TGAGATTTTTGATGTGCTGCTGG - Intronic
983089450 4:163486678-163486700 TTGGATTTTTGAGATTATGCTGG - Intergenic
984012638 4:174389027-174389049 TGGAATCCTTGAGTTCCTGCTGG + Intergenic
986254707 5:6092487-6092509 TGTGATTCTTCAGCTGCTTCAGG + Intergenic
987514696 5:18890200-18890222 TGTGATTTTTGATGTGCTGCTGG + Intergenic
988185358 5:27854082-27854104 TGGGTTACTTCAGATCCTGCAGG - Intergenic
988336707 5:29917335-29917357 TGAGCTTTTTGATATGCTGCTGG - Intergenic
989340080 5:40364274-40364296 TGGGCTTCTTGAGATTTTGGAGG + Intergenic
989659645 5:43786539-43786561 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
989661025 5:43797861-43797883 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
989687916 5:44110794-44110816 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
989689187 5:44120047-44120069 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
989726586 5:44594643-44594665 TGGGATTCTGGAAAAGCTGCAGG + Intergenic
990024090 5:51163986-51164008 AAGGCTTCTTGACATGCTGCTGG - Intergenic
990138725 5:52679044-52679066 TAGGCTTTTTGACATGCTGCTGG + Intergenic
990195231 5:53307494-53307516 TGAGCTTCTTGATGTGCTGCTGG + Intergenic
991644669 5:68789677-68789699 TGGGATTCTTGCTATGCTAATGG + Intergenic
992439994 5:76789496-76789518 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
994778453 5:104063995-104064017 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
994847061 5:105002933-105002955 TGAGCTTTTTGATATGCTGCTGG + Intergenic
995718411 5:115103847-115103869 TGGGATTCTTAAGAGACTTCTGG + Intergenic
998490607 5:142543021-142543043 TTGGCTTCTTGAGATTCTGCTGG + Intergenic
999659874 5:153849745-153849767 TAAGATTTTTGAGGTGCTGCTGG + Intergenic
1000345098 5:160307774-160307796 TGGGCTTCTGCAGATGCAGCAGG + Intronic
1000700740 5:164445963-164445985 TGTGATGCTTAAAATGCTGCTGG + Intergenic
1000737657 5:164925682-164925704 TAAGATTCTTGATGTGCTGCTGG + Intergenic
1002582764 5:180219943-180219965 TTAGATTTTTGATATGCTGCTGG + Intergenic
1003677572 6:8220507-8220529 TGGGATTCTTGAGGTTATGAAGG - Intergenic
1004148158 6:13089320-13089342 TGGGATTTCTGAGAGGGTGCAGG + Intronic
1007878466 6:45134491-45134513 TTGGACTTTTGAGTTGCTGCTGG - Intronic
1009591192 6:65673062-65673084 TGTGATTCTTCAGTTGCTTCAGG + Intronic
1012120839 6:95365325-95365347 TGGGATTTTTGAGTTAATGCTGG - Intergenic
1013352396 6:109317662-109317684 TGGGACCCCTGAGATGCTGCCGG + Intergenic
1017304520 6:152900758-152900780 TAGGTTTTTTGATATGCTGCTGG + Intergenic
1017310347 6:152968712-152968734 TAGGCTTTTTGAGGTGCTGCTGG + Intergenic
1019219780 6:170464295-170464317 TGGGAGGCTTGAGAACCTGCTGG - Intergenic
1021051602 7:15992218-15992240 TAGGCTTTTTGATATGCTGCTGG + Intergenic
1022447916 7:30484962-30484984 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1024226188 7:47328247-47328269 CGGGATTGTTGAGCTGCTGCTGG + Intronic
1024738681 7:52332963-52332985 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1024739531 7:52338975-52338997 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1029886952 7:103883059-103883081 TAGGATTTTTGATGTGCTGCTGG - Intronic
1030202811 7:106922574-106922596 TGTGCTTTTTGAGGTGCTGCTGG - Intergenic
1030446079 7:109647551-109647573 TGCGATTCTTCAGTTGCTTCAGG + Intergenic
1031664235 7:124465092-124465114 TAAGATTTTTGATATGCTGCTGG + Intergenic
1033964849 7:146962395-146962417 AGGAATACTTGAGATGATGCAGG + Intronic
1035090457 7:156305863-156305885 TGGGACGCTGGAGATGCTGGAGG - Intergenic
1035767193 8:2115989-2116011 TGGCATTATTGAGATGGTGATGG + Exonic
1035812183 8:2501667-2501689 TGTGATTCATGAGGTGCTTCAGG - Intergenic
1035862659 8:3046715-3046737 TGGAAGTCTTCAGCTGCTGCGGG - Intronic
1036549330 8:9803027-9803049 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1039281860 8:35994896-35994918 TGAGCTTTTTGATATGCTGCTGG - Intergenic
1041110478 8:54478161-54478183 TGGGATGCTTTAGAAGGTGCTGG + Intergenic
1042638274 8:70903008-70903030 TAGGCTTCTTGATGTGCTGCTGG + Intergenic
1044435700 8:92160257-92160279 TGGGATGTTTGAGGTGCTGATGG - Intergenic
1045533013 8:103002145-103002167 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1046321467 8:112582443-112582465 TGGTATATTTGAGATACTGCAGG + Intronic
1046908539 8:119601114-119601136 TGCAATCCTTGGGATGCTGCTGG + Intronic
1047765408 8:127986203-127986225 TGGCATGCTTGATATTCTGCTGG + Intergenic
1048097045 8:131308306-131308328 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1048848213 8:138619701-138619723 TGGGTTTCCTGGGATGGTGCTGG + Intronic
1050067992 9:1780841-1780863 TGAGCTTTTTGATATGCTGCTGG + Intergenic
1050222385 9:3408048-3408070 TTGGCGTCTTGAGAAGCTGCAGG - Intronic
1055210655 9:73786803-73786825 TGAGCTTCTTGATGTGCTGCTGG - Intergenic
1055872444 9:80899265-80899287 TGTGGTTCTTGAAATGCTACAGG - Intergenic
1056656567 9:88514438-88514460 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1057307724 9:93921785-93921807 TGGGCTCCCTGAGAGGCTGCCGG - Intergenic
1058691926 9:107527397-107527419 AGACCTTCTTGAGATGCTGCTGG - Intergenic
1060863887 9:126979608-126979630 TGGGATCCTTGCCAGGCTGCTGG + Intronic
1062668094 9:137688954-137688976 TGGGAGTGGTGAGCTGCTGCAGG + Intronic
1185602856 X:1352151-1352173 TGGATTTCTTGAGCTGCAGCTGG + Exonic
1185862286 X:3590949-3590971 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1186420242 X:9419870-9419892 TGAGATTCTTGGAATCCTGCAGG + Intergenic
1187933002 X:24311278-24311300 TGGGCTGCTGGAGCTGCTGCAGG + Intergenic
1187939210 X:24364884-24364906 TGGGCTGCTGGAGCTGCTGCAGG - Intergenic
1188424365 X:30029454-30029476 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1188643715 X:32538225-32538247 TGTGATTCTTCAGTTGCTTCAGG - Intronic
1190359618 X:49636607-49636629 TGGGCTTCATCAGATTCTGCAGG + Intergenic
1190988379 X:55521459-55521481 TGGGCTCCTTGATATGCTGGAGG + Intergenic
1191081663 X:56517794-56517816 AGGGATTCTTAAAATTCTGCAGG + Intergenic
1191950611 X:66587642-66587664 TAAGCTTCTTGATATGCTGCTGG + Intergenic
1191981908 X:66934884-66934906 TAGGCTTTTTGATATGCTGCTGG + Intergenic
1192730902 X:73801754-73801776 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1192731938 X:73809319-73809341 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1194031453 X:88821217-88821239 TTAGATTTTTGATATGCTGCTGG + Intergenic
1194180406 X:90704717-90704739 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1194199904 X:90941637-90941659 TGGGACTTTTGAGTTGATGCTGG + Intergenic
1195017259 X:100791798-100791820 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1195141489 X:101964992-101965014 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1195349981 X:103986506-103986528 TACAATTCTTGAGATGCTGCTGG + Intergenic
1195351938 X:104004636-104004658 CACGCTTCTTGAGATGCTGCTGG - Intergenic
1195357462 X:104052333-104052355 TACAATTCTTGAGATGCTGCTGG - Intergenic
1196222052 X:113122748-113122770 TGTGATTCTTCAGTTGCTTCAGG + Intergenic
1197204390 X:123777364-123777386 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1197626368 X:128806789-128806811 TGTGATGCTTGAGATGCTCCTGG - Intergenic
1199256664 X:145725666-145725688 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1200527070 Y:4286876-4286898 TGTGATTCTTCAGTTGCTTCAGG - Intergenic
1200545895 Y:4518053-4518075 TGGGACTTTTGAGTTGATGCTGG + Intergenic