ID: 1179062508

View in Genome Browser
Species Human (GRCh38)
Location 21:37992134-37992156
Sequence ATTGTTCACCAGCTCTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179062508 Original CRISPR ATTGTTCACCAGCTCTCCAT GGG Intronic
901025738 1:6277851-6277873 GCTGTTCACCTGCTCTCCCTGGG - Intronic
902623970 1:17666311-17666333 ATTGATCAGCAGCTCTTCCTGGG + Intronic
904059512 1:27697063-27697085 ATACTTCTCCAGCTCTCTATTGG - Intergenic
905967499 1:42111513-42111535 AATGTTTACCAGCTCTCTACTGG - Intergenic
908392934 1:63699722-63699744 AATGTTCTCCAGCTCTGCAGAGG + Intergenic
913244949 1:116863176-116863198 ATTATTCACCCACACTCCATTGG + Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915871186 1:159561226-159561248 ATTGTTCTCCAGGGCTTCATTGG - Intergenic
917679057 1:177347812-177347834 ATTGTTTACTAACTCTGCATAGG + Intergenic
919091114 1:192979784-192979806 ATTATTCACCCACACTCCATTGG - Intergenic
919849560 1:201663523-201663545 TCTGTTCACAATCTCTCCATTGG + Intronic
920296224 1:204958815-204958837 ATTGTTCACCACCTCTGCAGGGG - Intronic
920438232 1:205961873-205961895 ATTCTTCACAAGCTCCCCAGAGG - Intergenic
920646398 1:207807183-207807205 AGTGGTCACCAGCTCTGCCTGGG - Intergenic
1066362720 10:34746858-34746880 ATTGTTCTCCAGCTGTCTAGAGG - Intronic
1068265967 10:54650415-54650437 AATGTTCACAAGTACTCCATAGG - Intronic
1073013686 10:100381670-100381692 ATTATTCACCCACACTCCATTGG + Intergenic
1075821717 10:125318991-125319013 TTTGTTCATCTGCTGTCCATTGG + Intergenic
1079936769 11:26626392-26626414 TTTGTTCTAGAGCTCTCCATTGG - Intronic
1084091511 11:66882040-66882062 ATTGTTCGTCAGCTCTCGTTGGG - Intronic
1086877980 11:92120745-92120767 ATTATTCTCCACTTCTCCATTGG - Intergenic
1086941204 11:92800435-92800457 GTTGTTCACCAGCACTGCACAGG + Exonic
1089941450 11:122422296-122422318 GTTGTCCTCCAGGTCTCCATGGG - Intergenic
1095623421 12:44284465-44284487 ATTGTTCACCAGTTCAACAGAGG - Intronic
1096628421 12:52909645-52909667 CTTGCTCACCAGCTGTCCACTGG + Intronic
1097970016 12:65623498-65623520 ATTGTTCATCAGATATCCAAGGG - Intergenic
1100743244 12:97618332-97618354 ATTGTTGACCAGGGCACCATGGG - Intergenic
1102962796 12:117104208-117104230 CTTGTTTACCAGCTCACCACTGG - Intergenic
1109528640 13:63609591-63609613 ATTGTTCACTAGTTTTCCGTAGG + Intergenic
1113022211 13:105900048-105900070 ATTGATCCCCAGCCCTCCAGGGG + Intergenic
1113370939 13:109724942-109724964 AATGTTCCCCAGTTCTTCATGGG + Intergenic
1118977493 14:70690306-70690328 TTTGTTCACCAAGTCTCAATTGG + Intergenic
1121193492 14:92049367-92049389 ATTATTCACCCACACTCCATTGG - Exonic
1121289178 14:92760584-92760606 ATTATTCACCAGCATTCCAGAGG + Intergenic
1121789364 14:96687345-96687367 TATGTTCACCAGCTTTCCACAGG + Intergenic
1122507442 14:102240664-102240686 ATTATTCACCCACACTCCATTGG + Intronic
1125213398 15:37240844-37240866 ATTGTTCACCCACGTTCCATTGG - Intergenic
1128078124 15:64841225-64841247 AGTGTTCTCCTGCTCTCCTTGGG - Intergenic
1133292074 16:4728882-4728904 AAGGTGCACCAGCACTCCATGGG + Intronic
1137403854 16:48175167-48175189 ATTGGTCACCAGCTCACTATAGG + Intronic
1137821724 16:51452543-51452565 GCTGTTCACCAGCTCTCCTCTGG + Intergenic
1138658988 16:58506907-58506929 GTTGTTCACCAGCTCCTCCTAGG - Exonic
1138914251 16:61443633-61443655 ATTGTGCTCCACCTCTCCAGTGG - Intergenic
1140228746 16:73099982-73100004 AATGTTCACCATCTCACTATGGG + Intergenic
1145080838 17:19893079-19893101 ATTATTCACCAACACTCCATTGG - Intergenic
1146429030 17:32773412-32773434 ATTATTCACCCACACTCCATTGG + Intronic
1149506749 17:57200744-57200766 AATGCTCACCAGGTCTCCACTGG - Intergenic
1155542388 18:26881979-26882001 ATTGGCCACCAGCTGTCTATTGG - Intergenic
1155892932 18:31289120-31289142 ATTATTCACCCACACTCCATTGG - Intergenic
1157623660 18:49031034-49031056 TTAGGTCACCACCTCTCCATTGG + Intergenic
1158500384 18:57995667-57995689 ATTGATCTTCAGCTCTGCATGGG - Intergenic
1167482579 19:49742153-49742175 ACTGTGCACCAGCTGTCCCTTGG + Intronic
1168676987 19:58285822-58285844 TTTGGTCACCTGCTCTCCATAGG + Exonic
925430644 2:3789613-3789635 AGTTTTCAACAACTCTCCATTGG + Intronic
925434031 2:3820537-3820559 ATTATTCACCCACACTCCATTGG - Intronic
933137753 2:78758922-78758944 ATTATTCACCCACACTCCATTGG + Intergenic
933999263 2:87692996-87693018 TTTGTGCACAAGCTCTCCAAAGG + Intergenic
934974551 2:98791578-98791600 TTTGTTCATCAGCTGTCCCTAGG + Intergenic
936294586 2:111257895-111257917 TTTGTGCACAAGCTCTCCAAAGG - Intergenic
936561783 2:113545207-113545229 ATTATTCTCCATCACTCCATGGG - Intergenic
938582429 2:132658835-132658857 CTTGGTCATCAGCTCTCCCTTGG - Intronic
939208828 2:139144634-139144656 ATTGTTCACCAATTTTCCAGAGG - Intergenic
939276988 2:140011752-140011774 ATTTTTCAATGGCTCTCCATTGG + Intergenic
940940725 2:159557556-159557578 ATTGTTCTCCATATCTTCATAGG + Intronic
945478537 2:210316910-210316932 TTTGTTCACCAGTTTTCCTTTGG + Intergenic
946911817 2:224469428-224469450 TTTTTTCACAGGCTCTCCATAGG + Intergenic
947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG + Intergenic
1169028635 20:2391048-2391070 GTTGTTCTCAAGCTCTCCATTGG - Intronic
1170073491 20:12394500-12394522 ATTCTTCACCAGCTTTTCAGAGG - Intergenic
1170828708 20:19820727-19820749 AGTTTTCACCAGCTCCCCAGGGG - Intergenic
1176944534 21:14963116-14963138 ATTGTACACAATCACTCCATTGG - Exonic
1178597418 21:33967374-33967396 ATAGTTCAGCAGCTCCACATTGG - Intergenic
1179062508 21:37992134-37992156 ATTGTTCACCAGCTCTCCATGGG + Intronic
1183635856 22:39062174-39062196 ATTATTCACCCACACTCCATTGG - Intronic
955353371 3:58210363-58210385 TTTGTTCATCACCTCTACATGGG + Intronic
961471040 3:127112854-127112876 AATGTGCACCAGATCTCCACTGG - Intergenic
961616630 3:128187963-128187985 CTGCTTCACCAGCTCACCATTGG - Intronic
961712956 3:128841210-128841232 ATTATTCACTCACTCTCCATTGG - Intergenic
962185394 3:133253758-133253780 ATTGTTTACCAGGTTTCCCTTGG + Intronic
962840316 3:139226771-139226793 ATTGTTCCCCTGTTCCCCATGGG - Intronic
963204190 3:142615658-142615680 ATTGTTCACTAGGTTTCCCTGGG - Intronic
963599686 3:147367812-147367834 AGGGTTCACCAGTTCTCCCTTGG - Intergenic
970265122 4:14274283-14274305 TCTATTCTCCAGCTCTCCATGGG + Intergenic
971981212 4:33753614-33753636 AATCTTCACAAGCTCTCCCTAGG - Intergenic
977128018 4:93195015-93195037 ATTATTCACAATCTGTCCATAGG - Intronic
980316249 4:131204621-131204643 ATTTTTCACCAGGAGTCCATAGG + Intergenic
981482901 4:145256199-145256221 ATTATTCACCCACACTCCATTGG - Intergenic
982978717 4:162103464-162103486 ATTGGTAGCCAGTTCTCCATGGG + Intronic
986847943 5:11777763-11777785 ATTTTTTACCAGTTCTCCAGGGG - Intronic
987001971 5:13668888-13668910 TTTGTTTACCACCTCTCAATGGG + Intergenic
990565311 5:57021660-57021682 ATTATTCACCCACACTCCATTGG - Intergenic
992522520 5:77569777-77569799 TTTGTTGACCAACTTTCCATTGG + Intronic
995033964 5:107512794-107512816 ATTGTGCACTACCTCACCATGGG + Intronic
998510271 5:142707221-142707243 ATCTTTCTCCAGCTCTTCATTGG + Intergenic
999052020 5:148533172-148533194 TTTGTTCTCCAGCCTTCCATTGG + Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000272385 5:159698351-159698373 ATTATTAACAAGGTCTCCATAGG - Intergenic
1004972590 6:20928273-20928295 ATTGTTCAATAGTTCTTCATGGG + Intronic
1007084779 6:39135685-39135707 ATTATTCACCCACACTCCATTGG - Intergenic
1007374299 6:41445735-41445757 GTTGAACCCCAGCTCTCCATGGG - Intergenic
1009983574 6:70755703-70755725 ATTGTTCTCCATCTCTCAATTGG + Intronic
1021660422 7:22914173-22914195 ATTATTCACCCACACTCCATTGG + Intergenic
1023898780 7:44457871-44457893 ATTGTACACCAGCAATCTATGGG - Intronic
1024457351 7:49624743-49624765 ATTGTTAATGAGCTCTCCTTGGG + Intergenic
1027354219 7:77340714-77340736 ATTATTCACCCACACTCCATTGG + Intronic
1028590090 7:92484452-92484474 ATTATTCACCCACACTCCATTGG - Intergenic
1029806761 7:103005725-103005747 ATTTTTCATCAACTCTCCACAGG + Intronic
1029992304 7:104973515-104973537 ATTGCTCACCAAATATCCATAGG + Intergenic
1031494030 7:122424363-122424385 TTTGTTCAACAGCTGGCCATAGG - Intronic
1032471245 7:132180824-132180846 CTTCTTCACCAGCTCACCAGCGG - Intronic
1032745848 7:134785117-134785139 AATGTCCAACAGCTCTCAATGGG + Intronic
1034399155 7:150849987-150850009 ATTCTTTACCAGGTTTCCATGGG + Intronic
1034798460 7:154035169-154035191 ATTGCTCACTAGCTCATCATTGG + Intronic
1035685383 8:1520171-1520193 ATGGTTCATCAGCTATCGATGGG + Intronic
1035950961 8:4020283-4020305 CTTGTTCAGCAGCTCTGCACTGG - Intronic
1036234276 8:7024702-7024724 CTTTTTCACCAGCTCACCCTAGG - Intergenic
1042886089 8:73553835-73553857 ATTGTTCACCAGACCTCAGTGGG + Intronic
1045373443 8:101548412-101548434 ATAATTCACCAGCTTTCCAGAGG + Intronic
1046074710 8:109301865-109301887 ATTATTCACCCACACTCCATTGG + Intronic
1048392797 8:133984165-133984187 ATTGATCACCAGTTCTCTTTGGG - Intergenic
1048748741 8:137646941-137646963 ATTGTAAACCTGCCCTCCATGGG - Intergenic
1049708935 8:144055083-144055105 ATTGGACACCAGCCCCCCATCGG + Exonic
1049890898 9:70123-70145 ATTATTCTCCATCACTCCATGGG + Intergenic
1053023009 9:34708777-34708799 CATGTCCACCACCTCTCCATTGG + Intergenic
1053060156 9:35024301-35024323 ATTATTCACCCACACTCCATTGG - Intergenic
1053409895 9:37909158-37909180 ATTTTTCACAAGTTCCCCATGGG - Intronic
1053732361 9:41071307-41071329 ATTATTCTCCATCACTCCATGGG + Intergenic
1054696090 9:68360409-68360431 ATTATTCTCCATCACTCCATGGG - Intronic
1054702209 9:68424133-68424155 CTTTTTCAGCAGCTCTTCATAGG - Intronic
1055778595 9:79794285-79794307 ATTGTTCTCCCCCTCTCCTTGGG - Intergenic
1060415344 9:123425947-123425969 TTTGTTCACCAGCTCTTCATGGG - Intronic
1188890866 X:35610149-35610171 ATTATTCACCCACACTCCATTGG + Intergenic
1189277595 X:39798001-39798023 GTTGTTCACCAGCTCACCACAGG - Intergenic
1190453374 X:50602708-50602730 TTTGTTCAGCAGCTCTGCCTTGG + Exonic
1191805994 X:65134323-65134345 ATTCTTCACCCACACTCCATTGG - Intergenic
1192674354 X:73180125-73180147 ATTGTTCACCATACCCCCATGGG - Intergenic
1195017146 X:100791112-100791134 ATTATTCACCCACACTCCATTGG - Intergenic
1196279528 X:113806977-113806999 ATTGTTCACTAGCTCTAACTTGG + Intergenic
1197101347 X:122659445-122659467 ATTGGTCATGATCTCTCCATGGG - Intergenic
1197700420 X:129595548-129595570 ATTATTCCCAAGCCCTCCATGGG + Intergenic
1198593824 X:138214491-138214513 ATTCTGCACCACCTCTGCATAGG - Intergenic
1199497587 X:148470490-148470512 ATGTTTCTCCTGCTCTCCATAGG - Intergenic