ID: 1179065938

View in Genome Browser
Species Human (GRCh38)
Location 21:38024958-38024980
Sequence CATTATGGACAAAGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179065926_1179065938 18 Left 1179065926 21:38024917-38024939 CCAGACGATCCCATCACTGCCTT 0: 1
1: 0
2: 2
3: 10
4: 101
Right 1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 155
1179065928_1179065938 8 Left 1179065928 21:38024927-38024949 CCATCACTGCCTTTACCACCTCC 0: 1
1: 1
2: 2
3: 77
4: 676
Right 1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 155
1179065933_1179065938 -10 Left 1179065933 21:38024945-38024967 CCTCCCATGGACACATTATGGAC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 155
1179065930_1179065938 -1 Left 1179065930 21:38024936-38024958 CCTTTACCACCTCCCATGGACAC 0: 1
1: 0
2: 0
3: 22
4: 177
Right 1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 155
1179065927_1179065938 9 Left 1179065927 21:38024926-38024948 CCCATCACTGCCTTTACCACCTC 0: 1
1: 0
2: 5
3: 40
4: 443
Right 1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 155
1179065931_1179065938 -7 Left 1179065931 21:38024942-38024964 CCACCTCCCATGGACACATTATG 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179065938 Original CRISPR CATTATGGACAAAGGGAGCT TGG Intronic
900724589 1:4207739-4207761 CAGTATGGACAATGTGAGCCAGG - Intergenic
900855269 1:5176678-5176700 CATTCTTTACAAAGGCAGCTCGG - Intergenic
905935589 1:41821635-41821657 CAATATGTAAAAAGGGATCTGGG - Intronic
911030132 1:93478707-93478729 TATTAAGGATAAAGGGAGCCAGG + Intronic
911923134 1:103792705-103792727 CAGCATGGAGAAAGGGACCTCGG + Intergenic
916053677 1:161052954-161052976 CCTCATGGACAAAGAGGGCTGGG + Intronic
917193901 1:172446665-172446687 AATTAGAGACCAAGGGAGCTGGG - Intronic
917616761 1:176753859-176753881 CATTATGGGAAAAGGAAGTTGGG - Intronic
920348531 1:205322187-205322209 CATAAAGGAGAAAGGGAGCTGGG + Intergenic
1063769337 10:9179876-9179898 CATTATGGGAAAAGGAGGCTTGG + Intergenic
1064056786 10:12104703-12104725 CAAGATGGAAAAAGGGAGCTAGG - Intronic
1064797677 10:19031829-19031851 CATTTTTGACAAAGGCATCTAGG - Intergenic
1064975815 10:21113626-21113648 CATTCTGGGCAATGGGACCTGGG - Intronic
1072379526 10:94853275-94853297 CATTATGCACAAAGGAAGGAAGG - Intergenic
1073629763 10:105136734-105136756 CACTCAGGACAAAGGGAGATTGG + Intronic
1074491211 10:113941232-113941254 AATTATGGTCATAGGGAGTTAGG - Intergenic
1076659278 10:132044548-132044570 CAGTGTGGCCCAAGGGAGCTGGG + Intergenic
1083383290 11:62286574-62286596 AATTATGCACTCAGGGAGCTTGG - Intergenic
1084942915 11:72623455-72623477 GATAATGGAGAGAGGGAGCTTGG - Intronic
1085495042 11:76961164-76961186 CATTAAGGAGAATGGGAGCCAGG + Intronic
1086937375 11:92759593-92759615 CCTTATGGCCTGAGGGAGCTGGG + Intronic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1089780585 11:120870620-120870642 CAGTCTGGACAAAGGGTACTGGG + Intronic
1095840317 12:46685182-46685204 CATTGGGGAGGAAGGGAGCTGGG + Intergenic
1098581404 12:72103427-72103449 CAGTATGGCATAAGGGAGCTAGG + Intronic
1099644122 12:85328598-85328620 AATTATAGATAATGGGAGCTAGG - Intergenic
1100916425 12:99428452-99428474 CACTATGAATAAAGGAAGCTAGG + Intronic
1102579889 12:113879667-113879689 CATTATGGATACAGGGATCAAGG - Intronic
1104387759 12:128365813-128365835 CCATCTGGACAAAGGGGGCTGGG - Intronic
1106765140 13:32906234-32906256 GATGATGGAGAAAGGGAGGTGGG - Intergenic
1107277194 13:38690038-38690060 CATTATGGGCATAGGAAACTCGG - Exonic
1109894188 13:68661242-68661264 AATTATGGACCAAGCAAGCTGGG - Intergenic
1110587603 13:77212929-77212951 CATTCTGGAACAAGGGAGCCTGG + Intronic
1113554886 13:111225014-111225036 CATTATGTACAAAGGGGTCTTGG + Intronic
1115872866 14:37824870-37824892 TGTTATGGGCAAAGGGAGCAGGG + Intronic
1117791023 14:59342511-59342533 TACTATGCACAAAAGGAGCTGGG + Intronic
1119542514 14:75450079-75450101 TACTATGGACAAGGGGAGTTGGG + Intronic
1119970125 14:78961098-78961120 CATTATGGAGAAAAGGATTTGGG + Intronic
1121176329 14:91893149-91893171 CATTTTAGACAAAGTGAGTTGGG - Intronic
1126872295 15:53002567-53002589 CATTCTAGACAGAGGGAGCTGGG - Intergenic
1130609475 15:85347773-85347795 CCTCATGGAAAAAGGGAGCAGGG + Intergenic
1133028477 16:2998671-2998693 GAGTGTGGACCAAGGGAGCTGGG + Intergenic
1133718872 16:8475392-8475414 TATTATGCACACAGGGAGTTGGG - Intergenic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1135914620 16:26594631-26594653 CATTTTGTGCAAAGTGAGCTAGG - Intergenic
1136479174 16:30531023-30531045 CATCATGGGCAGAGGGGGCTAGG - Intronic
1140449882 16:75062529-75062551 CATAGATGACAAAGGGAGCTCGG - Intronic
1141264805 16:82487275-82487297 CATCGTGGTCAATGGGAGCTTGG - Intergenic
1151917835 17:77131695-77131717 CATTCTGGACAAATGAAGTTGGG + Intronic
1153148182 18:2057308-2057330 CTTTATGCAAAAAGGAAGCTGGG - Intergenic
1157683849 18:49627342-49627364 CATTTTTGACACAGGGAGCCGGG - Intergenic
1159658200 18:71058120-71058142 CATAAAGAACAAAGGGGGCTCGG + Intergenic
1164726625 19:30469737-30469759 CATGATGGACATAGGCAGGTGGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
930525310 2:52521967-52521989 CAATGTGGATAAAGGGGGCTGGG - Intergenic
930542909 2:52730025-52730047 CTTCAAGGAGAAAGGGAGCTAGG + Intergenic
931706104 2:64947764-64947786 CATTATGGACAAATGAAGCAGGG - Intergenic
932463486 2:71898266-71898288 AGTAATGGACAAAGAGAGCTGGG - Intergenic
933213902 2:79604252-79604274 AATTATGGAGTAAGGGAGGTGGG + Intronic
935348868 2:102136333-102136355 CCTGAGGGACAATGGGAGCTAGG - Intronic
937077821 2:119119765-119119787 CAATAAGTACAAAGGGAGATTGG - Intergenic
937922476 2:127140882-127140904 CACTCTGGACAAACGGACCTCGG - Intergenic
939501411 2:142990001-142990023 CTTTATGGGCAAAGGGCTCTTGG - Intronic
941017905 2:160377742-160377764 AATTTTTGGCAAAGGGAGCTTGG + Intronic
942267360 2:174242025-174242047 AATTCTGGACAAAGGGATGTTGG + Intronic
942401643 2:175609453-175609475 CAGTAGGAACAAAGGAAGCTGGG - Intergenic
945262858 2:207860901-207860923 CATTCTGGATAAAGGTAGCGAGG + Intronic
946153629 2:217792743-217792765 CAGTGTGGGCAAAGGGAGCCAGG - Intergenic
947610199 2:231520417-231520439 CATGATGGACCAAGCCAGCTGGG - Intergenic
1174163021 20:48565030-48565052 AATAATTGACAAAGGGAACTAGG + Intergenic
1174983615 20:55424434-55424456 TATTCTGGACACAGAGAGCTTGG - Intergenic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1178013956 21:28320498-28320520 GAATATGGACAAAGGGTGCATGG - Intergenic
1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG + Intronic
1179995041 21:44970372-44970394 CAATGGGGCCAAAGGGAGCTGGG - Intronic
1182597783 22:31435450-31435472 CAATATGGACGGAGGGGGCTGGG + Intronic
1183213797 22:36466577-36466599 CTCTATGGCCAAGGGGAGCTGGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185163777 22:49245185-49245207 GATTATGAACGAAGGGAGCAAGG - Intergenic
951666315 3:25127707-25127729 CATTTTGATCAAAGGTAGCTGGG - Intergenic
951885335 3:27518791-27518813 CATTATGGAAAGTGGCAGCTAGG + Intergenic
956021436 3:64937635-64937657 CATAATGGACAAAGGCAACCAGG + Intergenic
956854864 3:73266033-73266055 CATTCTGGACATAGGGACATAGG + Intergenic
957249138 3:77750451-77750473 CATTATGGAAAGAGGCAGATTGG + Intergenic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
960947215 3:122974929-122974951 CATTGTGGAAAAGGAGAGCTGGG - Intronic
960984486 3:123265747-123265769 CAATATAGACAAAGGAACCTTGG - Intronic
962178561 3:133181160-133181182 CGTTATTGACACAGGAAGCTGGG + Intronic
962734015 3:138308003-138308025 GAGTGTGGACAAAGGAAGCTTGG + Intronic
962769306 3:138597513-138597535 CATTGTGCACTCAGGGAGCTCGG - Intergenic
963342069 3:144048385-144048407 CATTATGGCCAAATGGAACCTGG - Intronic
965777571 3:172247914-172247936 CATTCAGGACAAAGGAAGCTAGG - Intronic
966224205 3:177580768-177580790 CATTGTGGAGAAATGGAGCCAGG + Intergenic
966683866 3:182672375-182672397 CATTCTCTAGAAAGGGAGCTTGG - Intergenic
967360263 3:188622727-188622749 CTTTTTGGAAAAAGAGAGCTGGG + Intronic
969242842 4:5912427-5912449 CTTTATGAAGAAAAGGAGCTGGG + Intronic
970171247 4:13292573-13292595 CATTATGGAAAAAGAAAACTGGG - Intergenic
970555774 4:17231105-17231127 AATCATGGTCAAGGGGAGCTGGG + Intergenic
971034053 4:22674141-22674163 CATTAGGAACAAAGTGGGCTTGG - Intergenic
976951065 4:90831201-90831223 CATTATGGAGAAAGGAAGGTAGG + Intronic
977523654 4:98118425-98118447 AATTCTGGATAATGGGAGCTAGG + Intronic
978413609 4:108452255-108452277 CATTACAGACAAATGGTGCTAGG - Intergenic
978416151 4:108478340-108478362 CATTTTGGACAAAGAGAGAGAGG + Intergenic
980224151 4:129959513-129959535 CATTTTGAACAAATGGTGCTGGG - Intergenic
980864357 4:138536926-138536948 CATTATGGACAATGGTATGTAGG + Intergenic
980881223 4:138711859-138711881 CCTTAAAGACAAAGGGAGCATGG - Intergenic
982442829 4:155456949-155456971 TATTATGGAAAAGGGGAGGTGGG + Intergenic
984019913 4:174472998-174473020 CATTATGGCAAAAGTGAGATTGG + Intergenic
984600498 4:181721142-181721164 CATTATGTACAAAGGCAGAGAGG + Intergenic
986667663 5:10117378-10117400 CAGCAGGGACACAGGGAGCTCGG - Intergenic
986916048 5:12622682-12622704 CAGCATTGACAAAGGCAGCTGGG + Intergenic
987422706 5:17739100-17739122 CATTAAGGACATAGGGAATTGGG + Intergenic
988378061 5:30464392-30464414 CATTAGGGAGAAAGAGAGATTGG + Intergenic
991437448 5:66611074-66611096 TGTTATGGACAAAGGGCCCTTGG - Intronic
992253405 5:74897864-74897886 TATTATGGACCAGTGGAGCTGGG + Intergenic
993088706 5:83397078-83397100 TGTTAAGGATAAAGGGAGCTGGG + Intergenic
995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG + Intronic
996523320 5:124451053-124451075 CACTCTGGACAAAGGGAACAAGG - Intergenic
1000529718 5:162404721-162404743 CATTAGGGATAATGGGAGCTGGG - Intergenic
1002168295 5:177361472-177361494 CTTTGTGGACCAAGGAAGCTTGG - Intronic
1002821040 6:724776-724798 CACTATGGGCAACTGGAGCTGGG - Intergenic
1004310436 6:14540504-14540526 TGTTTTGGACAAAGGGAGCCGGG - Intergenic
1005848480 6:29801117-29801139 CATTCTGGACACAGGCACCTGGG - Intergenic
1006249752 6:32772061-32772083 CATATTGGACTATGGGAGCTTGG + Intergenic
1006798263 6:36744299-36744321 AATGATGGACATGGGGAGCTTGG + Exonic
1008675988 6:53819224-53819246 CATTTTGGAGAAAGGAAGTTCGG + Intronic
1008908646 6:56708719-56708741 CATTATGGGTAAAGGGTGGTCGG + Intronic
1010136645 6:72561937-72561959 CATTGTGGACCAAGGGTGCCTGG + Intergenic
1014787464 6:125634928-125634950 GATTATGGACAAGGGGGTCTGGG - Intergenic
1015425941 6:133067533-133067555 AATTATGGCCAAAGGGATCATGG + Intergenic
1018385814 6:163301963-163301985 TAGTCTGGACAAAGGCAGCTTGG - Intronic
1018928068 6:168220868-168220890 CGTTATGGACAAAAGCAACTTGG - Intergenic
1021423510 7:20472190-20472212 CATTATGAATGAAGAGAGCTGGG + Intergenic
1022262146 7:28716563-28716585 CATTATGGAGGTAGGGAGTTCGG + Intronic
1025626454 7:63226717-63226739 CAGAATGAACAAAGGCAGCTTGG - Intergenic
1026464508 7:70642613-70642635 CAGTATGGACACAGGGAAGTAGG - Intronic
1027136461 7:75627837-75627859 GATGATGGTCAAGGGGAGCTGGG + Intronic
1027780774 7:82517307-82517329 GATTATGGACAAAGAGAGGAAGG + Intergenic
1030213211 7:107016892-107016914 CATTATGGATAGAGGAACCTAGG + Intergenic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1031708590 7:125014532-125014554 CATTATTTACAAAGTGAACTTGG + Intergenic
1032099059 7:128957996-128958018 AGTTTTGGACAAAGGGAGGTCGG - Intronic
1034094112 7:148390508-148390530 CCTTATGGTTAAAGGGATCTTGG + Intronic
1036545121 8:9760712-9760734 CTTTATGGACTAAAGTAGCTGGG - Intronic
1038929900 8:32182114-32182136 CATTATGAAAAAGAGGAGCTGGG + Intronic
1044871526 8:96625069-96625091 TATTAAGGACAAGGAGAGCTAGG - Intergenic
1045052104 8:98336708-98336730 CATTGTGGAGCAAGGAAGCTGGG + Intergenic
1045428914 8:102095164-102095186 TACTATGGTCAAATGGAGCTGGG + Intronic
1046924656 8:119773062-119773084 CATTATTGAAAAAGCAAGCTTGG + Intronic
1047406984 8:124593841-124593863 TGTGATGGACAAAGGGAGATGGG + Intronic
1047442208 8:124888273-124888295 CATTATCCACCAAGTGAGCTGGG - Intergenic
1049328588 8:142037867-142037889 CAGTAAGGACAGAGGGAGGTGGG - Intergenic
1051260250 9:15256881-15256903 CCTTATGAACAAAGGTAGATTGG + Intronic
1052087358 9:24284034-24284056 CAAGATAGACACAGGGAGCTAGG - Intergenic
1053197154 9:36128106-36128128 CATTTTGGAGAAAGGGCTCTCGG + Intergenic
1186394900 X:9198063-9198085 CACTATGGACAGAGGTGGCTTGG + Intergenic
1191969350 X:66796260-66796282 AATTATGGACAAAGGAATATAGG + Intergenic
1192276508 X:69636859-69636881 CATGATGGAGAAAGTGAGGTGGG - Intronic
1192340518 X:70259793-70259815 CAAGCTGGACCAAGGGAGCTTGG - Intergenic
1198608317 X:138369107-138369129 AATTCCAGACAAAGGGAGCTTGG + Intergenic
1199174465 X:144769225-144769247 CATCATAGACAAAAGTAGCTCGG + Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1202380604 Y:24273908-24273930 CCTCATGGAAAAAGGGAGCAGGG + Intergenic
1202490180 Y:25396217-25396239 CCTCATGGAAAAAGGGAGCAGGG - Intergenic