ID: 1179067459

View in Genome Browser
Species Human (GRCh38)
Location 21:38039366-38039388
Sequence ATTTCAACGCAGGAACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179067459_1179067470 20 Left 1179067459 21:38039366-38039388 CCCCCCAGTTCCTGCGTTGAAAT 0: 1
1: 0
2: 3
3: 24
4: 241
Right 1179067470 21:38039409-38039431 TGTTAGGAGGCGGAGCCTTTGGG 0: 1
1: 6
2: 127
3: 748
4: 1946
1179067459_1179067471 23 Left 1179067459 21:38039366-38039388 CCCCCCAGTTCCTGCGTTGAAAT 0: 1
1: 0
2: 3
3: 24
4: 241
Right 1179067471 21:38039412-38039434 TAGGAGGCGGAGCCTTTGGGAGG 0: 1
1: 31
2: 402
3: 1169
4: 2142
1179067459_1179067468 10 Left 1179067459 21:38039366-38039388 CCCCCCAGTTCCTGCGTTGAAAT 0: 1
1: 0
2: 3
3: 24
4: 241
Right 1179067468 21:38039399-38039421 AATGTGACGCTGTTAGGAGGCGG 0: 1
1: 4
2: 46
3: 361
4: 1419
1179067459_1179067469 19 Left 1179067459 21:38039366-38039388 CCCCCCAGTTCCTGCGTTGAAAT 0: 1
1: 0
2: 3
3: 24
4: 241
Right 1179067469 21:38039408-38039430 CTGTTAGGAGGCGGAGCCTTTGG 0: 1
1: 0
2: 8
3: 183
4: 943
1179067459_1179067465 4 Left 1179067459 21:38039366-38039388 CCCCCCAGTTCCTGCGTTGAAAT 0: 1
1: 0
2: 3
3: 24
4: 241
Right 1179067465 21:38039393-38039415 AGTCCTAATGTGACGCTGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 138
1179067459_1179067467 7 Left 1179067459 21:38039366-38039388 CCCCCCAGTTCCTGCGTTGAAAT 0: 1
1: 0
2: 3
3: 24
4: 241
Right 1179067467 21:38039396-38039418 CCTAATGTGACGCTGTTAGGAGG 0: 1
1: 0
2: 7
3: 76
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179067459 Original CRISPR ATTTCAACGCAGGAACTGGG GGG (reversed) Intronic
900814553 1:4833405-4833427 ATTTCAACACAGAAACTGTGGGG + Intergenic
901219078 1:7572745-7572767 ATTTCAACATAGGAATTTGGGGG + Intronic
901733740 1:11298960-11298982 ATTTCCAAGAAGGAACAGGGAGG + Intergenic
902329871 1:15726007-15726029 ATTTCAACACAGGAATCTGGAGG + Intronic
904383725 1:30128277-30128299 ATTTCAGGGCAGGAACCAGGTGG + Intergenic
907715491 1:56922497-56922519 ATTTCAACATAGGAATTTGGGGG - Intergenic
908034466 1:60037226-60037248 GTTTCAACACAGGAACTTTGAGG - Intronic
908887570 1:68807387-68807409 ATTTCAAGACAGGAACTAGATGG + Intergenic
910084264 1:83380445-83380467 ATTTCAACACATGAACTTGGAGG + Intergenic
910342683 1:86205923-86205945 AGTTCTATGCAGGAACTGTGGGG - Intergenic
914725745 1:150326054-150326076 ATTTCAACCCATGAACTTAGAGG - Intronic
915219223 1:154360719-154360741 ATTTCAACATATGAATTGGGGGG - Intergenic
916059934 1:161091475-161091497 ATCTCAAAGCAGCATCTGGGTGG - Intergenic
916699557 1:167277412-167277434 ATTCCAGCTCAGGAACTGGCTGG - Intronic
918470775 1:184870898-184870920 ATTTCAACGTATGAATTTGGGGG - Intronic
918925534 1:190781229-190781251 ATTTCAAAGCAAGAACTGTTTGG + Intergenic
920363420 1:205435205-205435227 ATTTGAACCCAGCACCTGGGTGG - Intronic
920831185 1:209467152-209467174 ATTTCAACACATGAATTTGGTGG - Intergenic
921579782 1:216882670-216882692 ATATCAATGCAGAAAATGGGTGG + Intronic
922743451 1:228029745-228029767 ATTTCAATGTAGGAATTGGGGGG - Intronic
923655629 1:235913614-235913636 ATTTCAAGGCAGGAAATGACTGG + Intergenic
1063030087 10:2225744-2225766 GTTTCCACACAGGAACAGGGGGG + Intergenic
1063997471 10:11633897-11633919 ATTTGAACTCAGGAATTGTGAGG + Intergenic
1065970579 10:30803101-30803123 ACTTCAACACATGAACTTGGGGG - Intergenic
1065993791 10:31037426-31037448 ACTTCAACACACAAACTGGGGGG - Intergenic
1067036545 10:42924818-42924840 ACTTCAACGCAGGAATTCGGGGG + Intergenic
1067945923 10:50687830-50687852 GCTTCAGCACAGGAACTGGGCGG - Intergenic
1068030599 10:51699884-51699906 ACTTCACCGTAGTAACTGGGAGG + Intronic
1068886633 10:62104501-62104523 ATTTCAACGTAGGAATTTTGGGG + Intergenic
1070867439 10:79714706-79714728 GCTTCAGCACAGGAACTGGGCGG - Intergenic
1070881231 10:79852830-79852852 GCTTCAGCACAGGAACTGGGCGG - Intergenic
1071634353 10:87236929-87236951 GCTTCAGCACAGGAACTGGGCGG - Intergenic
1071647804 10:87369146-87369168 GCTTCAGCACAGGAACTGGGCGG - Intronic
1073114290 10:101082527-101082549 ATTTAACTGCAGGAACTGGTGGG - Intergenic
1073496353 10:103894769-103894791 ATCTCAGGTCAGGAACTGGGTGG + Intronic
1075064339 10:119279325-119279347 ACTTCAACACAGGAATTTGGGGG + Intronic
1075395898 10:122126880-122126902 ATTTCAACACAGGAATTTCGGGG - Intronic
1076071574 10:127494181-127494203 ATTTCAACATAGGAATTTGGGGG + Intergenic
1076309860 10:129497676-129497698 GTTTCAACACAGGAATTTGGAGG - Intronic
1077146361 11:1048029-1048051 ATTTCAACACAGGAACCGGAGGG - Intergenic
1080273318 11:30473928-30473950 ATTTCAAGGCATGACTTGGGTGG - Intronic
1080442357 11:32306443-32306465 AAGTCAAAGCAGGTACTGGGAGG - Intergenic
1080621900 11:33993641-33993663 ACTTCAACATAGGAATTGGGAGG + Intergenic
1081792571 11:45798781-45798803 AGTTCAACACAGGATTTGGGTGG + Intergenic
1082561570 11:54626173-54626195 ATTTCAACGTAAGATTTGGGTGG + Intergenic
1083138554 11:60702839-60702861 ATTTCAACACATGAATTTGGAGG + Intronic
1083235530 11:61348508-61348530 CTTTCAACACAGGAATTTGGGGG - Exonic
1084720986 11:70905505-70905527 ATTTCAACACATGAATTCGGAGG - Intronic
1086237822 11:84653376-84653398 ATTTCAAGGTAGGCATTGGGTGG - Intronic
1088386161 11:109258722-109258744 ATTTCAACACGAGAAGTGGGCGG + Intergenic
1088824015 11:113478464-113478486 ATTTCAACATATGAATTGGGGGG + Intergenic
1088915629 11:114225693-114225715 TTTTCAACACAGGAACTTTGGGG + Intronic
1088925916 11:114302741-114302763 ATTTCAACACAGAAATTGGGAGG - Intronic
1089218252 11:116849063-116849085 GTTTCAAGGCTGGGACTGGGAGG + Intronic
1089469171 11:118707127-118707149 ATTTCAACACAGGAATTGCGAGG - Intergenic
1089958426 11:122594513-122594535 ATTTCAACACAGGAATTTGCAGG - Intergenic
1091667547 12:2430235-2430257 ATTTCAACATAGGAATTTGGGGG + Intronic
1091862538 12:3799103-3799125 ATTTCAACATAGGAATTTGGGGG - Intronic
1091867982 12:3859012-3859034 ATTTGAACCCAGGAGGTGGGGGG + Intronic
1092360594 12:7833132-7833154 AATTCCACTCACGAACTGGGAGG + Intronic
1092373195 12:7934212-7934234 AATTCCACTCACGAACTGGGAGG + Intronic
1092523060 12:9292900-9292922 ATTTCAACACAGGAATTTGGAGG + Intergenic
1092544231 12:9438997-9439019 ATTTCAACACAGGAATTTGGAGG - Intergenic
1092775473 12:11941641-11941663 ATTTCAACACATGAACTTTGGGG - Intergenic
1093228782 12:16517241-16517263 TTTTCAACACATGAACTTGGAGG - Intronic
1094508715 12:31083071-31083093 ATTTCAACACAGGAATTTGGAGG + Intronic
1097206347 12:57324800-57324822 ACTTTAACACGGGAACTGGGTGG - Intronic
1097594131 12:61606780-61606802 ATTTCAACACAAGAATTGGAGGG - Intergenic
1099217577 12:79872010-79872032 ATTTCAAGGCAGAAACTGTATGG - Intronic
1099224401 12:79952133-79952155 ATTTCAACACAGGAATTTTGGGG - Intergenic
1100468575 12:94871281-94871303 ATTTCAACATATGAACTGCGGGG + Intergenic
1100642605 12:96496677-96496699 ATTTCAACATATGAATTGGGGGG + Intronic
1100765733 12:97863465-97863487 ATTTCAACACATGAATTTGGGGG - Intergenic
1101332800 12:103770783-103770805 ATTTCAACACAGGAATTTTGGGG - Intronic
1103426790 12:120842791-120842813 GTTTCAACATAGGAATTGGGTGG + Intronic
1104063938 12:125291023-125291045 ATTTCAACGTATGAATTGGCTGG - Intronic
1105639407 13:22246709-22246731 ATTTCAACACATGAATTTGGGGG + Intergenic
1105857630 13:24386680-24386702 ATTTCAACACAGGAATTCTGGGG - Intergenic
1105933468 13:25074943-25074965 TTTCCAACGCATGAACTGTGGGG + Intergenic
1106865550 13:33960158-33960180 ATTTCAACATGGGATCTGGGTGG + Intronic
1107396578 13:40024358-40024380 ATTTCAACTTAGAAACTGGCAGG + Intergenic
1109302122 13:60600356-60600378 GTTTCAACCTATGAACTGGGGGG - Intergenic
1109811033 13:67512760-67512782 ATTACAATGCAGGAGCTGTGAGG - Intergenic
1111557222 13:89896301-89896323 TTGTAAAGGCAGGAACTGGGAGG - Intergenic
1113248562 13:108426053-108426075 ATTTCAACATAGGAATTTGGTGG + Intergenic
1113501090 13:110774775-110774797 ATTTCAACAAATGAACTTGGTGG + Intergenic
1116433944 14:44876185-44876207 ATTTCAACATAGGAATTTGGGGG + Intergenic
1118496908 14:66316105-66316127 ACTTCAGCTCAGGAAGTGGGCGG - Intergenic
1119326100 14:73760341-73760363 ATTTGGTCGCAGGAAGTGGGCGG - Intronic
1121637183 14:95461818-95461840 CTTTCAGAGCAGGGACTGGGAGG + Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1127764250 15:62169425-62169447 ATTTCAACATAGGAATTTGGTGG - Intergenic
1128728833 15:70007024-70007046 ATTTCAACAGTGGAATTGGGAGG + Intergenic
1129348965 15:74942967-74942989 ATTTCAAGGTAGGAAATGGCAGG - Intergenic
1130115142 15:81000313-81000335 ATTTCAAGGGAGGAACGGGCAGG + Intergenic
1132121450 15:99179409-99179431 TTTTCAACACAGGCAATGGGCGG - Intronic
1134216355 16:12319814-12319836 ACTTCAAAGCAGGAAGGGGGAGG + Intronic
1134372818 16:13641272-13641294 ATGTCAAGGGAGGAACTTGGTGG + Intergenic
1135549932 16:23390131-23390153 CTTTCCAAGCATGAACTGGGAGG - Intronic
1139122340 16:64035589-64035611 ATTTCAGTGTATGAACTGGGGGG + Intergenic
1140020460 16:71233511-71233533 ATTTCAACACATGAATTTGGAGG - Intergenic
1140210588 16:72966770-72966792 AATTCAACCCTGGAACTAGGTGG - Intronic
1140218956 16:73029717-73029739 ATGTCCACGCAGGAACAGTGGGG - Intronic
1141535832 16:84679088-84679110 ATTTCAACCTAGGAATTTGGGGG - Intergenic
1143336678 17:6176615-6176637 ATTTCAACGTATGAATTCGGGGG + Intergenic
1145375061 17:22339372-22339394 ATTTCAAGGGTGGAACTGGAAGG - Intergenic
1147482142 17:40776226-40776248 ATTTCAAGGCTGGGAGTGGGAGG - Intergenic
1149327785 17:55550047-55550069 ATTTCAACATAGGAATTTGGAGG - Intergenic
1149439832 17:56664794-56664816 ATTTCAACACACGAATTTGGTGG + Intergenic
1152941926 17:83177328-83177350 ATTTCAACACATGAATTTGGGGG - Intergenic
1154438621 18:14366411-14366433 ATTTCAACGTAGGAATTTTGGGG - Intergenic
1157622484 18:49024451-49024473 ACTTCAGTGGAGGAACTGGGGGG - Intergenic
1158830417 18:61271530-61271552 ATTTGAACGCAAGAAGTGAGGGG + Intergenic
1160146267 18:76367541-76367563 ATTCCACTGGAGGAACTGGGTGG - Intronic
1160428276 18:78793181-78793203 GTTTCAACACAGGAATGGGGAGG + Intergenic
1161433731 19:4249521-4249543 ATCTCAAGGCAGGCACTGGCTGG - Intronic
1165254003 19:34562088-34562110 ATTTCAACACAGGAATTTTGGGG + Intergenic
1165310488 19:35026631-35026653 AGGTCAACGCAGGAACTCCGGGG + Intergenic
1166967845 19:46541033-46541055 ACTTCAACACAGGAATTTGGAGG + Intronic
1167226160 19:48242110-48242132 ATTTCAACACATGAACTTGAGGG - Intronic
1167752089 19:51387494-51387516 ACTTGAAGGGAGGAACTGGGGGG + Intronic
930605924 2:53493032-53493054 ATTTCAACACATGAATTTGGTGG - Intergenic
932483111 2:72061598-72061620 ATGTCAAGGGAGGAACTGGTGGG - Intergenic
933690702 2:85177304-85177326 ATTTCAACACAGGAATTTGGTGG + Intronic
935326938 2:101946109-101946131 ATTTCAACAGAGGAATTTGGGGG - Intergenic
935553188 2:104479829-104479851 ATTTCAACAGAGGAATTTGGGGG - Intergenic
935598454 2:104898005-104898027 ATTTCAACATAGGAACTCTGGGG - Intergenic
935607376 2:104984570-104984592 ATTTCAACACAGGAATTTTGGGG - Intergenic
937713776 2:125009164-125009186 ATTTCAACATATGAATTGGGGGG - Intergenic
938388179 2:130882581-130882603 ATTTCAACATATGAACTTGGGGG + Intronic
939104355 2:137932137-137932159 ATTTCAACATAGGAATTTGGGGG + Intergenic
940537656 2:154967013-154967035 ATTTCAACTTATGAACTTGGGGG - Intergenic
941597550 2:167496662-167496684 ATTTCAACACAGGAATTTTGAGG - Intergenic
944154624 2:196596415-196596437 ATTTCAACACATGAATTTGGGGG - Intergenic
944253054 2:197597425-197597447 ATTTGAACCCAGGAACTGTCTGG - Intronic
946045873 2:216820589-216820611 ATTTCAACATAGAAACTGGGGGG - Intergenic
947614450 2:231546244-231546266 ACTTCAACACAGGAATTTGGGGG + Intergenic
948288083 2:236802712-236802734 ATTTCAATGCATGAATTTGGGGG + Intergenic
948364699 2:237447089-237447111 ATTTCAACACAAGAATTTGGGGG + Intergenic
1169718672 20:8648169-8648191 ATACCAAAGCAGGAAGTGGGTGG + Intronic
1169909089 20:10632712-10632734 ATTTCAAACCAGGAGCTGGAAGG + Intronic
1172582490 20:36059258-36059280 ATTTCAACATAGGAATTTGGGGG + Intergenic
1174407433 20:50311362-50311384 ATTTCAACCCTGGGACTGTGTGG + Intergenic
1176049312 20:63108288-63108310 ATTTCAACATAGGAATTTGGGGG - Intergenic
1176457061 21:6923068-6923090 ATTTCAACGTAGGAATTTTGGGG + Intergenic
1176835234 21:13788150-13788172 ATTTCAACGTAGGAATTTTGGGG + Intergenic
1178686475 21:34715226-34715248 ATCTCAACACAGGAATTGGGAGG - Intronic
1178772034 21:35514488-35514510 ATTTCAACACATGAATTGGGTGG - Intronic
1179067459 21:38039366-38039388 ATTTCAACGCAGGAACTGGGGGG - Intronic
1179239337 21:39575165-39575187 ATTTCAACACATGAACTTTGGGG + Intronic
1181384425 22:22533486-22533508 ATTTCAACATAGGAATTGAGGGG - Intergenic
949420950 3:3865039-3865061 GTTTCCAAGCAGGAGCTGGGAGG - Intronic
950704405 3:14771024-14771046 ATTTCAACACATGAACTTTGGGG - Intronic
951548343 3:23851844-23851866 ATTTCAACACAGGATTTGGAGGG - Intronic
952555675 3:34527450-34527472 ATTACAATGTAAGAACTGGGTGG + Intergenic
954643359 3:52115542-52115564 ATTTCAACACAGGAATTTTGGGG - Intronic
955612382 3:60771406-60771428 ATTTCAAAACAGGAACGGAGTGG + Intronic
956631740 3:71323376-71323398 ATCCCAACACAGAAACTGGGAGG + Intronic
957246158 3:77719510-77719532 ATTTCAACGTAAGATTTGGGTGG - Intergenic
958646699 3:96883747-96883769 ACTTCAACCCAGGAGGTGGGAGG - Intronic
959223243 3:103549197-103549219 ATTTCAACATAGGAATTTGGAGG - Intergenic
960268314 3:115647018-115647040 ATTTCAACAGAGGAAATGTGAGG - Intronic
962140705 3:132787797-132787819 ATTTCAACATATGAACTTGGGGG - Intergenic
962203842 3:133419275-133419297 ATTTCAGCACAGGAATTTGGGGG + Intronic
962607649 3:137045715-137045737 ATTTCAACACAGGAATTTCGGGG + Intergenic
964623610 3:158738713-158738735 GCTTCAACACATGAACTGGGGGG + Intronic
964809919 3:160652449-160652471 ATTTCAACATATGAATTGGGTGG - Intergenic
965806405 3:172546750-172546772 ACTTCAATGTAGGAACTGAGGGG + Intergenic
967129012 3:186453478-186453500 ATTTCAACACATGAATTGGGGGG - Intergenic
969093352 4:4713371-4713393 ATTTCAACACATGAACTTTGGGG + Intergenic
970954163 4:21791367-21791389 ATTTCAACACAGGAATTGCGGGG + Intronic
971324660 4:25634089-25634111 ATTTCAACACATGAATTTGGGGG + Intergenic
973082897 4:46016472-46016494 ATTTTAAGGCAGAAACTTGGTGG + Intergenic
974488971 4:62539412-62539434 ATTTCAACAGAGGAGCTTGGAGG + Intergenic
974992591 4:69112910-69112932 ATTTCTAACCATGAACTGGGTGG - Exonic
976376366 4:84350030-84350052 ATTTCAACATATAAACTGGGGGG + Intergenic
976428089 4:84929476-84929498 ATTTCAACGTATGAATTTGGGGG - Intronic
977253355 4:94713092-94713114 AATTCAAGACATGAACTGGGGGG - Intergenic
979018570 4:115466389-115466411 ATTTCAACACATGAATTTGGGGG - Intergenic
979539240 4:121861627-121861649 ATTGCAAGGCTGGAACTGGGAGG - Exonic
980206693 4:129728985-129729007 ATTTCAACATACGAACCGGGGGG - Intergenic
982069354 4:151681971-151681993 ATTTCAACACAGGAATTTGGGGG + Intronic
982203719 4:152981651-152981673 ATTTCAACACAGGAATTTGAGGG - Intergenic
983714147 4:170756466-170756488 AATTCAACGCATGAACTGCAAGG - Intergenic
985491870 5:184807-184829 ACTTGAGCCCAGGAACTGGGGGG + Exonic
985729423 5:1539061-1539083 ATTTCAGCGTAGGAATTGGTGGG + Intergenic
986064207 5:4219939-4219961 ATTTCAATGTAGGAATTTGGGGG + Intergenic
989366294 5:40659416-40659438 AGATCAATGCAGGAACTTGGTGG + Intergenic
991335860 5:65546560-65546582 ATTTCAACATAGGAATTTGGGGG - Intronic
992761985 5:79958706-79958728 ATTTCAACATAGGAATTTGGGGG - Intergenic
993504040 5:88690497-88690519 ATTTTAACGCGGGAGCTAGGGGG - Intergenic
994378678 5:99044079-99044101 ATTTCAACACAGGAACTTTAGGG - Intergenic
999040841 5:148410098-148410120 TTTTCAATGGAGGAAGTGGGAGG + Intronic
999807908 5:155101038-155101060 ACTTCAACATAGGAATTGGGGGG - Intergenic
1001721663 5:173861864-173861886 ATTTCAAAGCAGTAAATTGGTGG - Intergenic
1002438956 5:179254047-179254069 ATCTCACTGCAGGAACTAGGAGG + Intronic
1003317979 6:5028714-5028736 ATTTCAACATAGGAATTTGGGGG - Intergenic
1003735977 6:8877981-8878003 ATTTCAACACAGGAATTTAGGGG + Intergenic
1004224861 6:13776130-13776152 GTTTCAACACAGGAATTTGGGGG - Intergenic
1009744556 6:67796612-67796634 ATTTCAAAATAGGAACTTGGGGG - Intergenic
1012400906 6:98842619-98842641 ATTTCCAGGCAGGAACTCAGGGG - Intergenic
1015903536 6:138092352-138092374 ATTTCAAGGCAGAAACTTGGTGG - Intronic
1016652561 6:146479528-146479550 ATTTCATGGGAGGAACTTGGTGG + Intergenic
1018256177 6:161921780-161921802 ATTTCAACACAGTGACTGGCTGG - Intronic
1018510264 6:164517230-164517252 AATTCAACATGGGAACTGGGTGG + Intergenic
1018697788 6:166404134-166404156 ATTTCAACGTACAAACTTGGTGG + Intergenic
1018761810 6:166899863-166899885 ATTTCAACACAGGAATTGGGGGG - Intronic
1018979086 6:168588542-168588564 ATTTCAACACAGGAATTTTGAGG + Intronic
1019199779 6:170305149-170305171 ATTTCAACCTATGAACTTGGGGG + Intronic
1019821048 7:3243003-3243025 ATTTTAAAGAAGGAACTGGTCGG - Intergenic
1021225474 7:18021293-18021315 ATTTCAACACAGGAATTTTGGGG - Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1025914831 7:65857256-65857278 ACTTGAACTCAGGAAATGGGAGG + Intergenic
1026916417 7:74122519-74122541 ATCGCCACGCAGGACCTGGGTGG - Exonic
1027301089 7:76836573-76836595 ATTTCAACACATGAACTTGGAGG + Intergenic
1027925614 7:84459057-84459079 ATTAAAAAGCAGGAGCTGGGAGG - Intronic
1028722539 7:94050139-94050161 ATTTGAAAGGAGGAACAGGGAGG + Intergenic
1029031741 7:97475446-97475468 ATTTCAACATAGAAATTGGGGGG - Intergenic
1029788819 7:102820881-102820903 TTTTCAACACATGAACTTGGGGG + Intronic
1032751348 7:134844971-134844993 ATTTCAACGTATGAATTTGGGGG + Intronic
1034010307 7:147522230-147522252 ATTTCAACATATGAACTTGGAGG + Intronic
1036721296 8:11177852-11177874 ATTTAATCGCAGGAACTGGGTGG - Intronic
1038491866 8:27977250-27977272 ATTTCAACATAGGAATTTGGAGG + Intronic
1039014481 8:33130618-33130640 GTTTCAACGTATGAACTGGCAGG + Intergenic
1040825178 8:51612528-51612550 ATTTCAACACAGGTATTTGGGGG - Intronic
1041040945 8:53845168-53845190 ATTTCAACACAGGAATTTTGGGG + Intergenic
1042789115 8:72583663-72583685 TTTTCAATGCAGGAGCTGAGGGG - Intronic
1045834936 8:106508722-106508744 ATTTTAATTCAGGAATTGGGTGG - Intronic
1047202183 8:122776358-122776380 ATTTCAACATATGAATTGGGGGG + Intergenic
1047441069 8:124879184-124879206 ATTTCAACGCGTGAATTTGGGGG + Intergenic
1048586992 8:135783450-135783472 ATTTCAACGTAGGAATTTTGGGG + Intergenic
1050778562 9:9300499-9300521 ATTTCAACACATGAATTTGGGGG - Intronic
1056219312 9:84435635-84435657 ATTTCAACATAGGAATTTGGGGG + Intergenic
1056481878 9:87013883-87013905 AGTTCAACGCAGGACCCTGGAGG - Intergenic
1056827847 9:89889208-89889230 ATTTCAACACAGGAATTTGTGGG - Intergenic
1057114192 9:92504847-92504869 TTTTTAACGCAGGAAATGAGGGG + Intronic
1057353014 9:94316212-94316234 GCTTCACCACAGGAACTGGGCGG + Intergenic
1057654732 9:96941379-96941401 GCTTCACCACAGGAACTGGGCGG - Intronic
1057762749 9:97889845-97889867 ATTTCAACACATGAACTAGGGGG + Intergenic
1058027537 9:100158743-100158765 ATTTCAACGCGGGATTTGGAGGG - Intronic
1058032255 9:100213184-100213206 ATTTCAACACATGAATTGGGGGG + Intronic
1059489448 9:114655101-114655123 ATTTCAACACATGAATTTGGGGG - Intergenic
1060632288 9:125170217-125170239 ATTTCAAAGCAGTAACAGGAGGG - Intronic
1185728902 X:2445508-2445530 ATTTCAACGCAGGAATTTGGGGG - Intronic
1185729588 X:2450812-2450834 ATTTCAATGCAGGAATTTGGGGG - Intronic
1185731127 X:2462883-2462905 ATTTCAATGCAGGAATTTGGGGG - Intronic
1186103122 X:6177798-6177820 ATTTCAACATAGGAATTTGGAGG - Intronic
1186172877 X:6896035-6896057 ATTTCAATATAGGAACTTGGGGG + Intergenic
1186449548 X:9660861-9660883 ATTTCAACATAGGAATTCGGGGG - Intronic
1187280638 X:17856276-17856298 ATTTCAACACAGGAGTTTGGAGG - Intronic
1187424004 X:19160979-19161001 ATTTCATGGCGGGAACTGGCTGG - Intergenic
1187627493 X:21132092-21132114 TTTTTAACAAAGGAACTGGGAGG - Intergenic
1187795109 X:22994890-22994912 ATTTCAACATAGGAACTTCGGGG + Intergenic
1187946290 X:24429162-24429184 ATTTCAACACAAGATTTGGGTGG - Intergenic
1187956416 X:24523314-24523336 ATTTCAACATAGGAATTTGGGGG + Intronic
1188467129 X:30494264-30494286 ATTTCAACATAGGAATTTGGAGG + Intergenic
1190371807 X:49749649-49749671 ATTTCAACATAGGAACTTGAGGG + Intergenic
1192395641 X:70778381-70778403 ATTTCAACATAGGAATTGTGGGG - Intronic
1192626095 X:72730408-72730430 ATTTCAACCCAAGAATTGGAGGG - Intergenic
1194127239 X:90034864-90034886 ATTTCAGTGCATGAACGGGGGGG + Intergenic
1194758631 X:97767347-97767369 TTTTCAACACAGGAACTGATAGG - Intergenic
1195456124 X:105072063-105072085 ATGTCAAGGGAGGGACTGGGTGG + Intronic
1195977631 X:110544639-110544661 TTTTCAACACAAGAATTGGGAGG - Intergenic
1196213100 X:113017829-113017851 ATTTCAACGTATGAACTTGAGGG - Intergenic
1196873904 X:120139459-120139481 ATTTCAACGTATGAATTTGGCGG - Intergenic
1198481507 X:137045642-137045664 ATTTCAACACATGAACTTCGGGG + Intergenic
1199451119 X:147980109-147980131 ATTACCACCCATGAACTGGGTGG - Intergenic
1199754852 X:150854485-150854507 ATTTCAATGTATGAATTGGGAGG - Intronic
1201277565 Y:12313161-12313183 ATTACAAAGGAGGAAATGGGAGG + Intergenic