ID: 1179068254

View in Genome Browser
Species Human (GRCh38)
Location 21:38046793-38046815
Sequence AGGTTCTATAAGAAGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179068254 Original CRISPR AGGTTCTATAAGAAGTGTGA TGG Intronic
904106340 1:28088190-28088212 AGGTTCTAAAAGAAGGGAGGAGG + Intronic
907432010 1:54417984-54418006 AGGTCCCTGAAGAAGTGTGATGG - Intergenic
909713636 1:78680472-78680494 GGATTCTCTAAGAAGAGTGAAGG - Intergenic
917220765 1:172726791-172726813 AAGTTCTGTTCGAAGTGTGAAGG - Intergenic
917382634 1:174430387-174430409 GGGTGCTATAAGAAGTGGTAAGG - Intronic
917589094 1:176458839-176458861 AGGTTCTATTCTAAGTGTGAGGG - Intergenic
918396495 1:184118481-184118503 AGGTTCTAGAACAAGACTGAGGG + Intergenic
918906565 1:190503962-190503984 AGGTTTTATAAAAATTGTGGGGG + Intergenic
919368141 1:196691967-196691989 AGGTACTATAAAAATTGTTAGGG - Intronic
919380926 1:196860134-196860156 AGGTACTATAAAAATTGTTAGGG - Intronic
923314282 1:232764820-232764842 AGGTGCTATAAAAAGGGTGGAGG - Intergenic
1066490268 10:35887652-35887674 AGAATCTATATGAATTGTGAGGG - Intergenic
1069128844 10:64673394-64673416 ACTTTCTATAAGAAATATGAAGG + Intergenic
1071487617 10:86113216-86113238 GGGTTCTATTTTAAGTGTGATGG - Intronic
1071773569 10:88758646-88758668 AGCTTATATAGGAAGAGTGATGG + Intergenic
1075056799 10:119224807-119224829 AGGTTCTATGAGAAGTTCAAAGG + Intronic
1077493989 11:2876760-2876782 GGGTTCTGTAAGAAGGGTGTTGG + Intergenic
1081115690 11:39196567-39196589 ATGTTCTTAAAGAACTGTGATGG - Intergenic
1086004265 11:82017699-82017721 AGTTACTATAAGAGGTGTAAAGG + Intergenic
1086629204 11:88995767-88995789 AGGTTGTATCAGACATGTGAAGG + Intronic
1088687152 11:112294420-112294442 AGGTTCTTACAAAAGTGTGATGG - Intergenic
1092756401 12:11767324-11767346 TGGTTTAATAAGAAGTATGAAGG - Intronic
1094271341 12:28620021-28620043 ACTTTCTATCATAAGTGTGATGG + Intergenic
1094646127 12:32326242-32326264 TTGTTCTATAAGAAGTATCATGG - Intronic
1097143227 12:56921098-56921120 AAGTTATATAAGAAAGGTGATGG + Intergenic
1098364694 12:69690077-69690099 AGGTTCTATAATAATTCAGAGGG + Intronic
1098570928 12:71986422-71986444 AGGCTCTATAAGAAATCTCAGGG - Intronic
1101458354 12:104861210-104861232 AGGTACTATTAGAAGTCTTAGGG - Intronic
1101526772 12:105538261-105538283 AGGTTCTGGATGAAGTGTCAGGG + Intergenic
1102613045 12:114129300-114129322 AGGTTGTATATGAATCGTGAAGG - Intergenic
1105549386 13:21378868-21378890 AGGTTCTATAAGAAGACAAATGG - Intronic
1107716370 13:43203528-43203550 AGATTCTATAAGAAATGAAAGGG - Intergenic
1108981188 13:56517204-56517226 AGGTGGTATAAGAAGTCAGACGG - Intergenic
1109874261 13:68378788-68378810 ACCTTATAAAAGAAGTGTGAGGG - Intergenic
1110902959 13:80846557-80846579 AGGTGCTATAAATTGTGTGAAGG + Intergenic
1111314367 13:86533650-86533672 TGGTACTCTAAGAAGTGAGATGG - Intergenic
1113409133 13:110068752-110068774 AGGTTATATAAGAAGGGACAAGG - Intergenic
1115137923 14:30133242-30133264 AGGTCATACAAGAAGTGTGATGG - Intronic
1120090912 14:80332639-80332661 AGGATCTAAAAGCAGTCTGAAGG - Intronic
1120402994 14:84055735-84055757 ACCTTTTAAAAGAAGTGTGAGGG - Intergenic
1121582717 14:95043149-95043171 GAGTTATATAAGATGTGTGAAGG + Intergenic
1128300080 15:66561127-66561149 AGGATCCATAAGAAGTGGCAGGG + Intronic
1128395569 15:67221992-67222014 AGGTACTATAGGAACTGAGAGGG - Intronic
1131044818 15:89305630-89305652 AGGTTCTAGAAGAAGTGGACTGG + Exonic
1131060906 15:89404127-89404149 TGGGCCTCTAAGAAGTGTGAGGG - Intergenic
1151035569 17:70794847-70794869 AGGTTTTGGCAGAAGTGTGAAGG + Intergenic
1152963526 18:95606-95628 AAGTTAAATAAGAAGAGTGATGG + Intergenic
1158172584 18:54616198-54616220 AGGTTCTATTATAAGTGAAATGG + Intergenic
1164354521 19:27405008-27405030 AGTTTCTACAAAAAGTGTGTTGG + Intergenic
1164426426 19:28145970-28145992 AGGATCTAGGAGATGTGTGAAGG - Intergenic
1164555753 19:29249540-29249562 AGGCTGTATAAGAAGTGTGACGG - Intergenic
926002446 2:9344613-9344635 AGCCTCTACAAGAAGAGTGACGG + Exonic
929397625 2:41541510-41541532 AGGTCCAATAAGAAGGTTGAGGG - Intergenic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
930907701 2:56592593-56592615 AGGATGTATAAATAGTGTGAGGG - Intergenic
931494330 2:62785709-62785731 AGGTTGTATAAGAAAGGTGAAGG - Intronic
932887710 2:75561838-75561860 AGCTCCTAGAAGCAGTGTGATGG + Intronic
936058559 2:109279812-109279834 AGGATCTATCAGGAGTGTGGGGG + Intronic
936287916 2:111195395-111195417 ACTTTCTAAAAGATGTGTGAGGG + Intergenic
936388617 2:112053541-112053563 AAGTTCTACAAGAAGAGTTAAGG - Intergenic
936982177 2:118275139-118275161 GGGTTCCATAAGAAGCCTGAAGG + Intergenic
939936139 2:148296230-148296252 ATATTCTATAAGAAGAGAGAAGG - Intronic
941607464 2:167617500-167617522 GGGTTCTATTAGAAGTGAAAAGG + Intergenic
944462495 2:199965428-199965450 ATGTTTTATAAGAAATGTTAAGG + Intronic
945839483 2:214870324-214870346 AGATTCTATAAGGAGTTTGTTGG - Intergenic
947987408 2:234460792-234460814 AGGAACTCTAAGATGTGTGAGGG - Intergenic
1168937458 20:1678454-1678476 AGGTTCTCTAACAAGTGAGCAGG + Intergenic
1170416960 20:16154607-16154629 AGTTTTTATAAGAAGTATAATGG - Intergenic
1171233058 20:23502697-23502719 AGTTTATATATGAAGTGTGGAGG - Intergenic
1174471126 20:50761700-50761722 ATGTTCTATAAGAACAGTGCTGG - Intergenic
1176876966 21:14140011-14140033 GGCTTTTATATGAAGTGTGAAGG + Intronic
1177739336 21:25135562-25135584 AGGTTGTAAAAGAAAGGTGAGGG + Intergenic
1178873710 21:36396308-36396330 AGGTTTTATCATAAGTGTGATGG + Intronic
1179068254 21:38046793-38046815 AGGTTCTATAAGAAGTGTGATGG + Intronic
1179772611 21:43634064-43634086 AGGGGCAAAAAGAAGTGTGAAGG + Intronic
1183603257 22:38852309-38852331 TGGTTTTATAAGAAGTAGGAGGG + Intergenic
949778644 3:7660617-7660639 AGTTTCTATAAGAAGCCTGTTGG - Intronic
950063963 3:10096256-10096278 GGTTTCTATAAGAAATGTGAAGG + Intronic
950369316 3:12514996-12515018 AGTGACTATAAGACGTGTGATGG - Intronic
950727362 3:14925227-14925249 AGGTTCCATAAGAAACTTGATGG - Intronic
952293593 3:32041552-32041574 AGATTCAATAAGAAGTGATACGG - Intronic
955773472 3:62409337-62409359 AAGTTCTCAAAGAAGTGTGTGGG + Intronic
956255912 3:67283077-67283099 AGGCTGTACAGGAAGTGTGATGG - Intergenic
962057534 3:131887784-131887806 AGGTTCTATAATTAGTTTAAAGG - Intronic
966668781 3:182503957-182503979 GGGATCTGTTAGAAGTGTGACGG - Intergenic
967274470 3:187760489-187760511 AGGTGCTATAAGATGAGGGAAGG + Intergenic
970507048 4:16742368-16742390 ATGTTGTATAAGAAATGTGTTGG - Intronic
971870895 4:32237159-32237181 AGGATCTCTGAGAATTGTGAGGG + Intergenic
972939084 4:44175286-44175308 CAGTTGAATAAGAAGTGTGAAGG + Intronic
973126610 4:46593483-46593505 AGGTTCTTTGAGAAGGATGAAGG - Intergenic
974003342 4:56531964-56531986 AGGTTTTGTCAGAAGTATGATGG - Intronic
975663588 4:76711219-76711241 AGCTTCTATAACAAGTCTGAGGG - Intronic
976463945 4:85346194-85346216 AGAGTCTATAGGAAGTCTGATGG - Intergenic
977022664 4:91776011-91776033 AGGTTCTCTGATAAGTGGGAGGG + Intergenic
977492625 4:97733828-97733850 AGGATCTGTTTGAAGTGTGACGG + Intronic
977912174 4:102549851-102549873 AGTTTCTGAAAAAAGTGTGAAGG - Intronic
984046032 4:174799330-174799352 AGGTTCTTTAAAAAGTGCCATGG + Intronic
984658777 4:182350582-182350604 AGGTTATAAAATCAGTGTGATGG + Intronic
986156514 5:5182092-5182114 AGTTTCCATGAGAGGTGTGAAGG - Exonic
988459652 5:31422547-31422569 AAGTTTTAGGAGAAGTGTGAAGG - Intronic
995554126 5:113310134-113310156 AGTTTCAATATGAATTGTGAAGG - Intronic
996482420 5:123989799-123989821 AAATTATTTAAGAAGTGTGACGG - Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998711581 5:144831964-144831986 AATTTCTATCACAAGTGTGATGG + Intergenic
999015269 5:148096578-148096600 GGTTTCTATAAGAAGTGAAATGG - Intronic
1000532013 5:162434695-162434717 AGGTTCACTAAGAAAGGTGATGG + Intergenic
1001738472 5:174028096-174028118 AGTTTCTATCAGCAGTGTGAAGG - Intergenic
1003816759 6:9850744-9850766 AAGATCTATTGGAAGTGTGAAGG - Intronic
1005154260 6:22785606-22785628 AGGTACAATGGGAAGTGTGAAGG + Intergenic
1008843323 6:55931180-55931202 ATGTAAAATAAGAAGTGTGAAGG - Intergenic
1009404584 6:63296358-63296380 AGATTCTATCAGAAGTGTGTTGG - Intronic
1011617239 6:89208390-89208412 ATGTTCTCTAAAATGTGTGATGG + Intronic
1012682806 6:102204128-102204150 AAGTTCCATAACAAGGGTGATGG + Intergenic
1013483757 6:110575623-110575645 AGGTTCTATAAGAAGGCTTTAGG + Intergenic
1016598346 6:145827098-145827120 GGGATCTATAAGCAGAGTGAAGG + Intergenic
1017572252 6:155758722-155758744 AGGTTAGAGAAGAAATGTGATGG + Intergenic
1020373156 7:7456843-7456865 ATGTTGAATAATAAGTGTGAAGG + Intronic
1021221334 7:17978242-17978264 AGTTTCTATCAAAAGTGAGAGGG - Intergenic
1028684068 7:93573877-93573899 AGCATCTATAAGATGTGTCATGG - Intronic
1029908471 7:104118516-104118538 ATCTTGTAAAAGAAGTGTGAGGG - Intergenic
1030710384 7:112742157-112742179 TGGTTCTATAAGAGTTGTGATGG + Intergenic
1030841835 7:114363302-114363324 AGCTTCCATAAGAATTGTTATGG - Intronic
1032850994 7:135795263-135795285 TGGCTCTATAAGAAGAGGGAGGG - Intergenic
1037407636 8:18560814-18560836 AGTTTCGATATGAAGTTTGAAGG - Intronic
1040095201 8:43435935-43435957 TGGTGCTACAAGAAGTGGGAAGG - Intergenic
1041674545 8:60524974-60524996 AGGAACTATAAAAAGTGTGGAGG - Intronic
1043648029 8:82547798-82547820 AGGTTCTATAAGAACTCAGAAGG - Intergenic
1047158163 8:122345334-122345356 AGGTTCTATGAGATGTGGAAAGG + Intergenic
1047303091 8:123631652-123631674 AGGTTTTATATTAAGGGTGAAGG + Intergenic
1050644046 9:7700395-7700417 CTGTTCTACAATAAGTGTGAAGG - Intergenic
1050747450 9:8893039-8893061 AAGTTTTCTAAGAAGTTTGATGG + Intronic
1053323294 9:37119520-37119542 AGCTGCTACAAGAAGTGTAATGG + Intergenic
1053800834 9:41763691-41763713 AAGTTCAAGAAGAAGTGTTATGG + Intergenic
1054144361 9:61551149-61551171 AAGTTCAAGAAGAAGTGTTATGG - Intergenic
1054189265 9:61975841-61975863 AAGTTCAAGAAGAAGTGTTATGG + Intergenic
1054649252 9:67612771-67612793 AAGTTCAAGAAGAAGTGTTATGG - Intergenic
1056083321 9:83119934-83119956 AGGGTCCATAAGAACTGTGTAGG - Intergenic
1059619890 9:115992259-115992281 AAGTTCAATAAAAAGTGAGAAGG - Intergenic
1059802313 9:117762923-117762945 ATATTCTAAAAGAAGGGTGATGG + Intergenic
1061472700 9:130839726-130839748 AGGGTCTATAAGATGATTGAGGG + Intronic
1062734568 9:138128120-138128142 AAGTTAAATAAGAAGAGTGATGG - Intergenic
1186149504 X:6659240-6659262 TGGTTCTATGCTAAGTGTGAGGG - Intergenic
1186457600 X:9722255-9722277 AAGTTCTTGAAGAAGTGAGAAGG - Intergenic
1189070795 X:37861845-37861867 AGGTTCTAGAAAAAGTGAGATGG + Intronic
1189280783 X:39819019-39819041 AGTTTCTGGAAGAAGTGTCATGG - Intergenic
1194689973 X:96972517-96972539 AGGTTCTATACTAAATGGGAGGG + Intronic
1194833226 X:98651024-98651046 AGATTCTTTCAGAACTGTGAGGG - Intergenic
1196505703 X:116438735-116438757 AGGTTCTATTAGAAGTATAGAGG + Intronic
1198514131 X:137387348-137387370 AGGTTCTGTACTAAGTGTTAAGG + Intergenic