ID: 1179068548

View in Genome Browser
Species Human (GRCh38)
Location 21:38050094-38050116
Sequence CTGGGATAGTTTCCTAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179068548_1179068552 0 Left 1179068548 21:38050094-38050116 CCAGTATTAGGAAACTATCCCAG 0: 1
1: 0
2: 0
3: 13
4: 87
Right 1179068552 21:38050117-38050139 AGACAAAAGCTCACTACGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 82
1179068548_1179068551 -1 Left 1179068548 21:38050094-38050116 CCAGTATTAGGAAACTATCCCAG 0: 1
1: 0
2: 0
3: 13
4: 87
Right 1179068551 21:38050116-38050138 GAGACAAAAGCTCACTACGTAGG 0: 1
1: 0
2: 3
3: 15
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179068548 Original CRISPR CTGGGATAGTTTCCTAATAC TGG (reversed) Intronic
901250963 1:7779493-7779515 CTGGGCTGATTTCCTACTACTGG - Intronic
901301588 1:8203482-8203504 CTGGGACAGATTCCTGAAACTGG - Intergenic
906193409 1:43913764-43913786 CTGGGATCGTGACCTAAAACAGG + Intronic
907732482 1:57080797-57080819 CAGTGTTAGTTTCCTAACACTGG + Intronic
911426878 1:97727465-97727487 CTTAGTTAGTTTCTTAATACTGG - Intronic
913001750 1:114587429-114587451 CAGGAATTGTTTCCAAATACTGG + Exonic
913136780 1:115898384-115898406 ATGGGATAGTGTCCTAATCCGGG + Intergenic
920821868 1:209389110-209389132 CTGGTAAAGTTTCCAAATTCTGG + Intergenic
920855099 1:209655543-209655565 CTGGGATGGATTACTAATAGTGG + Intergenic
921320779 1:213936363-213936385 CAGGTATACTTTCCTAATTCTGG + Intergenic
922682541 1:227612595-227612617 CTGGGATAGCTTTCTACTCCTGG + Intronic
1063624674 10:7677880-7677902 CTGGGATAAATGCCTAGTACTGG - Intergenic
1064015880 10:11772096-11772118 CTGGGATAGTATTTTAATAAAGG + Intergenic
1065463848 10:25998526-25998548 CTGGGTTAGTGTACTAATAAGGG + Intronic
1069626322 10:69869780-69869802 AAGGGAGAATTTCCTAATACTGG + Intronic
1071184242 10:83022689-83022711 TTGTGATAGTTTGCTGATACTGG + Intergenic
1073445394 10:103577270-103577292 CTGGGAAAGCTTCCTAATGGAGG - Intronic
1075053144 10:119198201-119198223 CTGGGATACTGTCCTAGTTCCGG + Intergenic
1075810229 10:125219774-125219796 CTGGAAGAGTTTCCTAATGGCGG - Intergenic
1087145842 11:94811022-94811044 CTGGGATTGGTTCCTAAATCAGG - Intronic
1087426417 11:97992857-97992879 ATGGGATAATTTCCAAATACTGG + Intergenic
1089960035 11:122608462-122608484 CTGGAATAGTTTACTGATATTGG - Intergenic
1093935831 12:24999734-24999756 CTGGGATAATTTCCTATTATAGG + Intergenic
1094562460 12:31568377-31568399 CTGGGAAACATTCCCAATACAGG - Intronic
1097064452 12:56310648-56310670 CTGGGAAATTTTCTTGATACTGG - Intronic
1098671752 12:73239130-73239152 CTGGGATAGATACCCAATAGTGG - Intergenic
1098844993 12:75523855-75523877 CTGTGTTAGTTTGCTAATGCAGG + Intergenic
1099033871 12:77560921-77560943 CTGGGATGGGCTCCTACTACTGG - Intergenic
1103041206 12:117696882-117696904 CTGGGAGGGTTTCCTGAGACTGG + Intronic
1108327253 13:49346014-49346036 CTATTATGGTTTCCTAATACTGG - Intronic
1109255355 13:60073580-60073602 CTGGGATATTTACCTCATAAAGG - Intronic
1111350850 13:87029161-87029183 CTGGGATAGTAGCTTCATACAGG - Intergenic
1116616269 14:47144019-47144041 CTAGGATACTTTCCTAATTCAGG - Intronic
1117307683 14:54492447-54492469 CAGGAATAGTTTCCAAATTCTGG + Intergenic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1119914406 14:78383879-78383901 CTGGGATAGATTCCTCATCAGGG - Intronic
1131484370 15:92808238-92808260 CCGGGATAGACTCCTAACACTGG + Intronic
1132296788 15:100742107-100742129 ATTGATTAGTTTCCTAATACTGG + Intergenic
1140411618 16:74744420-74744442 CTGGAATAATTTCCAAATACTGG - Intronic
1143234824 17:5390476-5390498 CTGACATAAATTCCTAATACTGG - Intronic
1145163669 17:20593264-20593286 CTGGGATAGCTTTCTATTATAGG + Intergenic
1149637470 17:58182541-58182563 CTGGGAAAGTCTTCTAACACGGG + Intergenic
1153496252 18:5703046-5703068 CTGGGATAGCCTCCTGATCCTGG - Intergenic
1156053463 18:32968915-32968937 TAGGGATAGTTTCCTATTTCTGG - Intronic
1159305994 18:66642977-66642999 CTGGAATAGTTTTCTAAAAGTGG + Intergenic
1161981358 19:7632101-7632123 CTGGGATACTTTCCTAGGAAGGG + Intronic
928995440 2:37285397-37285419 CTGGGTTAGTATCCAAATACGGG + Intronic
931205264 2:60140298-60140320 CAGGAATAGTTTCCTGACACAGG - Intergenic
939234509 2:139474040-139474062 CTGGGCTATTTTCCAAATATGGG - Intergenic
942279938 2:174350962-174350984 CTGGAAAAGTTTCCTAATGCTGG - Intronic
943257756 2:185618176-185618198 CTGGGACACTTTCCTTAGACTGG + Intergenic
1173189537 20:40865429-40865451 CTGGGAAAGTTTCCTAGAACAGG - Intergenic
1177885301 21:26739439-26739461 CTTGGATAGTTTCCTAAGAGAGG - Intergenic
1179068548 21:38050094-38050116 CTGGGATAGTTTCCTAATACTGG - Intronic
1179813727 21:43889508-43889530 CTGGATTAGTTAACTAATACAGG + Intronic
1179954860 21:44732960-44732982 CTGGGTTACTCTCCTAATAAAGG + Intergenic
1181900262 22:26148169-26148191 ATGGAATATTTTACTAATACAGG + Intergenic
953025583 3:39143084-39143106 CTGGGACAGTGTCCTCAAACTGG + Exonic
955276016 3:57547568-57547590 CATGAATAGTTTCCTAATTCTGG + Intergenic
955917818 3:63924425-63924447 CTAGGTTTGTTTCCTAATATAGG + Intronic
958013657 3:87913806-87913828 CTGTGTTAGTTTCCTAATAATGG - Intergenic
966814925 3:183882534-183882556 CTTGGATAGTTTCATATAACTGG + Intronic
975989680 4:80244948-80244970 GTGGCATAGATTCCTAAAACTGG - Intergenic
978748012 4:112216598-112216620 CTAGGATAGCTTCTTAATATAGG - Intergenic
984499621 4:180542869-180542891 CAGGCATAGTTACCTAATCCTGG + Intergenic
985874298 5:2583654-2583676 CTGGGTGAGTTTCCTTATGCAGG + Intergenic
990451666 5:55937708-55937730 CTGGGATAGCTTTCTATTACAGG - Exonic
996248191 5:121292085-121292107 CTGGGTTAGTTTCATGTTACAGG + Intergenic
996873172 5:128214652-128214674 CTGGGTAAGTTTCCTTGTACTGG - Intergenic
997567427 5:134899931-134899953 CTGGATTACTTTCCAAATACTGG - Exonic
1008453649 6:51682900-51682922 CCTGGATACTTACCTAATACAGG + Intronic
1009834589 6:68982879-68982901 CTGCGAAAGTTTCTTAATTCTGG - Intronic
1010030951 6:71270141-71270163 TTGGGATAGTTTCCAAATTTTGG - Intergenic
1013026704 6:106281589-106281611 CTGGGATTGTTTCTAGATACTGG + Intronic
1013601871 6:111712577-111712599 CTGGGGCAGTTTCCTAATCTGGG + Intronic
1018048519 6:159986879-159986901 TTGGAATAGTTTCCTAATTCTGG + Intronic
1023468039 7:40480098-40480120 GGGGGAAAGTTTCCTAATATTGG - Intronic
1026237109 7:68536458-68536480 CATGGATAGTTTCCTAACAGAGG - Intergenic
1027413174 7:77944197-77944219 CTGGGATACAATACTAATACTGG - Intronic
1032404452 7:131645606-131645628 TTGGGAGAGTTTCTTAATCCTGG + Intergenic
1034719684 7:153279460-153279482 CTAGGATATTTTTCTACTACTGG - Intergenic
1036114159 8:5940527-5940549 CCGGGATACTTTCCTAAGGCTGG + Intergenic
1036623090 8:10440431-10440453 ATGTGTTAGTTTCCTAATATTGG + Intergenic
1037165559 8:15824320-15824342 CAGGGATGTTTTCCTAAAACAGG + Intergenic
1037190320 8:16117029-16117051 CTGGGCTAGTTTCTTAAAGCAGG + Intronic
1038275084 8:26114729-26114751 CTGGGGTGGTCTCCTATTACTGG - Intergenic
1039008071 8:33063176-33063198 ATGGGATAGTTTCCAAATGTTGG + Intergenic
1045525194 8:102935497-102935519 CTTGGAGAGTTGACTAATACAGG - Intronic
1047572871 8:126119726-126119748 CTATGAAAGTTTCGTAATACAGG + Intergenic
1048319966 8:133391124-133391146 CTGGGATAGCTCCCTAAAAGAGG + Intergenic
1051945226 9:22561022-22561044 CTGGCCAAGTCTCCTAATACAGG - Intergenic
1054996802 9:71400670-71400692 CTGCCATAGTTTACTATTACTGG + Intronic
1055483875 9:76737454-76737476 CTGGTACAGTTTCTGAATACGGG - Intronic
1188149582 X:26654731-26654753 CAGGGATTGTTTCTTATTACAGG + Intergenic
1190108194 X:47573721-47573743 CTGGGAAAGTTTCCTCCTCCAGG - Intronic
1192032728 X:67531893-67531915 GAGGGATAGTTTCCTTAAACTGG - Intergenic
1193641717 X:84016804-84016826 CTCAGATAGTTTCCAAATTCTGG + Intergenic
1194036921 X:88886222-88886244 CTGGGATTGGTCCCTGATACTGG - Intergenic
1196287747 X:113901910-113901932 CATGGATAGTTTCCAAAGACTGG + Intergenic
1200708712 Y:6464953-6464975 ATGGGATAGTTCCATAATCCTGG - Intergenic
1201025400 Y:9699756-9699778 ATGGGATAGTTCCATAATCCTGG + Intergenic