ID: 1179068635

View in Genome Browser
Species Human (GRCh38)
Location 21:38051156-38051178
Sequence GTGGTCTCCCTGAGATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179068628_1179068635 12 Left 1179068628 21:38051121-38051143 CCCTGGCTGAGATTGACCATGGC 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 165
1179068630_1179068635 -4 Left 1179068630 21:38051137-38051159 CCATGGCGTCAGTCCTCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 165
1179068626_1179068635 20 Left 1179068626 21:38051113-38051135 CCGCTTTTCCCTGGCTGAGATTG 0: 1
1: 0
2: 2
3: 28
4: 303
Right 1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 165
1179068625_1179068635 24 Left 1179068625 21:38051109-38051131 CCATCCGCTTTTCCCTGGCTGAG 0: 1
1: 0
2: 1
3: 21
4: 273
Right 1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 165
1179068629_1179068635 11 Left 1179068629 21:38051122-38051144 CCTGGCTGAGATTGACCATGGCG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG 0: 1
1: 0
2: 2
3: 32
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179068635 Original CRISPR GTGGTCTCCCTGAGATTGGG AGG Intronic
900579436 1:3401251-3401273 GTGGTCTCTCTGACACAGGGAGG + Intronic
900737841 1:4310289-4310311 GTGGTCCGCCTGAGAGTGAGTGG + Intergenic
902643389 1:17780899-17780921 GTGGTCTCTCTGGGACTGGGGGG + Intronic
904985385 1:34543649-34543671 GTGGTTTCCAGGAGTTTGGGAGG + Intergenic
906364032 1:45190340-45190362 GTGGTTTACCTGGGAATGGGTGG - Intronic
910443475 1:87276883-87276905 GTGTTCTCCCTGAAATTTGGGGG + Intergenic
915703337 1:157819233-157819255 GTTGGCTACCTGAGATTTGGGGG + Intronic
920135177 1:203763714-203763736 GTGATTTCCCTGAGATGTGGGGG + Intergenic
920641346 1:207754386-207754408 GTGTTCAACCTGAGATGGGGGGG - Intronic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
922252538 1:223863210-223863232 TCGGTCTCCCTGGGAGTGGGTGG - Intergenic
922590204 1:226769839-226769861 GTGGTCTCGCTGAGCTGGGAAGG + Intergenic
923781925 1:237032367-237032389 GTCTCCTCCCTGAGATGGGGTGG + Intergenic
1064124210 10:12645450-12645472 CTGGTCTCCCAGAGATAGGGTGG + Intronic
1064147271 10:12835649-12835671 GGGGACTCCATGAGTTTGGGGGG - Intergenic
1067715942 10:48691244-48691266 GTGGTCACCCTGACTTAGGGTGG + Intronic
1069508811 10:69024826-69024848 TTGGTCTCCCTGGGAGTGGGTGG + Intergenic
1073419086 10:103409440-103409462 GAGGACTCCCAGAGAGTGGGAGG + Intronic
1075627506 10:123973219-123973241 GCTGTCTCCCTGAGATTTGCAGG + Intergenic
1077292050 11:1801933-1801955 TTGGTCTCCCTGGGAGTGGGTGG - Intergenic
1078402055 11:11037312-11037334 GGGGTCTGCCTGAGCTTGGGAGG + Intergenic
1079075645 11:17384012-17384034 GGGGTCTCCCTCAGAGTTGGTGG + Intergenic
1079985706 11:27198315-27198337 CTGGTCTCCCTGAGCTTGGAAGG + Intergenic
1081311962 11:41585361-41585383 GTGGTTTCCCAGTGATTGGATGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084267657 11:68013130-68013152 GCCTTCTGCCTGAGATTGGGGGG - Intronic
1088344194 11:108804377-108804399 GTGGTCCCACTTAGTTTGGGAGG + Intronic
1090283226 11:125476126-125476148 GTGGTTGCCCAGAGATTGGGCGG + Intronic
1090643072 11:128745865-128745887 GTGGGCTCCCTGTGATTGTAAGG + Intronic
1097233986 12:57527599-57527621 GGGGTCTCCCTGAGTTGGAGGGG - Exonic
1100405383 12:94268210-94268232 GTGTTCTCCCTGAGGTGTGGGGG + Intronic
1102337657 12:112095503-112095525 GAGGTCTGCTTGAGCTTGGGAGG + Intronic
1103763173 12:123265699-123265721 GTGGCCTCCCTGAGTGTGTGAGG - Intronic
1108504425 13:51098328-51098350 GTGGTCTCCTTGGCATTGGCTGG - Intergenic
1109819088 13:67628167-67628189 TTTGTCTGCCTGAGATTTGGAGG + Intergenic
1113627676 13:111858560-111858582 GGGGACTTCCTGAGATTGGAGGG - Intergenic
1114058809 14:19000500-19000522 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
1114103735 14:19401254-19401276 TTGGTCTCCCTGAGAGTGGCTGG - Intergenic
1115174325 14:30544944-30544966 GTGGTTGCCCGGGGATTGGGTGG - Intergenic
1116931669 14:50696896-50696918 GGGGTCTCCTTGAGAGTGGAGGG - Intergenic
1118935024 14:70279854-70279876 GAGGTCTCCTTGAGAGTGGGGGG + Intergenic
1122806010 14:104257528-104257550 GTGGACTCCCTGAGTTAAGGAGG + Intergenic
1124371166 15:29105569-29105591 GTGGCCTCCCTGAGGCTGGTGGG - Intronic
1124957990 15:34372313-34372335 TTGGTCTCCCTGGGATTGGATGG - Intergenic
1127010485 15:54620898-54620920 GTAGTCTCCCTGGTGTTGGGGGG + Intronic
1127803062 15:62494161-62494183 GTGGTTTGCCTCAGTTTGGGTGG + Intronic
1129410334 15:75347508-75347530 GTGGGGTCCCCGAGCTTGGGGGG - Intronic
1129823385 15:78619503-78619525 GTGTTCTCCCGGAGGCTGGGAGG - Intronic
1133071164 16:3247583-3247605 GTGGTCCTACTGGGATTGGGTGG + Intronic
1134286428 16:12865955-12865977 CTGGTTCCCCTGTGATTGGGTGG - Intergenic
1136922804 16:34345896-34345918 GTGGGCTCCCAGAGCTGGGGAGG - Intergenic
1136981769 16:35065910-35065932 GTGGGCTCCCAGAGCTGGGGAGG + Intergenic
1138019028 16:53460128-53460150 TTGATCTCCCTGAGACTGGTAGG + Intronic
1138826112 16:60322235-60322257 GGGGTCTACCTGAGACTGGAGGG - Intergenic
1140255936 16:73336389-73336411 GGGGCCTCCCTGAGGGTGGGGGG - Intergenic
1142333951 16:89474669-89474691 GGAGTCTCTCTGAGCTTGGGAGG - Intronic
1145862389 17:28221730-28221752 ATGGTCTCCCTGACTTAGGGTGG + Intergenic
1146722409 17:35132590-35132612 GTGGGCAGCCTGAGTTTGGGTGG - Intronic
1147250445 17:39150149-39150171 GTGGTCTCCCTGAAAATTGGTGG + Intronic
1147299583 17:39514889-39514911 GTGGTTTGCCTGGGAATGGGAGG - Intronic
1147927926 17:43956632-43956654 ATGGTCTCCCTGACTTGGGGTGG - Intronic
1147967354 17:44200223-44200245 GAGGCCTCCCTGCGATTGGTCGG - Intergenic
1152097616 17:78281054-78281076 GTAGTTTCGCTGAGTTTGGGTGG - Intergenic
1152228839 17:79104772-79104794 CAGGCCTCCCTGAGATGGGGAGG + Intronic
1152236008 17:79139243-79139265 GTGGTCTCCCTGTGTCGGGGTGG - Intronic
1153718585 18:7877719-7877741 GAGGGCTCCCTGAGCTTGGTAGG - Intronic
1154501569 18:15000221-15000243 GTCCTCTCCCTGCGATGGGGCGG + Intergenic
1158652384 18:59299549-59299571 GAAGTCTCCCTGTGAATGGGAGG - Intronic
1158694684 18:59693394-59693416 TTGGTCTCCCTGAGAGTGGGTGG + Intronic
1161373693 19:3928024-3928046 GTCGTCTCCATGAGCTTTGGGGG + Exonic
1162468302 19:10856282-10856304 GTGCTCTCCCTGAGCCTGGCTGG + Exonic
1164387438 19:27786343-27786365 GTGGTATCCCCAAGTTTGGGGGG + Intergenic
1165382233 19:35489616-35489638 GTGGTGTCACTGAGCTGGGGGGG - Intronic
1166251782 19:41576346-41576368 GAGGACTCCCTGGGAGTGGGTGG + Intronic
1168137394 19:54360611-54360633 GTGGGTTCCCAGAGATTAGGGGG - Intronic
1168160683 19:54508471-54508493 GTGGGTTCCCAGAGATTAGGGGG + Intronic
1168535996 19:57171812-57171834 TTGGTCTCCCTGAGAGAGTGGGG + Intergenic
924965349 2:71564-71586 GTGGTCAGCCTCAGATTGGGTGG - Intergenic
925876865 2:8318743-8318765 GTGCTCTGGCTGAGGTTGGGGGG - Intergenic
926249420 2:11145585-11145607 GTGGTTTCCCTTGGTTTGGGTGG + Exonic
929874007 2:45781380-45781402 TTGGACTCCCTGCGATAGGGTGG - Intronic
931385719 2:61795832-61795854 CTAGTCTCCCTGAGACTGGCTGG + Intergenic
933447483 2:82400818-82400840 GTGGTCTACATGAGAGTGGAAGG - Intergenic
935537914 2:104316073-104316095 TGGTTCTACCTGAGATTGGGTGG + Intergenic
936165546 2:110116492-110116514 GTCCTCTCCCAGAGACTGGGGGG - Exonic
936427837 2:112435125-112435147 GTGGCCTCCCTGAGCGTGGATGG - Intergenic
937210581 2:120266954-120266976 GGGGGCCCCCTGAGACTGGGAGG + Intronic
937220509 2:120340530-120340552 GTGGTCTCTCTGGGAGAGGGAGG + Intergenic
938282386 2:130073717-130073739 TTGGTCTCCCTGAGAGTGGCTGG - Exonic
938333016 2:130462289-130462311 TTGGTCTCCCTGAGAGTGGCTGG - Exonic
938356793 2:130658382-130658404 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
938433229 2:131265188-131265210 TTGGTCTCCCTGAGAGTGGCTGG + Exonic
938477276 2:131627770-131627792 TTGGTCTCTCTGAGAGTGGCTGG + Intergenic
942410850 2:175708001-175708023 GGGGCCTACCTGAGATTGGAGGG - Intergenic
942504377 2:176626285-176626307 TTGGTCTCCCTGGGAGGGGGTGG - Intergenic
943637632 2:190323892-190323914 GTGGATCACCTGAGATTGGGAGG - Intronic
1171882688 20:30630250-30630272 TTGGTCTCCCTGAGAGCGGCTGG - Intergenic
1172164984 20:32893513-32893535 GTGGCCTCTCTGAGGATGGGAGG + Intronic
1172479021 20:35260171-35260193 GAGGACTCCCTGAGCTTGTGAGG - Intronic
1173671128 20:44799618-44799640 GGAGTCACCCTGAGAGTGGGTGG - Intronic
1176169531 20:63690668-63690690 GTGTCCTCCCTGCTATTGGGGGG - Intronic
1176250503 20:64118046-64118068 GAGGTCACCCTGATGTTGGGGGG + Intergenic
1176250546 20:64118200-64118222 GAGGTCACCCTGATGTTGGGGGG + Intergenic
1176250592 20:64118351-64118373 GAGGTCACCCTGATGTTGGGGGG + Intergenic
1176374411 21:6080086-6080108 GTGGCCTCCCTGAGCGTGGATGG + Intergenic
1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG + Intronic
1179254851 21:39706754-39706776 GTGGTCTCCCAGCCCTTGGGAGG + Intergenic
1179749065 21:43458159-43458181 GTGGCCTCCCTGAGCGTGGATGG - Intergenic
1180477294 22:15723116-15723138 TTGGTCTCCCTGAGAGTGGCTGG + Intergenic
1180755050 22:18155492-18155514 GTGGGCTCCCTTAGCTTGCGGGG + Intronic
1183910224 22:41073639-41073661 TTGGTCTCCCTGGGAGTGGGTGG - Intergenic
1184009998 22:41740365-41740387 GTGGTCCCTCTGAGGTGGGGTGG + Intronic
1184606469 22:45577326-45577348 GGGGTCACCCAGAGAGTGGGTGG - Intronic
949194342 3:1287517-1287539 TTGGTCTCCCTAAGAATTGGAGG + Intronic
950478099 3:13226845-13226867 GGGGTCTCCCTGAGATCTGGAGG - Intergenic
951871735 3:27369357-27369379 GCGGTGTCCCTGAGGTTGAGGGG - Exonic
952568099 3:34682044-34682066 CTGGTCTCCATGAAAGTGGGAGG + Intergenic
952707367 3:36392832-36392854 GAGACCTCCCTGGGATTGGGAGG - Intronic
953357211 3:42265602-42265624 GTGGTCTACCCGAGCTTGCGGGG - Intronic
953517712 3:43612429-43612451 GTGGTATCCCTGAGAAAGGCAGG - Intronic
953825163 3:46245707-46245729 GGGGTCTACTTGAGAGTGGGAGG - Intronic
953877076 3:46672405-46672427 ATAGTCTCCATGAGGTTGGGAGG + Intronic
955939869 3:64137578-64137600 GTGGTCTCCCTGACATTTTCTGG - Intronic
956309840 3:67866741-67866763 GTGGATTTCCTGAGATTAGGAGG + Intergenic
957528826 3:81414176-81414198 GTGATCTCCAAGAGCTTGGGTGG - Intergenic
958055616 3:88407046-88407068 GTGGTCTACTTGAGGGTGGGAGG - Intergenic
962494891 3:135929211-135929233 TTGTTCTCCCTGAAAATGGGAGG + Intergenic
962803142 3:138907338-138907360 GAGGACTGCTTGAGATTGGGAGG - Intergenic
964063787 3:152557242-152557264 AAGGTCTCCCTGAAATAGGGAGG - Intergenic
964505189 3:157391350-157391372 CTGCTCTCCCTCAGCTTGGGTGG - Intronic
965966709 3:174500520-174500542 GTGTTCTTCCTGATTTTGGGAGG + Intronic
966078979 3:175976981-175977003 TTGGTCTCCCTGGGAGTGGGTGG - Intergenic
966516088 3:180822129-180822151 TTGGTCTCCCTGGGAGTTGGTGG + Intronic
967368027 3:188709780-188709802 CTGGTCTCCAACAGATTGGGAGG - Intronic
967953293 3:194857344-194857366 GTGGGCTCCCTCAGATGGGAGGG - Intergenic
968706548 4:2080924-2080946 GTGGTCTCCCAGGGCTTGGATGG - Intronic
969580253 4:8060594-8060616 TTGGACTCCCTGAGCTGGGGCGG + Intronic
970716231 4:18928285-18928307 GTGGTTTCCTGGAGATGGGGTGG + Intergenic
971217215 4:24672698-24672720 TTGCTCTCTCTGAGCTTGGGTGG + Intergenic
973366364 4:49212689-49212711 TTGGTCTCCCTGAGAGTGGCTGG - Intergenic
979420058 4:120493217-120493239 TTGGTATCCATGAGGTTGGGAGG - Intergenic
985591337 5:766974-766996 GTGGTCTCCCTGACAGTGGGTGG - Intergenic
985615919 5:922058-922080 GGGGTCTCCCTGAGATGCTGGGG - Intergenic
990106552 5:52270606-52270628 GTGGTCTACTTGAGGGTGGGAGG + Intergenic
994316638 5:98340326-98340348 TTGGTCCCCCTGGGAGTGGGTGG + Intergenic
995170815 5:109109635-109109657 GTGGTCCCCCTGAGATGCTGTGG - Intronic
995454438 5:112336572-112336594 CTGGTCCCCTTGTGATTGGGTGG + Intronic
998108236 5:139481933-139481955 GTGGTCTCCCTGGGTCTTGGTGG - Intronic
999323812 5:150630752-150630774 GTGCTCTTACTGAGCTTGGGTGG + Intronic
1001541270 5:172541426-172541448 CTGGCCTCCCTGTGATTGAGTGG + Intergenic
1004927910 6:20433152-20433174 GTGGACTCGCTGAGATTAAGGGG + Intronic
1005898710 6:30198953-30198975 GGCGGCTCCCTGAGATGGGGCGG + Exonic
1006805848 6:36788488-36788510 GTGGTCTGCCTAAGATTGCTGGG - Intronic
1009860579 6:69325977-69325999 GTGGACTACCTGAGCGTGGGTGG + Intronic
1012313351 6:97755562-97755584 TTGTTCTCCCTGAAATTGGGTGG + Intergenic
1013466196 6:110419059-110419081 GTGATCTCCCTGAGACTGCAGGG + Intergenic
1013743624 6:113318849-113318871 CTGGTGTTCCTGAGAGTGGGTGG + Intergenic
1016663151 6:146604479-146604501 TTGGTCTCCCTGGGAGTGGGTGG + Intronic
1018196685 6:161361594-161361616 GTGGTATCCCTGACAGTGGTGGG + Intronic
1019348288 7:541260-541282 GCGGGCTCCCTGGGGTTGGGTGG - Intergenic
1019646566 7:2132824-2132846 GTTGTCAACCTGAGATTTGGAGG - Intronic
1020124765 7:5527216-5527238 TTGGTCTCCCTGGGAGTGGGTGG - Exonic
1022506745 7:30912300-30912322 GGGGTGTCCCTGGGCTTGGGGGG + Intronic
1022631981 7:32093931-32093953 GTATTATCCCTGAGATTGAGAGG - Intronic
1026023160 7:66726338-66726360 GAGGCCTCCCAGAGATTAGGAGG + Intronic
1028638913 7:93021647-93021669 GTGCTTACCCTGAGATGGGGTGG + Intergenic
1033848258 7:145462165-145462187 GTGTTCTTCCCTAGATTGGGAGG + Intergenic
1034290475 7:149927152-149927174 TTGGTCTCCCTGGGAGTGGGTGG - Intergenic
1034660598 7:152765689-152765711 TTGGTCTCCCTGGGAGTGGGTGG + Intronic
1035333027 7:158108476-158108498 GGGGTTTCCCTGAAATGGGGTGG - Intronic
1036548209 8:9792452-9792474 GAGGTTTCCCTGAGCTGGGGAGG + Intergenic
1037885366 8:22593350-22593372 GTGGATTACCTGAGGTTGGGAGG + Intronic
1038551256 8:28471041-28471063 GTGTTCTCTCTCAGTTTGGGAGG + Intronic
1042721655 8:71833034-71833056 CTGGTGTCCTTCAGATTGGGTGG + Intronic
1044738076 8:95299514-95299536 GAGGTATCCCTGAGAGTGGAAGG + Intergenic
1045942330 8:107754084-107754106 GTGGTCTTCCTGTGGTTTGGAGG - Intergenic
1048358754 8:133676146-133676168 GTGGTCTCCCTAAGTTTAGGAGG + Intergenic
1049302021 8:141876227-141876249 ATGTTCTCCCTGAGAGTAGGCGG - Intergenic
1049389033 8:142358781-142358803 GTGGTCTCCCAGCGATGGGGGGG - Intronic
1049671441 8:143871837-143871859 GGGGTCCCCCTGAGAGTGGCAGG + Exonic
1049817008 8:144609121-144609143 ATGCTTTCCCTGAGATTAGGAGG - Intergenic
1051195722 9:14561439-14561461 GTGGGCTCTCTGAGGTGGGGTGG + Intergenic
1051689640 9:19696477-19696499 TTGGTATCCCTGAGTCTGGGAGG + Intronic
1053615214 9:39758641-39758663 GGGGCCTACCTGAGATTGGAGGG + Intergenic
1054238305 9:62583749-62583771 GGGGCCTACCTGAGATTGGAGGG - Intergenic
1054552435 9:66618269-66618291 GGGGCCTACCTGAGATTGGAGGG - Intergenic
1058084436 9:100733200-100733222 TTGGTGTCCCTGGGAGTGGGCGG + Intergenic
1060207534 9:121690973-121690995 GTGGGCTTGCTGAGATTGGCTGG - Intronic
1060229307 9:121814951-121814973 GTGGCCTCCCTGGGCGTGGGGGG + Intergenic
1062488468 9:136792579-136792601 GGGGTGCCCCTGAGATTGAGAGG + Intronic
1062498926 9:136844125-136844147 GTCCTCTCCCTGCGATGGGGCGG - Intronic
1185432117 X:17455-17477 GGGGTCTCCCTGTGGTTCGGAGG - Intergenic
1185441433 X:230169-230191 GGGGTCTCCCTGTGGTTCGGAGG - Intergenic
1185881667 X:3746714-3746736 TGGGTCTCCATGAGACTGGGAGG + Intergenic
1186165570 X:6822857-6822879 GGGGTCTACCTGAGAGTGGAGGG - Intergenic
1186415190 X:9377224-9377246 GGGGTCTACCTGAGGGTGGGGGG - Intergenic
1187245904 X:17552740-17552762 GTGGCCTCCCTGAAATAGAGAGG + Intronic
1189812653 X:44794825-44794847 TTGGTCTCCCTGGGAGTGGGTGG + Intergenic
1194284317 X:91990819-91990841 GTGGCCTCCCTGAACTTTGGGGG + Intronic
1195557055 X:106238773-106238795 GTGGTCTACATGACAGTGGGGGG + Intergenic